| Literature DB >> 29534734 |
Wei Jiang1,2,3,4,5, Min Guo1,2,3,4,5, Min Gong1,2,3,4, Li Chen1,2,3,4, Yang Bi1,2,3,4, Yun Zhang1,2,3,4, Yuan Shi1,2,3,4, Ping Qu1,2,3,4, Youxue Liu1,2,3,4, Jie Chen6,7,8,9, Tingyu Li10,11,12,13.
Abstract
Our previous studies demonstrated that vitamin A deficiency (VAD) can impair the postnatal cognitive function of rats by damaging the hippocampus. The present study examined the effects of retinoic acid (RA) on apoptosis induced by hypoxic-ischemic damage in vivo and in vitro, and investigated the possible signaling pathway involved in the neuroprotective anti-apoptotic effects of RA. Flow cytometry, immunofluorescence staining and behavioral tests were used to evaluate the neuroprotective and anti-apoptotic effects of RA. The protein and mRNA levels of RARα, PI3K, Akt, Bad, caspase-3, caspase-8, Bcl-2, Bax, and Bid were measured with western blotting and real-time PCR, respectively. We found impairments in learning and spatial memory in VAD group compared with vitamin A normal (VAN) and vitamin A supplemented (VAS) group. Additionally, we showed that hippocampal apoptosis was weaker in the VAN group than that in VAD group. Relative to the VAD group, the VAN group also had increased mRNA and protein levels of RARα and PI3K, and upregulated phosphorylated Akt/Bad levels in vivo. In vitro, excessively low or high RA signaling promoted apoptosis. Furthermore, the effects on apoptosis involved the mitochondrial membrane potential (MMP). These data support the idea that sustained VAD following hypoxic-ischemic brain damage (HIBD) inhibits RARα, which downregulates the PI3K/Akt/Bad and Bcl-2/Bax pathways and upregulates the caspase-8/Bid pathway to influence the MMP, ultimately producing deficits in learning and spatial memory in adolescence. This suggests that clinical interventions for HIBD should include suitable doses of VA.Entities:
Keywords: Apoptosis; Hypoxic-ischemic brain damage (HIBD); Mitochondrial membrane potential (MMP); PI3K/Akt; Retinoic acid (RA); Vitamin A (VA)
Mesh:
Substances:
Year: 2018 PMID: 29534734 PMCID: PMC5851324 DOI: 10.1186/s13041-018-0360-0
Source DB: PubMed Journal: Mol Brain ISSN: 1756-6606 Impact factor: 4.041
Fig. 1The learning ability and spatial memory of the VAD, VAN and VAS groups. a The escape latency of all the groups. b The path length of all the groups. c The passing times of all the groups. d The swimming speed levels between the four groups. e A representative trace of VAD group. f A representative trace of VAN group. g A representative trace of VAS group. h A representative trace of control group. i The active avoidance response rates of the four groups. j The passive avoidance response rates of the four groups. k The none avoidance response rates of the four groups. The data are expressed as the means ± SEM, N = 20, aP ≤ 0.05, bP ≤ 0.01, cP ≤ 0.05, dP ≤ 0.01
Fig. 2A comparison of hippocampal cell apoptosis between the VAN and VAD groups on post-HIBD days 3 and 7. a VAD DG area b VAN DG area c VAD CA3 area d VAN CA3 area e VAD CA1 area f VAN CA1 area. The yellow arrows indicate TUNEL-positive cells. g The number of apoptotic cells in different areas of the two groups.The data are expressed as the means ± SEM, N = 9, *P ≤ 0.05, **P ≤ 0.01
Fig. 3RA modulates the PI3K/Akt pathway to influence apoptosis via RARα signaling in vivo. a The mRNA expressions of RARα in the VAN and VAD groups on P3~ 14. b The mRNA expressions of PI3K in the two groups. c The mRNA expressions of Akt in the two groups. d The mRNA expression levels of Bad in the two groups. e The protein expression levels of RARα, PI3K, Akt, p-Akt, Bad and p-Bad between the two groups in different stages. The data are expressed as the means ± SEM, N = 9, *P ≤ 0.05, **P ≤ 0.01
Fig. 4Hippocampal mRNA and protein levels of the apoptosis pathway in the VAD and VAN groups. a The mRNA expression levels of Bcl-2 in the VAN and VAD groups on P3~ 14. b The mRNA expression levels of Bax in the two groups. c The mRNA expression levels of caspase-8 in in the two groups. d The mRNA expression levels of Bid in the two groups. e The mRNA expression levels of caspase-3 in the two groups. f The protein expression levels of Bcl-2, Bax, caspase-8, Bid, and caspase-3 between the two groups in different stages. g The caspase-3 protein activities in the cytoplasm of the VAD and VAN groups. h The caspase-8 protein activities in the cytoplasm of the two groups. The data are expressed as the means ± SEM, N = 9, *P ≤ 0.05, **P ≤ 0.01
Fig. 5The apoptosis rate of primary neurons injured by OGD at different concentrations of RA. a Flow cytometry for apoptosis in primary hippocampal neurons after 0~ 40 μmol/L RA treatment. b A comparison of apoptosis rates for different concentrations of RA. The data are expressed as the means ± SEM, N = 5, *P ≤ 0.05, **P ≤ 0.01
Fig. 6The apoptosis rate of primary neurons injured by OGD at different RA receptor levels. a Flow cytometry for apoptosis in primary hippocampal neurons at different RA receptor levels. The UR (upper right) and LR (lower right) quadrants represent apoptotic cells. b A comparison of apoptosis rates for the different RA receptor levels. The data are expressed as the means ± SEM, N = 5, *P ≤ 0.05, **P ≤ 0.01
Fig. 7The rate of abnormal mitochondrial membrane potential in primary neurons injured by OGD at different RA receptor levels. a Flow cytometric measurement of the rate of abnormal MMP at different RA receptor levels. The lower quadrants represent cells with abnormal MMP. b A comparison of the rates of abnormal MMP for the different RA receptor levels. The data are expressed as the means ± SEM, N = 5, *P ≤ 0.05, **P ≤ 0.01
Fig. 8mRNA and protein levels of the PI3K/Akt signaling pathway in primary hippocampal neurons after OGD injury. a With different RA receptor levels, the mRNA expressions of RARα and PI3K in the different groups. b With different RA receptor levels, the mRNA expressions of Akt and Bad in the different groups. c, d With different RA receptor levels, the protein expression levels of RARα, PI3K, Akt, p-Akt, p-Bad and Bad among all the intervention groups. The data are expressed as the means ± SEM, N = 5, *P ≤ 0.05, **P ≤ 0.01
Fig. 9mRNA and protein levels of apoptosis-related signaling molecules in primary hippocampal neurons after OGD injury. a With different RA receptor levels, the mRNA expressions of caspase-3, Bid and Bax in the different groups. b The mRNA expression levels of caspase-8 and Bcl-2 in different groups. c The protein expression levels of caspase-3, Bid, Bax and caspase-8 between the different groups. d The protein activities of caspase-3 and caspase-8 between the different groups. The data are expressed as the means ± SEM, N = 5, *P ≤ 0.05, **P ≤ 0.01
| RARα | Fwd: 5′CAGGAGGGAGAAGGCAGTGAC3′ |
|---|---|
| caspase-8 | Fwd: 5′GGCAGCCAGTTCTTCGTT3′ |
| caspase-3 | Fwd: 5′GGGTGCGGTAGAGTAAGC3′ |
| Bid | Fwd: 5′CCTGGAAATAGGGAGACG3′ |
| Bax | Fwd: 5′AAGTAGAAGAGGGCAACCAC3′ |
| Bcl-2 | Fwd: 5′CGGGAGAACAGGGTATGA3′ |
| PI3K | Fwd: 5′CTGGAAGCCATTGAGAAG3′ |
| Akt | Fwd: 5′CTCTTCTTCCACCTGTCTCG3′ |
| Bad | Fwd: 5′CAGGCAGCCAATAACAGT3′ |
| β-actin | Fwd: 5′GCATAGCCACGCTTGTTCTTGAAG3′ |