Literature DB >> 29527419

Genetic analysis of 'Candidatus Phytoplasma aurantifolia' associated with witches' broom on acid lime trees.

Aisha G Al-Ghaithi1, Ali M Al-Subhi1, Issa H Al-Mahmooli1, Abdullah M Al-Sadi1.   

Abstract

"Candidatus Phytoplasma aurantifolia" is associated with witches' broom disease of lime in Oman and the UAE. A previous study showed that an infection by phytoplasma may not necessarily result in the physical appearance of witches' broom symptoms in some locations in Oman and the UAE. This study investigated whether phytoplasma strains belonging to "Ca. P. aurantifolia" (based on the 16S rRNA gene analysis) in locations where disease symptoms are expressed are different from phytoplasma in locations where disease symptoms are not expressed. About 21 phytoplasma strains (15 from areas and trees with disease symptoms and six from areas and trees without disease symptoms) were included in the analysis. The study utilized sequences of the imp and SAP11 genes to characterize the 21 strains. Phylogenetic analysis of both genes showed that the 21 strains are similar to each other and to reference strains in GenBank. The study shows that there is a low level of diversity among all phytoplasma strains. In addition, it shows that phytoplasma in places where witches' broom symptoms are not expressed are similar to phytoplasma in places where disease symptoms are expressed. This may suggest that disease expression is not linked to the presence of different phytoplasma strains, but may be due to other factors such as weather conditions.

Entities:  

Keywords:  Acid lime; Oman; Phylogeny; WBDL

Year:  2018        PMID: 29527419      PMCID: PMC5842765          DOI: 10.7717/peerj.4480

Source DB:  PubMed          Journal:  PeerJ        ISSN: 2167-8359            Impact factor:   2.984


Introduction

Phytoplasmas are prokaryotic gram-positive bacteria that are difficult to be cultured in artificial media (Contaldo et al., 2012, 2016). They are phloem limited and transmitted by phloem-sucking insects of the order Hemiptera, mostly leafhoppers (Cicadellidae), planthoppers (Fulgoroidea), and psyllids (Psyllidae) (Frost et al., 2013; Rashidi et al., 2014; Queiroz et al., 2016). They have a wide range of host plants from over 100 plant families, including many citrus species (Hogenhout et al., 2008). Symptoms produced by “Candidatus Phytoplasma aurantifolia” on acid lime trees include excessive production of shoots with very small, light green leaves and short internodes, no flowers or fruits, and the general decline of the tree leading to a final dieback. Witches’ broom symptoms progress rapidly from the time of symptom appearance until the final stage of tree death where the tree collapses within four to five years after first symptom appearance (Al-Sadi et al., 2012; Al-Yahyai et al., 2015). A previous study showed that the association of “Ca. P. aurantifolia” with acid lime results in witches’ broom symptoms in some geographical locations but not in others (Al-Ghaithi et al., 2017). The study found the symptoms were apparent in most areas in Oman except in monsoon areas or areas with extreme desert conditions. Although this may be in part related to differences in climatic conditions between these areas, it is necessary to characterize the phylogenetic association and diversity of phytoplasma that are present in locations which are conducive and less conducive to witches’ broom symptom expression. The identification and characterization of phytoplasma has long relied on the use of the 16S rRNA gene (Mehdi et al., 2012). However, other molecular markers have been developed which include the Tuf, SecA, SecY, SAP11, imp, and other genes (Sugio et al., 2011; Bekele et al., 2011; Dickinson & Hodgetts, 2013; Al-Abadi et al., 2016). Immunodominant membrane proteins (imp) genes are more variable than their surrounding genes in phytoplasma. They are located on the external surface of phytoplasma cell membrane (Siampour et al., 2012). SAP11 is an effector protein that targets plant cell nuclei (Bai et al., 2009) and induces stem proliferation, changes in leaf shape, and the down regulation of jasmonic acid production. Our previous work compared phytoplasma across countries (Al-Abadi et al., 2016) using three genes but only from one area (subtropical). In addition, a recent study by our group compared phytoplasma across different conditions using one gene (16S rRNA) but from three areas (semitropical, subtropical, and desert) (Al-Ghaithi et al., 2017). The aim of our current study was to investigate the genetic relatedness of phytoplasma across different conditions (semitropical, subtropical, and desert) using two additional genes (imp and SAP11) that were not used in 2017. The study helped to determine whether the difference in witches’ broom symptom expression in different geographical regions could be related to the presence of different phytoplasma strains.

Materials and Methods

Sample collection

Fifteen samples positive for phytoplasma from trees developing WBD symptoms and six samples collected from asymptomatic trees from areas with no apparent WBD symptoms were included in the study. The choice of samples was based on our previous findings (Al-Ghaithi et al., 2017). The 21 samples were collected from 11 different locations, two samples from a semitropical area (Salalah), four samples from desert areas (Najed and UAE), and 15 samples from subtropical areas (Fig. 1). Samples were collected from young leaves developing WBD symptoms.
Figure 1

A map showing the locations from which samples were collected.

See Table 2 for more details.

A map showing the locations from which samples were collected.

See Table 2 for more details.
Table 2

GenBank accession numbers and characteristics of 21 phytoplasma isolates used in the study.

No.Sample codeName of the regionEnvironmentYear of collectionGenBank accession numbers
16S rRNAimpSAP11
1S2SalalahSemitropical2014KX602312KY829473KY829493
2S3SalalahSemitropical2014KX602309KY829474KY829494
3D1NajedDesert2014KX602311KY829475KY829495
4D2NajedDesert2014KX602290KY829476KY829496
5D3UAEDesert2015KX602307KY829477KY829497
6D4UAEDesert2015KX602308KY829478KY829498
7W1MahadaSubtropical2014KX602293KY829479KY829499
8W2MahadaSubtropical2014KX602294KY829480KY829500
9W3MahadaSubtropical2014KX602310KY829481KY829501
10W4MadhaSubtropical2014KX602295KY829482KY829502
11W5MadhaSubtropical2014KX602296KY829483KY829503
12W6RustaqSubtropical2014KX602298KY829484KY829504
13W7RustaqSubtropical2014KX602313KY829485KY829505
14W8BarkaSubtropical2014KX602299KY829486KY829506
15W9BarkaSubtropical2014KX602300KY829487KY829507
16W10SurSubtropical2014KX602301KY829488KY829508
17W11SurSubtropical2014KX602302KY829489KY829509
18W12NizwaSubtropical2014KX602303KY829490KY829510
19W13NizwaSubtropical2014KX602304KY829491KY829511
20W14DhankSubtropical2014KX602305KY829492KY829512
21W15DhankSubtropical2014KX602306KY829473KY829513

Nucleic acid extraction and polymerase chain reaction

Total nucleic acids were extracted following the method of Doyle & Doyle (1987) in CTAB extraction buffer. Ground leaves mixed with CTAB buffer were incubated at 65 °C for 10 min. This was followed by adding an equal amount of phenol:chloroform:isoamyl alcohol (25:24:1) and centrifugation (this step was repeated twice). Then 0.6 volume of isopropanol and 0.3M NaAc (pH 5.2) was added to the supernatant. The DNA pellets were washed with 70% ethanol, dried and then resuspended in 100 μl sterilized distilled water and stored at −80 °C. The 21 strains have already been characterized in our previous study based on the 16S rRNA (Table 1) and were found to belong to the 16S rRNA subgroup II-B (Al-Ghaithi et al., 2017). Therefore, polymerase chain reaction (PCR) were conducted for the imp and SAP11 genes as described by Al-Subhi et al. (2017). Imp-R1, Imp-F1, and Imp-F2 primers were used for the amplification of the imp gene using a two-stage PCR. Imp (F1) and Imp (R1) were used in direct PCR, while Imp (F2)/Imp (R1) were used in seminested PCR (Table 1). Amplification of the SAP11 gene was done using the primers SAP11-W-F1 and SAP11-W-R1 in direct PCR. The primer pair SAP11-W-F2/SAP11-W-R2 was used in nested PCR (Table 1). The PCR conditions for both genes in the direct and nested/seminested PCR were adjusted to the same conditions as follows: 94 °C for 2 min, then 40 cycles (94 °C for 30 s, 53 °C for 45 s, and 72 °C for 1:30 s), followed with final extension at 72 °C for 10 min.
Table 1

Primers used for amplifying Phytoplasma genes.

GenePrimer name5′-3′ SequenceProduct size (bp)Reference
impimp-FGTTATAATTGAAGGCGATA-TTG519Al-Subhi et al. (2017)
imp-F2ATAGAGGAGAAGAAAAAGTTTC
imp-RGATCATATTTGGTTTATAGGAG
SAP11SAP11-w-F1CTTCAGCCACAAATAGAATCTTT1,050Al-Subhi et al. (2017)
SAP11-w-R1CAAATACAAATCGCTGCATAAA
SAP11-w-F2TTCCTTTTATGAAATCACCTCAG∼550
SAP11-w-R2GCGCATATTATTAAACTCCTTT

Note:

Al-Subhi et al. (2017).

Note: Al-Subhi et al. (2017).

Sequencing and analysis of sequences

Sequencing was carried out at MACROGEN Inc., Korea, using the same primers used in the nested PCR. The forward and reverse sequences for each phytoplasma isolate were aligned and edited using ChromasPro (v. 1.41; Technelysium Pty Ltd., Brisbane, Queensland, Australia). Phylogenetic analysis of the obtained sequences and representative sequences from GenBank for the different subgroups of phytoplasma was carried out using the Kimura 2-parameter evolutionary model in Mega 6 (Tamura et al., 2013). Trees were generated using 1,000 replications and a 50% majority-rule for the bootstrap analysis.

Results

Phylogenetic analysis of phytoplasma strains based on SAP11 gene

Amplification using the primer pair SAP11-w-F2/and SAP11-w-R2 produced a fragment of 339 bp (Fig. 2). Sequencing of the PCR products followed by phylogenetic analysis based on SAP11 gene sequences showed that all samples clustered together with the reference isolates belonging to “Ca. P. aurantifolia” (Fig. 3). All strains from Oman clustered with the reference isolate with a very high bootstrap support (100%), and were separated from all other closely related strains.
Figure 2

(A) Nested PCR of SAP11 gene using SAP11 F2/R2 showing 339 bp DNA fragment size. (B) Seminested PCR of IMP gene using IMP F2/R1 showing 519 bp for some samples from monsoon areas (semitropical), desert, and subtropical areas.

Figure 3

Phylogenetic analysis using the SAP11 gene of phytoplasma strains sampled in acid lime trees grown in desert areas (circle), semitropical areas (triangle), and subtropical areas (square).

The tree was constructed by the neighbor-joining method using Kimura’s two-parameter mode. Sequences of the 21 strains from Oman were compared to a worldwide collection of strain sequences from different phytoplasma groups obtained from GenBank.

(A) Nested PCR of SAP11 gene using SAP11 F2/R2 showing 339 bp DNA fragment size. (B) Seminested PCR of IMP gene using IMP F2/R1 showing 519 bp for some samples from monsoon areas (semitropical), desert, and subtropical areas.

Phylogenetic analysis using the SAP11 gene of phytoplasma strains sampled in acid lime trees grown in desert areas (circle), semitropical areas (triangle), and subtropical areas (square).

The tree was constructed by the neighbor-joining method using Kimura’s two-parameter mode. Sequences of the 21 strains from Oman were compared to a worldwide collection of strain sequences from different phytoplasma groups obtained from GenBank.

Phylogenetic analysis of phytoplasma strains based on the imp gene

The primer pair ImpF2/Imp R1 resulted in a product of 519 bp in size (Fig. 2). Phylogenetic analysis of the 21 samples and three reference sequences from GenBank showed that all samples clustered with the references strains with a very high bootstrap support (100%) (Fig. 4).
Figure 4

Phylogenetic analysis using the imp gene of phytoplasma strains sampled in acid lime trees grown in desert areas (circle), semitropical areas (triangle), and subtropical areas (square).

The tree was constructed by the neighbor-joining method using Kimura’s two-parameter mode. Sequences of the 19 strains from Oman were compared to a worldwide collection of strain sequences from different phytoplasma groups obtained from GenBank.

Phylogenetic analysis using the imp gene of phytoplasma strains sampled in acid lime trees grown in desert areas (circle), semitropical areas (triangle), and subtropical areas (square).

The tree was constructed by the neighbor-joining method using Kimura’s two-parameter mode. Sequences of the 19 strains from Oman were compared to a worldwide collection of strain sequences from different phytoplasma groups obtained from GenBank. Phylogenetic analysis of 21 isolates based on the combined Imp and SAP11 gene sequences showed clustering of all the isolates in one cluster (Fig. 5). GenBank accession numbers for all samples are illustrated in Table 2.
Figure 5

Phylogenetic analysis of 21 isolates sampled in acid lime trees grown in desert areas (circle), semitropical areas (triangle), and subtropical areas (square) based on the combined Imp and SAP11 gene sequences.

Discussion

Phytoplasmas of the taxonomic group 16SrII (peanut witches’ broom phytoplasma group) are associated with diseases affecting crops and wild plants in different geographical areas worldwide. “Ca. P. aurantifolia,” from the taxonomic subgroup 16SrII-B, causes a devastating and lethal disease of lime (Lime witches’ broom) in Gulf countries (Oman, UAE, and Saudi Arabia). Phytoplasma inducing a similar witches’ broom disease were reported in different host plants such as alfalfa (Khan et al., 2002) and sesame (Al-Sakeiti et al., 2005). Furthermore, the 16Sr II group was detected in other crops in the Middle East including Iran and Lebanon (Weintraub & Jones, 2010), the Mediterranean region (Tolu et al., 2006), Australia (Aryamanesh et al., 2011), Mexico (Hernandez-Perez et al., 2009), Indonesia (Harling et al., 2009), Europe (Tolu et al., 2006; Davino et al., 2007; Parrella et al., 2008; Harling et al., 2009), and Sudan (Zamora, Acosta & Martínez, 2012). Candidatus Phytoplasma aurantifolia” was reported in Oman, the UAE, Iran, and other countries (Bové et al., 2000; Chung, Khan & Brlansky, 2006; Al-Ghaithi et al., 2016). However, our previous findings showed that symptom expression due to WBD is not apparent in some areas, especially deserts and monsoon areas (Al-Ghaithi et al., 2017). Although it was clear that there was a relationship between symptom expression and geography, it was questioned whether phytoplasma infecting trees expressing WBD symptoms could be the same as phytoplasmas from trees not expressing WBD symptoms. Phylogenetic analysis showed that all phytoplasma isolates share the same sequences of the imp and SAP11 genes. This resulted in a lack of clustering of phytoplasma isolates from different climatic conditions, showing that phytoplasma from symptomatic and asymptomatic trees have the same imp and SAP11 gene sequence. Previous studies using the 16S rRNA gene showed limited variation between phytoplasmas which belong to the same group (Bertaccini & Duduk, 2009). Similarly, low variation was detected between different isolates of “Ca. P. aurantifolia” from three different countries (Oman, UAE, and Iran) based on sequences of the 16s rRNA, secA, and imp genes. These three genes could not separate strains based on the country from which they were obtained. Findings from our study were in agreement with Al-Abadi et al. (2016) who showed limited variation in the imp gene. Although the SAP11 gene is associated with symptom induction (Sugio et al., 2011), no differences were found in the sequence of this gene between isolates obtained from areas with or without WBD expression. Thus, this result and the above results confirm that all phytoplasma isolates are identical and have low genetic diversity. They do not support the possible presence of different phytoplasma strains in the studied locations and trees.

Conclusion

This study shows that WBD phytoplasma from semitropical areas, subtropical areas, and desert areas share a very high level of genetic similarity based on imp and SAP11 genes. This gives indication that acid lime trees in these locations are affected by the same phytoplasma strain, but symptom development is affected by environmental factors rather than by phytoplasma strains. Also, symptom development can be affected by other parameters such as soil moisture or/and plant cultivars or/and cultural practices or even coinfection with other pathogens/strains. Future studies should address the relationship between symptom expression in acid lime and other possible factors.
  11 in total

1.  Phytoplasma protein effector SAP11 enhances insect vector reproduction by manipulating plant development and defense hormone biosynthesis.

Authors:  Akiko Sugio; Heather N Kingdom; Allyson M MacLean; Victoria M Grieve; Saskia A Hogenhout
Journal:  Proc Natl Acad Sci U S A       Date:  2011-11-07       Impact factor: 11.205

2.  Phytoplasmas: bacteria that manipulate plants and insects.

Authors:  Saskia A Hogenhout; Kenro Oshima; El-Desouky Ammar; Shigeyuki Kakizawa; Heather N Kingdom; Shigetou Namba
Journal:  Mol Plant Pathol       Date:  2008-07       Impact factor: 5.663

3.  MEGA6: Molecular Evolutionary Genetics Analysis version 6.0.

Authors:  Koichiro Tamura; Glen Stecher; Daniel Peterson; Alan Filipski; Sudhir Kumar
Journal:  Mol Biol Evol       Date:  2013-10-16       Impact factor: 16.240

4.  Development and evaluation of different complex media for phytoplasma isolation and growth.

Authors:  N Contaldo; E Satta; Y Zambon; S Paltrinieri; A Bertaccini
Journal:  J Microbiol Methods       Date:  2016-06-01       Impact factor: 2.363

5.  Molecular identification of a new phytoplasma associated with alfalfa witches'-broom in oman.

Authors:  A J Khan; S Botti; A M Al-Subhi; D E Gundersen-Rindal; A F Bertaccini
Journal:  Phytopathology       Date:  2002-10       Impact factor: 4.025

6.  Seasonal patterns of aster leafhopper (Hemiptera: Cicadellidae) abundance and aster yellows phytoplasma infectivity in Wisconsin carrot fields.

Authors:  K E Frost; P D Esker; R Van Haren; L Kotolski; R L Groves
Journal:  Environ Entomol       Date:  2013-06       Impact factor: 2.377

7.  AY-WB phytoplasma secretes a protein that targets plant cell nuclei.

Authors:  Xiaodong Bai; Valdir R Correa; Tania Y Toruño; El-Desouky Ammar; Sophien Kamoun; Saskia A Hogenhout
Journal:  Mol Plant Microbe Interact       Date:  2009-01       Impact factor: 4.171

8.  Classification of a new phytoplasmas subgroup 16SrII-W associated with Crotalaria witches' broom diseases in Oman based on multigene sequence analysis.

Authors:  Ali Al-Subhi; Saskia A Hogenhout; Rashid A Al-Yahyai; Abdullah M Al-Sadi
Journal:  BMC Microbiol       Date:  2017-11-25       Impact factor: 3.605

9.  Invasive mutualisms between a plant pathogen and insect vectors in the Middle East and Brazil.

Authors:  Renan Batista Queiroz; Philip Donkersley; Fábio Nascimento Silva; Issa Hashil Al-Mahmmoli; Abdullah Mohammed Al-Sadi; Claudine Márcia Carvalho; Simon L Elliot
Journal:  R Soc Open Sci       Date:  2016-12-07       Impact factor: 2.963

10.  Increased sodium and fluctuations in minerals in acid limes expressing witches' broom symptoms.

Authors:  Aisha G Al-Ghaithi; Muhammad Asif Hanif; Walid M Al-Busaidi; Abdullah M Al-Sadi
Journal:  Springerplus       Date:  2016-04-06
View more
  1 in total

1.  Assessing the Impact of Climate Change on the Distribution of Lime (16srii-B) and Alfalfa (16srii-D) Phytoplasma Disease Using MaxEnt.

Authors:  Amna M Al Ruheili; Alaba Boluwade; Ali M Al Subhi
Journal:  Plants (Basel)       Date:  2021-02-28
  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.