Morphogenetic defects underlie Superior Coloboma, a newly identified closure disorder of the dorsal eye.

The eye primordium arises as a lateral outgrowth of the forebrain, with a transient fissure on the inferior side of the optic cup providing an entry point for developing blood vessels. Incomplete closure of the inferior ocular fissure results in coloboma, a disease characterized by gaps in the inferior eye and recognized as a significant cause of pediatric blindness. Here, we identify eight patients with defects in tissues of the superior eye, a congenital disorder that we term superior coloboma. The embryonic origin of superior coloboma could not be explained by conventional models of eye development, leading us to reanalyze morphogenesis of the dorsal eye. Our studies revealed the presence of the superior ocular sulcus (SOS), a transient division of the dorsal eye conserved across fish, chick, and mouse. Exome sequencing of superior coloboma patients identified rare variants in a Bone Morphogenetic Protein (Bmp) receptor (BMPR1A) and T-box transcription factor (TBX2). Consistent with this, we find sulcus closure defects in zebrafish lacking Bmp signaling or Tbx2b. In addition, loss of dorsal ocular Bmp is rescued by concomitant suppression of the ventral-specific Hedgehog pathway, arguing that sulcus closure is dependent on dorsal-ventral eye patterning cues. The superior ocular sulcus acts as a conduit for blood vessels, with altered sulcus closure resulting in inappropriate connections between the hyaloid and superficial vascular systems. Together, our findings explain the existence of superior coloboma, a congenital ocular anomaly resulting from aberrant morphogenesis of a developmental structure.

Introduction

Aberrant ocular morphogenesis during embryonic development frequently results in reduced visual acuity or blindness. Morphological development of the eye begins with evagination of retinal precursors from the forebrain to produce bilateral optic vesicles and subsequent invagination of the associated ectoderm to create the lens [1,2]. Each optic vesicle reorganizes into a bilayered optic cup, with the distal (lens-facing) layer forming the presumptive neural retina and the proximal layer forming the retinal pigmented epithelium (RPE). To provide an entry point for vasculature and an exit pathway for axons of the optic nerve, a transient inferior (choroid) fissure forms along the ventral/inferior side of the optic cup and stalk. In cases where the inferior fissure fails to close, gaps remain within tissues of the eye (iris, retina, choroid and/or occasionally lens) [3,4]. This congenital anomaly, referred to as ocular coloboma, is estimated to occur in 1 out of 4–5,000 live births and cause 3–11% of pediatric blindness [4,5]. Ocular coloboma has a complex causality encompassing mutations in over 20 genes [5,6]. Although both clinically and genetically heterogeneous, coloboma predominantly affects the inferior aspect of the eye.

The posterior segment of the developing eye receives two vascular supplies [7]. The transient hyaloid vasculature is a plexus between the retina and lens, and is connected to the hyaloid artery, which enters the eye via the inferior fissure. A second circulatory system, the choroidal vasculature, grows over the surface of the optic cup to nourish the RPE and the light-sensing photoreceptor cells in the outer retina. Although development of the choroidal vessels is poorly understood, zebrafish studies demonstrated that the complex choroidal vascular plexus is preceded by a simple set of pioneer vessels [8,9]. To form this so-called superficial vascular system (distinct from the superficial retinal vessels and also known as the ciliary vasculature), three radial vessels grow over the optic cup and anastomose to create an annular vessel encircling the lens. The highly stereotypical formation of the superficial vessels suggests precise developmental regulation, but the mechanisms that guide their growth are currently unknown.

In the context of studying a large cohort of patients with ocular coloboma, we identified five local patients with a novel ocular anomaly characterized by gaps in tissues of the superior eye. Although it is logical that such an anomaly represents another fissure disorder, common models of vertebrate eye development do not feature a division in the embryonic dorsal/superior eye. However, a careful examination of zebrafish, chick, and mouse eye development did reveal a transient groove, or sulcus, bisecting the dorsal optic cup. Moreover, we utilized patient exome sequencing and zebrafish models to define the importance of dorsal-ventral patterning in morphogenesis of this ocular sulcus. Functionally, the superior ocular sulcus serves as a conduit for the advancing first vessel of the superficial vasculature, and we note profound errors in vascular growth and connectivity in embryos with abnormal sulci.

Results

Identification of patients with superior coloboma

Over a six-year period (2007–2012), we identified five local patients with superior ocular defects affecting the iris, lens, retina, optic nerve and/or sclera (Fig 1 and S1 Table); notably, these were unassociated with a family history of such anomalies. On the basis of apparent similarity to coloboma (gaps in inferior/ventral ocular tissue), yet inverse orientation, we propose the term superior coloboma to describe this disorder. The first patient, with tuberous sclerosis attributable to a rare TSC2 (c.C5026T; p.R1676W) mutation, exhibited a prominent unilateral iris coloboma situated at 12 o'clock. Bilateral disease was present in a single patient (#2), and involved both iris and lens (Fig 1, images 2 and 3). Two of the five patients were diagnosed in infancy, and for one (#4), examination under anesthesia was required to fully characterize pathology. As is evident from Fig 1, the diversity of tissue involvement in superior colobomata recapitulates that present in inferior colobomata. We subsequently received, from pediatric ophthalmologists at US and UK tertiary referral centers, clinical data on three further patients with superior colobomata. These cases extended the range of associated phenotypes to include additional structural ocular malformations (microphthalmia, or small eye; #8). All eight patients in our cohort had profoundly reduced visual acuity, precluding normal stereopsis.

Fig 1

Superior coloboma.

Montage from patients with superior coloboma (numbers represent patients described in S1 Table). #1: unilateral superior iris coloboma. #2: first panel, asymmetrically-sized iris defects with bilateral pupil involvement, left eye shown; second panel, superior lenticular coloboma (asterisk) associated with a lens zonule defect. #3: lenticular coloboma, lens edge visible with retro-illumination. #4: superior scleral defect with uveal (choroid) protrusion. #5: superior retino-choroidal coloboma extending from optic disc in patient with Dandy-Walker Syndrome. #6: first panel, iris coloboma; second panel, edge of retino-chorodial coloboma (asterisk). #7: extensive retino-choroidal coloboma. #8: intra-operative photograph of a superior iris coloboma in a microphthalmic eye.

Exome sequencing of superior coloboma patients

To identify candidate genetic variants carried by superior coloboma patients, exome sequencing was performed on the initial five probands (S2 Table). Identified variants were prioritized by comparison to SNP databases (frequency <1%), in silico prediction algorithms (Mutation Taster >0.95) and expression within the developing eye or previously identified connections to coloboma (see methods). We focused our efforts on understanding genetic alterations in the single patient with bilateral superior coloboma (#2, Table 1). In particular, we noticed that patient #2 carries compound heterozygous variants in the Retinoic Acid (RA) synthesis gene CYP1B1 [10](S1A Fig) as well as a rare (dbSNP: 1 in 60,706; NHLBI and 1000 Genomes: 0 in 14,000) missense variant in Bone Morphogenetic Protein Receptor 1A (BMPR1A, S1B and S1C Fig). As RA and BMPs are morphogens with essential roles in eye development, including regulation of inferior fissure closure [11-17], we hypothesized that the identified mutations contributed to the patient’s ocular disorders. In order to examine how disruption of eye patterning genes could lead to superior coloboma, we next turned to animal models and conducted an in depth analysis of dorsal eye morphogenesis.

Table 1

Select genetic variants identified in superior coloboma patient #2.

Gene	Type	Variant	Mutation Taster
ACVRL1	nonsynonymous SNV	NM_001077401:c.C1445T:p.A482V	0.999706
ASPM	nonsynonymous SNV	NM_018136:c.C4213T:p.R1405C	0.999919
SYNE1	nonsynonymous SNV	NM_033071:c.G12229C:p.D4077H	0.990532
TLR10	nonsynonymous SNV	NM_001017388:c.T1255C:p.W419R	0.989287
CD36	stopgain SNV	NM_001127444:c.T1079G:p.L360X	1
COL10A1	nonsynonymous SNV	NM_000493:c.T23G:p.L8W	0.998959
CTSC	nonsynonymous SNV	NM_001814:c.A1088C:p.E363A	0.999985
CYP1A1	nonsynonymous SNV	NM_000499:c.C712T:p.P238S	0.999742
CYP1A1	nonsynonymous SNV	NM_000499:c.T857C:p.I286T	0.99848
CYP1B1	nonsynonymous SNV	NM_000104:c.G1103A:p.R368H	0.970216
DHRS9	nonsynonymous SNV	NM_001142271:c.G856C:p.D286H	0.99818
DHX38	nonsynonymous SNV	NM_014003:c.A2947G:p.I983V	0.999192
DOCK5	nonsynonymous SNV	NM_024940:c.G2698A:p.E900K	0.993012
DSCAM	nonsynonymous SNV	NM_001389:c.G701A:p.R234H	0.979737
EAF1	nonsynonymous SNV	NM_033083:c.G619A:p.D207N	0.976956
FURIN	nonsynonymous SNV	NM_002569:c.G1343A:p.R448Q	0.997805
HHIP	nonsynonymous SNV	NM_022475:c.C1762T:p.P588S	0.999972
IFT57	nonsynonymous SNV	NM_018010:c.A1232G:p.N411S	0.991636
LAMA4	nonsynonymous SNV	NM_001105206:c.G3239A:p.R1080Q	0.997947
LAMA5	nonsynonymous SNV	NM_005560:c.G10411A:p.G3471S	0.999959
LAMC2	nonsynonymous SNV	NM_005562:c.C2080T:p.R694C	0.994374
LRP2	nonsynonymous SNV	NM_004525:c.G13803A:p.M4601I	0.999811
MCM5	nonsynonymous SNV	NM_006739:c.G375C:p.Q125H	0.999992
MKS1	stopgain SNV	NM_001165927:c.C478T:p.R160X	1
MMP2	nonsynonymous SNV	NM_001127891:c.C1481T:p.S494L	0.994768
MMP9	nonsynonymous SNV	NM_004994:c.A344G:p.K115R	0.985048
NCOR1	nonsynonymous SNV	NM_001190440:c.G6956A:p.R2319Q	0.966004
NEUROD1	nonsynonymous SNV	NM_002500:c.C590A:p.P197H	0.999982
PCDH15	stopgain SNV	NM_001142767:c.T1283G:p.L428X	1
PLXNA3	nonsynonymous SNV	NM_017514:c.A3440G:p.K1147R	0.996782
SIPA1L1	nonsynonymous SNV	NM_015556:c.C3056T:p.T1019M	0.99995
SLIT2	nonsynonymous SNV	NM_004787:c.G4333C:p.D1445H	0.993067
SOD2	nonsynonymous SNV	NM_000636:c.G198C:p.E66D	0.999998
SYNE1	nonsynonymous SNV	NM_033071:c.G12229C:p.D4077H	0.990532
TLR10	nonsynonymous SNV	NM_001017388:c.T1255C:p.W419R	0.989287

Vertebrate studies of dorsal ocular morphogenesis

Inferior coloboma arises from failed closure of the choroid fissure located in the ventral eye. Given the comparable phenotype despite opposite orientation seen in superior coloboma patients, we hypothesized a similar etiology. Although the standard model of eye development describes an uninterrupted dorsal retina, two older studies of fish eye development identified a groove present in this space [18,19]. To determine if such a structure exists broadly across vertebrates and whether it is a Laminin-lined space, we chose to revisit the study of dorsal eye morphogenesis in fish, chick and mouse. Using multiple microscopy methods, we identified a transient groove/sulcus in the dorsal zebrafish eye [dorsal in fish and superior in human are equivalent; for consistency with superior coloboma, we describe this structure as the superior ocular sulcus (SOS)] (Fig 2A–2D). The sulcus is visible by stereoscope but more obvious in compound or confocal observations of live embryos (Fig 2A), and most easily discernible from 21–25 hpf. When imaged under an electron microscope, the SOS can be seen to transect the distal portion of the dorsal retina (Fig 2B), while single confocal optical slices reveal the SOS as a distinct space (Fig 2C) lined by basal lamina (Fig 2D).

Fig 2

The superior ocular sulcus in zebrafish, chick and mouse.

(A) Zebrafish eyes displaying superior ocular sulci (SOS) marked by an asterisk or arrows. Top row: lateral view DIC image of the eye of a live embryo, photographed on a compound microscope. Enlarged view is shown in panel on right. Bottom row: Left, lateral view surface projection of the eye of a live Tg(rx3:GFP) embryo; Right, surface projection dorsal views of eyes from a Tg(rx3:GFP) embryo. (B) Scanning electron micrographs showing SOS at narrow (top row) and wide (bottom row) phases. Red boxes denote regions enlarged in panels on the right. (C) Single optical section, lateral view, through the eye of an embryo injected with eGFP-CAAX mRNA to label the cell membranes, with right panel showing enlarged view of boxed area. (D) Single optical section, lateral view, through eye of Tg(rx3:GFP) embryo (cyan) immunolabelled for Laminin to highlight the basal lamina (magenta). (E) Diagram showing chick eye with red line demonstrating the plane of section employed on the right. Representative horizontal section through the dorsal eye of a HH16 chick, stained with a Laminin antibody (green) and DAPI (blue). A dorsal, Laminin-lined space is evident in the distal portion of optic cup (asterisk). (F) Diagram showing 3D model of an embryonic eye with red line demonstrating plane of section for both mouse and chick sections. Right three panels are a representative horizontal section through the dorsal eye of an embryonic day 10.5 (E10.5) mouse, stained with a Laminin antibody (green) and DAPI (blue). A dorsal, Laminin-lined space is evident in the distal portion of optic cup (asterisk). Except where noted, scale bars are 50 μm. cf, choroid fissure; D-V, dorsal-ventral; HH, Hamburger Hamilton embryonic stage; hpf, hours post fertilization; N-T, nasal-temporal; nr, neural retina; Pr-Di, proximal-distal.

To ascertain whether a similar structure exists in chick, we examined tissue sections immunostained for Laminin and counterstained with DAPI. At stage HH16, we observed the presence of a Laminin-lined division in the distal portion of the chick dorsal optic cup (n = 6/8 eyes; Fig 2E, S2 Fig). For evidence of a comparable structure in mammals, we next examined mice and found a Laminin-lined separation across the inferior portion of the dorsal optic cup at embryonic day 10.5 (Fig 2F). A collaborator also shared older SEM studies of newt (Taricha tarosa) development, which similarly demonstrate the presence of a division across the dorsal embryonic eye (S3 Fig, personal communication, A. Jacobson). Thus, we present clear evidence for the existence of an evolutionarily conserved, Laminin-lined sulcus in the dorsal optic cup of multiple vertebrate species.

The inferior fissure temporarily bisects the ventral retina prior to closing through progressive fusion of the nasal and temporal margins of the ventral optic cup [3]. The SOS similarly extends across the dorsal zebrafish retina (Fig 2A–2D) to partially separate the nasal and temporal retinal lobes, and is also present only transiently. To determine the mechanism of SOS closure, we followed ocular morphogenesis over time. The SOS arises soon after optic cup formation (19–20 hpf) as a distinct and narrow structure (S1 Video and Fig 2A and 2B). Notably, formation of the sulcus occurs at a time when the developing retinal pigmented epithelium is spreading around the optic cup, but is not associated with significant cell movement or apoptosis in the forming dorsal retina (S2 Video). Unexpectedly, the edges of the narrow SOS do not migrate toward one another and fuse, but instead the SOS transitions at 22–24 hpf to a shallow and wide trough and gradually disappears after 26 hpf (S3–S5 Videos and S4 Fig). Both phases are visible in representative scanning electron microscopy images (Fig 2B). As we observed the transition from narrow to wide, and never detected an epithelial fusion event, it is logical to propose that the sulcus closes via cell rearrangement or shape modification, mechanisms distinct from the epithelial fusion that occurs within the choroid fissure.

CYP1B1 and the superior ocular sulcus

CYP1B1 mutations cause ocular malformation and are a major cause of congenital and adult glaucoma [20]. Patient #2 carries one of the known disease-causing alleles (R368H) while the second allele is a truncation (A287Pfs6), and so both alleles are expected to be pathogenic. Retinoic acid can be synthesized through both the Cyp1b1 and Aldh pathways [10,21], and mRNA encoding both types of RA synthesis enzyme is expressed in the dorsal zebrafish eye (S5A Fig)[12,22]. In order to test whether Cyp1b1 is necessary for SOS closure, we used TALEN mutagenesis to create zebrafish carrying a 13 bp frameshift deletion within the P450 domain, resulting in an early stop codon and a truncated protein. Surprisingly, the zebrafish cyp1b1 mutants did not display defects in sulcus closure, even when the Aldh pathway was additionally inhibited (S5B Fig)[23]. Given the lack of a phenotype with reduced RA signaling, we next investigated the BMPR1A variant and Bmp-dependent regulation of SOS closure.

Bmp signaling regulates closure of the superior ocular sulcus

Bmp ligands (Gdf6/Bmp13 and Bmp 2, 4, and 7) pattern the eye at the time of SOS closure [11-14,24,25] and the identified BMPR1A patient variant alters a highly conserved residue in the kinase domain (p.Arg471His, S1 Fig); therefore, we tested whether reduced Bmp receptor activity affects closure of the SOS. The small molecule DMH1 is an inhibitor of type IA BMP receptors, with robust and specific activity in zebrafish [26,27]. Embryos were treated with DMH1 either just after gastrulation or just prior to optic cup invagination (10 and 18 hpf, respectively) and evaluated for SOS presence at 28 hpf, a time point when the sulcus is no longer visible in wildtype embryos. Exposure to DMH1 prevented SOS closure in a dose-dependent manner (Fig 3A and 3B), establishing that Bmp signaling regulates sulcus morphogenesis.

Fig 3

The role of BMPR1 signaling in closure of the superior ocular sulcus.

(A-B) Effect of Bmpr1 antagonist DMH1 on SOS closure. Lateral view DIC images of eyes from live embryos (first row) and single optical slices of eyes processed for anti-Laminin immunofluorescence (second row) following exposure to control media or 0.02 μM DMH1, starting at either 10 or 18 hpf (A). SOS is marked by red asterisk. Quantification of delayed sulcus closure in DMH1-treated embryos (B). N = 3 experiments, n = 89 or 90 embryos for each condition. Data are means ± SEM. Statistics is a one-way ANOVA for each time series with Tukey's post-hoc test: **P<0.01. (C) Injection of caBMPR1A mRNA into one-cell stage zebrafish embryos caused expansion of eve1 gene expression into a circular ring in whole embryos at 50% epiboly (5.3 hpf). Significantly fewer embryos exhibited circular eve1 expression when injected with R471H-caBMPR1A. N = 3 experiments. Data are means ± SEM. Statistics is a two-tailed t test: *P<0.05. Scale bars are 50 μm.

We next used a zebrafish overexpression assay to evaluate whether the patient variant disrupts BMPR1A function. As injection of one-cell stage embryos with wildtype human BMPR1A mRNA failed to elicit alterations to dorsal-ventral axis specification, we used site-directed mutagenesis to introduce a Q233D mutation previously shown to render BMPR1A constitutively active [28]. Injection of mRNA encoding the constitutively active BMPR1A receptor (caBMPR1A) efficiently induced ventralization of whole zebrafish embryos, while caBMPR1A carrying the patient variant (R471H-caBMPR1A) showed mildly reduced activity (Fig 3C and S6 Fig). The patient variant therefore does not completely inactivate the protein, but this assay does suggest that it could be a hypomorphic allele and may have been one of multiple factors contributing to the development of superior coloboma. Overall, our data support a role for Bmp signaling in regulating SOS closure.

Within the zebrafish eye, Bmpr1a mediates signaling from the Gdf6a (Growth Differentiation Factor 6a, Bmp13) ligand [29] and absence of Gdf6a results in almost complete loss of dorsal (superior) ocular genes, expansion of ventral (inferior) genes, and a small eye phenotype [12,13,30]. Knockdown of Gdf6a signaling in wildtype embryos by injection of antisense morpholino oligonucleotides caused a highly penetrant SOS closure defect, very similar to that seen with DMH1 exposure (Fig 4A–4C). Recapitulation of the persistent sulcus phenotype in both homozygous [12,13] and a subset of heterozygous gdf6a embryos (Fig 4D and 4E) shows that SOS closure is sensitive to the precise level of Bmp signaling. A lack of Gdf6a also affected formation of the SOS, as seen by the deeper sulcus in a representative SEM image (Fig 4D, bottom right panel) and in animations showing the surface morphology of the dorsal eye in 22 hpf wildtype (S6 Video), gdf6a heterozygous (S7 Video) and gdf6a homozygous (S8 Video) embryos. While the sulcus eventually closes in most Gdf6a-deficient embryos, two adult gdf6a fish displayed superior colobomata (Fig 4F), demonstrating that an early closure defect can lead to the disease phenotype.

Fig 4

The role of Gdf6a signaling in superior ocular sulcus morphogenesis.

(A) Delayed SOS closure caused by Gdf6a knockdown. Tg(rx3:GFP) zebrafish eyes (cyan) from uninjected and Gdf6a morpholino-injected embryos shown as DIC images of live embryos and single optical slices following anti-Laminin antibody staining (magenta). SOS marked by red asterisk. (B) Quantification of embryos with delayed sulcus closure, as assessed at 28 hpf. (C) Time series of maximum projection confocal images of a Tg(rx3:GFP) embryo injected with gdf6a morpholino. (D) DIC images of wildtype, gdf6a+/- and gdf6a-/- eyes (SOS marked by red asterisk). Bottom right panel shows SEM image of a Gdf6a-deficient eye with a pronounced sulcus. (E) Quantification of gdf6a mutants (or siblings) with delayed SOS closure. (F) Adult wildtype zebrafish (top panel) showing normal eye morphology and a gdf6a zebrafish (bottom panel) with superior coloboma (red arrow). N = 3 experiments for graphs in B and E. n = number of embryos. Data are means ± SEM. Statistics in B is a two-tailed t test, and in E is one-way ANOVA with Tukey’s test: **P<0.01, *** P<0.001. Scale bars are 50 μm.

There are diverse outputs of Gdf6a signaling, regulating cellular functions such as apoptosis, cell proliferation, and dorsal-ventral retinal patterning [12,13,17,31]. Because proliferative defects are visible after sulcus closure and apoptotic cells are not concentrated near the SOS [31], we reasoned that dorsal-ventral retinal patterning is the Gdf6a function most essential for SOS closure. During development, dorsal ocular Bmp signaling is balanced by midline Sonic Hedgehog (Shh) activity [16,32], and gdf6a mutants exhibit an expansion of the Shh downstream gene vax2 into the dorsal retina [13]. We therefore tested whether increased Shh signaling in Bmp-deficient embryos underlies the persistent SOS phenotype. Indeed, treatment of gdf6a and gdf6a embryos with the Shh inhibitor cyclopamine significantly rescued the delayed closure phenotype (Fig 5A and 5B). Cyclopamine treatment also partially rescued patterning in the dorsal retina, as it restored the tbx5 expression domain in gdf6a heterozygotes (Fig 5C and 5D). These data support the idea that SOS closure is dependent on proper pattern formation within the developing retina and that sulcus morphogenesis is regulated by a balance of ventral Shh and dorsal Bmp signaling pathways.

Fig 5

Inhibition of Hedgehog signaling rescues closure of the superior ocular sulcus in Gdf6a-deficient embryos.

(A-B) Effect of Hedgehog inhibition (cyclopamine treatment) on SOS closure in Gdf6a-deficient embryos. DIC images of gdf6a+/- eyes, treated with either control solution (left) or 10 μM cyclopamine (right) (A). SOS marked by red asterisk. Quantification of effect of cyclopamine treatment on SOS closure in gdf6a+/- incross embryos (B). (C-D) Effect of cyclopamine on dorsal retinal patterning in Gdf6a-deficient embryos. tbx5 RNA expression in eyes from 28 hpf gdf6a, gdf6a, and gdf6a embryos with or without cyclopamine treatment (C). Quantification of effect of cyclopamine treatment on area of tbx5 expression (D). n = number of embryos, N = 4 (B) or 3 (D) experiments. Data are means ± SEM. Data in B and D are means ± SEM; Statistics in B is a one-way ANOVA with Tukey’s test, D is two-way ANOVA with Tukey’s test: **P<0.01. Scale bars are 50 μm.

Analysis of a second superior coloboma variant

Transcriptome analyses of Gdf6a-depleted retinas have highlighted critical regulators of dorsal-ventral patterning within the zebrafish eye [31]. Using this dataset, we interrogated the superior coloboma patient exome data, and identified a variant in TBX2 (p.Pro329His). Zebrafish tbx2b is expressed in the dorsal eye in a Gdf6a- and BMP-dependent manner (Fig 6A)[13]. To analyze the function of zebrafish tbx2b in regulating sulcus morphogenesis, we compared dorsal eye morphology between wild type embryos and tbx2b (from beyond) mutants [33]. We note a statistically significant increase in the proportion of embryos displaying an open SOS in tbx2b mutants compared to wildtype embryos at 28 hpf (Fig 6B and 6C). Such experimental results support a model in which dorsal-ventral patterning within the embryonic eye provides essential cues for morphogenesis of the SOS.

Fig 6

Analysis of Tbx2b and closure of the superior ocular sulcus.

(A) Whole-mount in situ hybridization for zebrafish tbx2b in control and BMP-depleted embryos. Top panels are eyes dissected from control and DMH1-treated embryos; bottom panels are from gdf6a, and gdf6a embryos. (B-C) Analysis of SOS closure in Tbx2b-depleted embryos. DIC images of eyes from live tbx2b (top panel) and tbx2b (bottom panel) embryos (B). Quantification of SOS closure in wild type and tbx2b mutant zebrafish eyes (C). Data are means ± SEM; one-way ANOVA with Tukey’s test: *P<0.05. Scale bars are 50 μm.

Superior ocular sulcus functions as a conduit for superficial vasculature

The inferior fissure demarcates the boundary between nasal and temporal retinal lobes and allows for ingrowth of blood vessels into the developing eye, both of which are also logical functions for the SOS. Alignment of the SOS with naso-temporal markers was examined in gdf6a embryos because of their easy-to-visualize sulcus and undisturbed nasal-temporal patterning. In situ hybridization with probes for foxg1a (nasal retina) and foxd1 (temporal retina) demonstrates that the expression boundaries align with the position of the sulcus. Although the SOS lies at the division between nasal and temporal retina (Fig 7A), its significance in separating retinal domains or, conversely, the role of nasal-temporal patterning in establishing the location of the sulcus remain to be tested.

Fig 7

Developmental functions of the superior ocular sulcus.

(A) The prominent and persistent SOS (red asterisk) present in gdf6a embryos aligns with the boundary between the nasal marker foxg1a and temporal marker foxd1. Note that nasal-temporal patterning is unchanged in the gdf6a heterozygotes (bottom row) compared to the wildtype embryos (top row). (B) SEM photographs showing the dorsal radial vessel (DRV) extending into the SOS (top row). DIC images of DRV (blue arrowheads) within a wide SOS (red arrows) (bottom row). Right panels are magnified views of boxed regions. (C-D) Surface projections (C) and single optical slices (D) from confocal images of Tg(rx3:GFP; kdrl:mCherry) embryos show the DRV (magenta) extending through the SOS (optic cup and lens are cyan). Scale bars are 50 μm unless otherwise noted.

Vascular inputs to the developing zebrafish eye include both the hyaloid artery that extends through the inferior fissure to form a plexus behind the lens, and the superficial vasculature that grows over the eye and encircles the lens [8,9]. The two systems are connected ventrally by the hyaloid vein. We hypothesized that the SOS forms a channel for the dorsal radial vessel (DRV, the first vessel of the superficial vasculature) as it grows over the dorsal retina and toward the lens. Indeed, SEM imaging shows a vessel extending into the SOS, and both DIC and confocal time-lapse imaging demonstrate that the nascent DRV grows through the sulcus (S3 and S9 Videos and Fig 7B–7D).

If the SOS functions to direct the DRV toward the lens, then altered sulcus morphology and dynamics would be expected to modify vascular development. Since our data demonstrate that Bmp signaling regulates SOS closure, we therefore evaluated development of the superficial vasculature in embryos lacking Gdf6a. The DRV does form in gdf6a-/- mutants and extends through the abnormally deep SOS; however, compared to control embryos, the DRV is of reduced caliber and unbranched at 26 hpf [gdf6a-/-: 0±0 branch points (n = 11) vs. siblings: 1.3±1.0 branch points (n = 24)] (Fig 8A, 8C and 8D). The gdf6a mutants always form a single DRV, compared to approximately half of control embryos where two DRV converge in the SOS (see control 41 hpf embryo in Fig 8A, Fig 8D). Moreover, instead of its normal course around the lens, the DRV in gdf6a-/- embryos projects deeply and ectopically travels dorsal to the lens to connect with the hyaloid vasculature (Fig 8A, 8B and 8E). The DRV subsequently degenerates in most gdf6a mutants, but the ectopic vessel remains as a dorsal connection between the superficial annular vessel and the hyaloid plexus (Fig 8A, 8E and 8F). Imaging of Tg(rx3:GFP;kdrl:mCherry) embryos revealed that the deep sulcus in gdf6a mutants creates a notable divot in the optic cup immediately dorsal to the lens (Fig 9A). In all cases (n = 8), the forming ectopic vessels grew directly into this space between the dorsal edge of the lens and the retina. Given the defects observed for the DRV in Bmp-deficient embryos, we conclude that dorsal retinal patterning is necessary for superficial vascular pathfinding.

Fig 8

Abnormal ocular vasculature in gdf6a homozygous mutants.

(A-B) Growing blood vessels (green) in the developing eyes of gdf6a-/- or control (sibling) embryos are highlighted by the kdrl:eGFP transgene and shown as maximum projections of confocal z-stacks (A) or 90° lateral rotations thereof (B). Dorsal radial vessels (DRVs) are indicated by arrows. In the top left panel, the lens is outlined with a dotted line and the entire eye with a white line. The DRV forms in most gdf6a mutants (shown at 34 hpf), can be observed degrading in 41 hpf embryos, and is often absent by 54 hpf. Ectopic connections (arrowheads) between DRV and hyaloid vasculature (hv) are visible in gdf6a embryos. Right panels are enlarged views of boxed regions. (B) Laterally rotated images showing ectopic connection to hyaloid vasculature in a gdf6a embryo, but not in a wildtype embryo at 41 hpf. (C-D) Quantification of area and number of DRV vessel(s) in 26 hpf control and gdf6a embryos. (E-F) Quantification showing percentage of control and gdf6a embryos with an ectopic connection between the hyaloid and superficial vascular systems (E) and a complete DRV (F) as assessed at 34 and 54 hpf. n = number of embryos. Scale bar is 50 μm.

Fig 9

Aberrant SOS closure leads to abnormal vasculature.

(A) Surface projections of 26 hpf Tg(rx3:GFP; kdrl:mCherry) wildtype and gdf6a embryos, shown without vessels (top row) and with vessels (bottom row). Last column shows expanded views of same gdf6a eye, highlighting the divot in the dorsal retina at the inferior edge of the superior ocular sulcus (yellow arrow). Small panel is 90° lateral rotation of vessel in adjacent panel, showing the DRV turn and extend toward the hyaloid vasculature. (B) Surface projections of Tg(rx3:GFP; kdrl:mCherry) embryos before (22 hpf) and after (26 hpf) DRV formation, with and without cyclopamine treatment. (C-D) Quantification of the area and number of DRV vessel(s) in control and cyclopamine-treated 26 hpf embryos. n = number of embryos. Scale bars are 50 μm unless otherwise noted. Di-Pr, distal-proximal.

Patterning of the ventral retina is regulated by Shh [16,32], and our earlier data suggest a balance between Bmp and Shh signaling impacts SOS morphogenesis. In contrast to Bmp loss, cyclopamine inhibition of Shh signaling in wild type embryos resulted in a shallow SOS that closes early (Fig 9B), and an increased proportion of embryos with multiple DRVs spread across the dorsal retina (Fig 9B and S7 Fig). A similar change in growth of the DRV was noted previously in embryos where the Shh receptor Smoothened is non-functional [34]. In summary, disrupted dorsal-ventral patterning of the retina leads to profound alteration of the superficial vasculature.

Aberrant vasculature in gdf6a mutants or cyclopamine-treated embryos could result either from a direct role of the morphogens in regulating vascular pathfinding or from altered SOS dynamics. To determine whether the SOS itself directly influences growth of the superficial vasculature, we prevented the Gdf6a-dependent sulcus defects by manipulating Hedgehog signaling. Indeed, cyclopamine treatment of gdf6a mutants both rescues SOS closure defects and precludes ectopic connection with the hyaloid vasculature (Fig 5 and S7 Fig). Similarly, loss of Gdf6 rescues the DRV overgrowth phenotype observed in cyclopamine-treated embryos (S7 Fig). Therefore, the data support a model in which proper SOS formation and closure are necessary for DRV pathfinding.

Discussion

In this manuscript, we classify superior coloboma as a separate disease with a developmental origin distinct from, but comparable to, inferior coloboma. Eight patients display gaps in tissues of the superior eye, including retina, lens, and iris. We demonstrated the existence of a transient dorsal groove in vertebrate eye development that is conserved amongst fish, chick, newt and mouse. Failure to close the superior ocular sulcus can result in adult zebrafish displaying a phenotype that resembles superior coloboma. Furthermore, it supports the evolutionary conservation of the SOS amongst vertebrates, an evolutionary distance of some 450 million years.

There are rare reports in the scientific literature of patients with “atypical” coloboma [35-39], ocular anomalies contrasting with the position of the known inferior embryonic fissure. The vast majority of such cases (macular coloboma, aniridia, or nasally/temporally oriented iris coloboma) are unlikely to arise from defects of sulcus closure. However, at least two of the described atypical coloboma patients display iris colobomata with a superior orientation [38,39]. Although the embryonic mechanism was originally considered anomalous, our identification of the SOS provides a likely explanation for the unusual coloboma identified in these two patients.

Exome sequencing of our superior coloboma patients identified rare variants in the genes encoding the type 1 BMP receptor and transcription factor T-box 2. In the absence of multigenerational pedigrees of affected patients, we are unable to causally link such variants to the incidence of disease. However, the connection between Bmp signaling and inferior fissure morphogenesis is well established. Indeed, variants in GDF6 (BMP13), BMP4, and SMOC1 are linked to inferior coloboma and microphthalmia [5,6,40-42]. Furthermore, zebrafish, Xenopus, chick, and mouse studies have demonstrated a key role for Bmp signaling in optic cup morphogenesis, apoptosis, proliferation, and dorsal-ventral eye patterning [11-13,40,41,43-45]. Consistently, abrogating Bmp signaling either by DMH1 treatment or loss of Gdf6a results in profound SOS closure defects. Beyond the gdf6a homozygous mutant phenotype, we also detected a partially penetrant sulcus closure defect in the otherwise morphologically normal gdf6a heterozygotes, arguing that the sulcus is particularly sensitive to the levels of Bmp signaling. Further, loss of Tbx2b function in zebrafish fby mutants leads to comparable aberrations in SOS morphogenesis. Such data, taken together with the detrimental nature of the patient BMPR1A variant, support a model whereby Bmp signaling modulates SOS closure via regulation of target genes such as tbx2.

Research on ocular Bmp signaling defines roles in regulating eye precursor cell number, apoptosis, proliferation, and dorsal-ventral gene expression [12,13,17,31,41,44,46,47]. However, apoptotic cell populations are not localized to the SOS, and proliferative defects are present only after SOS closure [31,47]. Furthermore, we note that gdf6a heterozygotes display aberrant sulcus closure, yet lack apoptotic or proliferative defects. In contrast, gdf6a heterozygotes display detectable alterations to dorsal-ventral gene expression, providing a correlation between patterning and SOS closure defects. To further test the role of dorsal-ventral patterning in sulcus dynamics, we asked whether rescue of the patterning defects in gdf6a mutants would also promote SOS closure. Given the expansion of inferior markers into the superior retina of gdf6a mutants [12,13], and the rescue of SOS defects with Shh inhibition, we conclude that the aberrant closure of the SOS in Gdf6- and Tbx2-depleted embryos is linked to dorsal-ventral patterning defects of the vertebrate eye.

The identification of a patient with two variants in CYP1B1 prompted us to carefully examine retinoid signaling in SOS closure. A role in ocular morphogenesis is well established for the retinoid signaling pathway, with mutations in the RA synthesis gene ALDH1A3 known to cause inferior coloboma [48]. Furthermore, RA regulates proliferation and migration of periocular mesenchyme (POM), a neural crest- and mesoderm-derived cell population that modulates inferior fissure closure. The inability of extensive zebrafish experiments to reveal a role for cyp1b1 in SOS closure, even in the context of Gdf6a deficiency (S8 Fig) may reflect the greater complexity of the family of retinoid synthesis enzymes in humans and their distinct expression patterns compared to zebrafish. Given the proximity of RA signaling to the SOS and known roles for RA in regulating morphogenesis in other systems, it remains plausible that RA signaling contributes to the causality of human superior coloboma.

Eye morphogenesis and patterning are dependent on multiple signaling pathways, in addition to Bmp and RA. For example, overexpression of the Wnt inhibitor Dkk1 results in loss of dorsal ocular gene expression [49], and mutation of the Wnt receptor FZD5 (thought to function as a receptor for both canonical and non-canonical Wnts) causes inferior coloboma [50]. In examining the prioritized list of rare variants identified in superior coloboma patients, we note rare variants in NKD1, CELSR2, FZD4, SCRIB, and WNT9B (components of canonical or non-canonical Wnt pathways). The rare TSC2 (Tuberous Sclerosis Complex 2/Tuberin) variant in patient #1 plausibly implicates other cellular mechanisms in the induction of superior coloboma. TSC2 complexes with TSC1 to regulate the mTOR signaling pathway [51], and loss of either gene leads to unregulated cell growth and proliferation.

The rare incidence of superior coloboma argues that the disorder is unlikely caused by simple, single-gene inheritance. Rather, a model incorporating multi-gene inheritance or incomplete penetrance is more plausible. Seven of the eight patients with superior coloboma in the current study display unilateral disease, also a common characteristic of inferior coloboma [52]. The highly penetrant defects found in zebrafish gdf6a mutant larvae, which only infrequently result in an adult superior coloboma phenotype (Fig 4F), are consistent with an impressive ability of the developing eye to recover from embryonic defects. However, the absence of an obvious coloboma does not preclude abnormal SOS morphogenesis generating subtler abnormalities, such as vascular misrouting. Although defining the relative contribution of heritability and environment is challenging, other disorders offer potential insight. Characterized by appreciable globe enlargement, high myopia represents an ocular disorder with substantial genetic and environmental components, where unilateral cases account for up to one third of the total [53]. Anisometropia represents a second example of an asymmetric developmental ocular phenotype [54], and the pattern apparent in the current cases (Fig 1) corresponds with such examples.

The parallels with the inferior ocular fissure, which provides a passageway for the hyaloid vasculature [7,9,55], are strong. The close coordination between the development of both structures is highlighted by the ability of the dilated hyaloid vein in zebrafish lmo2 mutants to disrupt fissure closure and cause inferior coloboma [56]. The tight association between the superficial vasculature’s DRV and the SOS provides convincing evidence that the SOS serves a similar retinal vascular guidance function. While developing blood vessels follow guidance cues in the same manner as growing axons [57], our data argues that the physical landscape of a tissue can also direct angiogenesis. First, the DRV in wildtype embryos travels directly through the SOS to reach the lens, whereas only a thin and unbranched DRV grows through the particularly deep sulci of gdf6a mutants. Second, the shallow or absent SOS in cyclopamine-treated embryos correlates with the appearance of multiple DRVs spread across the dorsal retina. Finally, the divot above the lens in gdf6a mutants aligns with the position of the ectopic connection between hyaloid and superficial vasculature. Taken together, these data support a model in which the SOS provides a path for directing and restraining DRV growth (Fig 10).

Fig 10

Model of superior ocular sulcus morphogenesis and function.

The superior ocular sulcus appears as a narrow groove in the dorsal retina soon after optic cup formation (22 hpf), and subsequently becomes wider (24 hpf). The DRV grows through the wide sulcus as it travels across the dorsal retina towards the lens (24–26 hpf). If BMP signaling is reduced, the sulcus persists as a deep and narrow structure, through which the DRV still travels. However, in low BMP conditions, the DRV has a thin and unbranched morphology as it traverses the deeper fissure, and then enters the divot at the inferior edge of the sulcus and forms an ectopic connection with the hyaloid vessels. If Sonic Hedgehog signaling is reduced, the SOS is absent at the time of DRV growth, resulting in the formation of more DRV vessels spread across the dorsal retina.

Here, we have characterized a previously unrecognized developmental structure with a significant disease connection. Further studies will be needed to discern the exact mechanisms of sulcus formation and resolution, and to more deeply analyze the causes of superior coloboma.

Materials and methods

Ethics statement

All experiments were conducted in accordance with the guidelines provided by the institutional IACUC. The research on chick and mouse was performed at the University of Texas and approved by their institutional AC committee (#2015–00089). The research on zebrafish was performed at the University of Alberta and approved by ACUC, Biosciences (#0082) and ACUC, Faculty of Medicine (#1476). Anesthesia and euthanasia were performed with MS-222.

Exome sequencing

Whole exome sequencing was performed on genomic DNA from each proband (#1 - #5) as part of FORGE Canada Consortium at the McGill University and Génome Québec Innovation Centre. Exome target enrichment was performed using the Agilent SureSelect 50Mb (V3) All Exon Kit and sequencing was performed on the Illumina HiSeq 2000, multiplexing three samples per lane. The mean coverage of coding sequence regions, after accounting for duplicate reads was greater than 70x. WES data was analyzed by performing alignment with BWA, duplicate read removal with Picard, local indel realignment with GATK, variant calling with SAMtools, and annotation with Annovar and custom scripts [58]. Subsequently exome sequencing was repeated commercially (Beijing Genomics Institute). In parallel, array CGH was performed to identify any causative copy number variations (CNV) using an Affymetrix cytoscan HD array that comprises approximately 1,800,000 CNV and 700,000 genotyping probes. Within patients #1–5, we identified 783, 843, 942, 708, and 721 rare (<1%) non-synonymous and stop-gain/loss variants, respectively. By filtering such variants using Mutation Taster (score >0.95), patients #1–5 contain 163, 155, 139, 112, and 148 higher probability variants, respectively. Subsequent prioritization included literature searches associating genes with ocular function and zfin.org examination of in situ expression patterns within the developing eye at 18–24 hpf, yielding a restricted subset of high priority variants in each proband (S1 Table).

Zebrafish husbandry and in situ hybridization

Zebrafish were cared for according to standard protocols, and embryos grown in embryo media at 28.5°C and staged appropriately. Zebrafish embryos grown past 24 hours post fertilization (hpf) were treated with 0.004% 1-phenyl 2-thiourea (PTU; Sigma-Aldrich, St. Louis, MO) to prevent pigment formation. The AB strain of wild-type (WT) fish, Tg(rx3:GFP), Tg(kdrl:eGFP), and Tg(kdrl:mCherry) transgenic lines [59-61], and cyp1b1 (see below), gdf6as327 [13], and tbx2b [33] mutant lines were used. The gdf6as327 mutation encodes a S55X truncation producing a 54 amino acid peptide lacking the mature domain. The tbx2b mutation is a point mutation resulting in a T>A substitution, resulting in a premature stop codon within the T-box sequence. In situ hybridization (ISH) was performed as described previously [12] with embryos fixed overnight at 4°C in 4% paraformaldehyde (PFA) and permeabilized by incubation in 10 μg/mL Proteinase K for 20 minutes for 28 hpf embryos and 1 min for 5.3 hpf (50% epiboloy) embryos. Following in situ hybridization, eyes from 28 hpf embryos were removed and mounted under a coverslip in 70% glycerol, and then photographed using a Zeiss Axioimager Z1 compound microscope and an Axiocam HR digital camera (Carl Zeiss Microscopy, LLC). 5.3 hpf embryos were imaged using an Olympus stereoscope and a Qimaging micropublisher camera.

Chick and mouse embryos

For the chick studies, fertilized Leghorn eggs (Texas A&M, Bryan, TX) were incubated at 38°C in a humidified forced-draft incubator. Chick embryos were staged according to Hamburger and Hamilton [62] and Swiss Webster mice were collected at E10.5

Immunocytochemistry and imaging of chick and mouse

Immunohistochemistry was performed as previously described [63]. Chick embryos were stained with antibodies against Laminin-1 (#3HL1; Developmental Hybridoma Studies Bank, Iowa; Conc: 1:250), whereas for mouse Laminin alpha 1 stains, we utilized a different antibody (Sigma L9393). Alexa-Fluor conjugated Goat anti-Rabbit IgG (#411008; Life Technologies,: Conc: 1:250) was used for fluorescent detection [64]. Antibodies used in the current study were validated for use in chicks in previous studies [64,65]. DAPI staining was used for detecting nuclei. Confocal images were obtained with an Olympus IX51 spinning disc microscope and data analyses carried out with Slidebook Pro (3I, CO). Images are presented as single 0.5–0.8 μm thick optical sections. The position in the dorsal-ventral plane is based on the acquisition of multiple serial sections and respective alignment to those sections (just ventral) that contain lens tissue.

Morpholino injections

A gdf6a Morpholino (5’-GCAATACAAACCTTTTCCCTTGTCC-3’) was used to block splicing at the exon 1–intron 1 boundary of the gdf6a pre-mRNA transcript [41]. 5–10 ng were injected into one-cell stage wildtype zebrafish embryos.

TALEN mutagenesis

TALEN mutagenesis constructs targeting the Cyp1b1 cytochrome P450 domain (nts 924–977) were created by Golden Gate cloning [66]. The target region was TTCGGGGCCAGTCAAGACACtctgtctacagctCTCCAGTGGATCATCCTGCTA, with the spacer region shown in small letters. 100 pg of RNA for each TAL construct were injected into one-cell stage zebrafish embryos and the offspring were screened for mutations by HRM. The 13 bp deletion causes a frameshift at aa317 (p.Cys317SerfsX23), followed by a stop codon at aa340. The wildtype protein is 526aa.

Zebrafish genotyping

The offspring of gdf6a heterozygous incrosses were genotyped by high resolution melt (HRM) temperature analysis performed on genomic DNA extracted in 10 μL of 50 mM NaOH (95°C, 10 minutes) and neutralized with 2 μL Tris-HCl, pH 8.0. PCR was performed using primers optimized for HRM (GCGTTTGATGGACAAAGGTC; CCGGGTCCTTAAAATCATCC) and Qiagen Master Mix on a Qiagen Rotor Gene Q qPCR machine (Qiagen). Conditions for amplification were 1 cycle at 95°C for 5 min, 40 cycles of 95°C for 10 seconds, 55°C for 30 seconds, followed by HRM ramp from 70–90°C, 0.1°C per step. Fish carrying the cyp1b1 mutation were HRM genotyped using primers CCATCTCAGATATTTTCGGGG and GTTATTTACCTGACAAGTAGCAG and a 52°C annealing temperature for amplification. Results were analyzed via Qiagen software v2.02 (Qiagen) and variants initially confirmed by Sanger sequencing. tbx2b mutants were genotyped by PCR followed by MseI restriction digest. Genomic DNA was extracted as above and diluted 10X for use as template. PCR was performed with Ex Taq DNA Polymerase (TaKaRa Bio Inc.) using the following primers: Forward-TGTGACGAGCACTAATGTCTTCCTC; Reverse-GCAAAAAGCATCGCAGAACG. Conditions for amplification were 1 cycle at 94°C for 2 min, 40 cycles of 94°C for 15 seconds, 58°C for 15 seconds, and 72°C for 20 seconds, followed by 1 cycle at 72°C for 3 min. The PCR products were then digested with MseI (NEB) for two hours and analyzed via gel electrophoresis using a 3% agarose gel.

Immunocytochemistry of Zebrafish embryos

For Laminin staining, whole embryos fixed in 4% PFA were permeabilized with ice-cold acetone (7 min), washed in water (5 min), and PBS with 0.5% Tween-20 (PBST, 5 min). Embryos were then treated for 5 min with 10 μg/mL Proteinase K in PBST, washed four times in PBST, blocked for 1 hour at room temperature in 5% normal goat serum and 2% BSA, and then incubated overnight at 4°C in block plus rabbit anti-Laminin primary antibody (1/100, L-9393, Sigma-Aldrich). After washing, embryos were incubated at room temperature for two hours in goat anti-rabbit Alexa Fluor 488 or 568 secondary antibody (1/1000, Molecular Probes). All embryos were washed 4 times for 10 minutes in PBST after primary and secondary antibody incubations. Eyes were removed and mounted on slides in 70% glycerol, or were imaged as whole embryos mounted in 1% low melting temperature agarose.

Scanning electron microscopy

Embryos at 22 hpf from AB (wildtype) and gdf6a+/- incrosses were fixed overnight in 2.5% Glutaraldehyde; 2% Paraformaldehyde. After washing in 0.1M phosphate buffer, embryos were gradually dehydrated in ethanol, transferred to Hexamethyldisilazane (HMDS; Electron Microscopy Sciences) and left to dry overnight. Embryos were then mounted on SEM stubs, sputter coated with Au/Pd using a Hummer 6.2 Sputter Coater (Anatech), and imaged on a XL30 scanning electron microscope (FEI) operating at 20 kV.

Construction and injection of BMPR1A constructs

The full coding domain of human BMPR1A mRNA (Ensembl transcript ID: ENST00000372037) was cloned into pCS2+. Using site-directed mutagenesis, the Q233D mutation was created to make caBMPR1a [28] and the patient mutation, G1412A, was subsequently added to create R471H-caBMPR1a, with sequences confirmed by Sanger sequencing. The constructs, which were identical except for the patient mutation, were linearized (NotI, NEB) and mRNA generated using the SP6 mMessage mMachine kit (Ambion). mRNA was purified using YM-50 Microcon columns (Amicon, Millipore) and concentration determined through spectrophotometry. The mRNA, which was newly synthesized for each round of injections, was diluted with DEPC-treated water, and embryos were injected with 25 pg of RNA at the single-cell stage. Both injections and analysis were performed in a blinded fashion.

Quantitative real-time PCR (qRT-PCR)

Primers were validated prior to the experiment, as previously described [67]. Endogenous control primers (elongation factor 1a; ef1a), previously used [67], were chosen from the Universal Probe Library Assay Design Centre for Zebrafish (Roche). Primer sequences for BMPR1A are as follows: F-CGTGTTCAAGGACAGAATCTGG; R-AAAGGCAAGGTATCCTCTGGTG. RNA was isolated from 40 embryos per group at the 256-cell stage using RNAqueous (Ambion), first-strand cDNA synthesis was performed using AffinityScript qPCR cDNA Synthesis (Agilent) and qRT-PCR was performed as described previously [67].

Pharmacological treatments

For drug treatments, embryos were transferred at 10 hpf or 18 hpf into 35 mm dishes containing 5 mL embryo media plus 0.05–0.2 μM DMH1 (Sigma-Aldrich), 1–5 μM N,N-diethylaminobenzaldehyde (DEAB; Sigma-Aldrich), 0–10 μM cyclopamine (Sigma-Aldrich), or an equivalent volume of vehicle (DMSO or ethanol). For each experiment, 15 embryos were added to each dish and two dishes were used for each treatment (total of 30 embryos). For analysis of SOS presence, embryos were grown at 28.5°C to 28 hpf, treatment conditions were blinded and the embryos were analyzed under a Zeiss Discovery V8 80x stereoscope for the presence of the SOS. Alternatively, live or fixed embryos at 22–54 hpf were mounted in 1% low melting temperature agarose for imaging.

Statistics

Two-factor analysis was done by Students t test. Multivariable analysis was performed by two-tailed, one or two-factor ANOVA with Tukey posthoc test. *P<0.05, **P<0.01, ***P<0.001.

Imaging of zebrafish embryos

Fixed or anaesthetized live transgenic embryos were mounted laterally in a 35mm dish in 1% low-melting temperature agarose and imaged using a Zeiss W Plan-Apochromat 20x/1.0 water immersion objective and a Zeiss LSM700 laser scanning unit mounted on a Zeiss Axioimager Z1 compound microscope. Z-stacks were made by taking optical slices at intervals of 2–3 μm for a total of ~60 μM, and maximum projections or surface projections were created from the resulting stacks using either ZEN (Carl Zeiss) or Imaris (Bitplane) software.

All DIC images were taken on an Axiocam HR digital camera mounted on a Zeiss Axioimager Z1 compound microscope. Photos and videos were annotated, assembled and processed for brightness and contrast in Adobe Photoshop software.

Members of FORGE Canada Consortium

FORGE Canada Consortium: Finding of Rare Disease Genes in Canada; Steering Committee: Kym Boycott (leader; University of Ottawa), Jan Friedman (co-lead; University of British Columbia), Jacques Michaud (co-lead; Université de Montréal), Francois Bernier (University of Calgary), Michael Brudno (University of Toronto), Bridget Fernandez (Memorial University), Bartha Knoppers (McGill University), Mark Samuels (Université de Montréal), Steve Scherer (University of Toronto).

Superior coloboma patient information.

(DOCX)

Click here for additional data file.

Genetic variants in superior coloboma patients.

Exome sequencing of superior coloboma patients identified rare variants (<1% frequency in general population) that were subsequently prioritized on the basis of high Mutation Taster score (>0.95) and prior association with ocular gene expression or function.

(XLSX)

Click here for additional data file.

Genetic variants identified in bilateral superior coloboma patient.

(A) Diagram of the human CYP1B1 protein, with the compound heterozygous mutations carried by patient#2 indicated. (B) Diagram of the human BMPR1A protein showing rare variant present in patient#2. (C) Alignment illustrating the evolutionary conservation of the BMPR1A protein kinase domain. The altered residue (p.R471H) is depicted in bold, with invariant residues denoted by *.

(TIF)

Click here for additional data file.

Superior ocular sulcus in chick.

(A) 3D Model of the eye depicting where the eye was sectioned to create the serial horizontal sections shown in B. B) Serial cryostat sections of a chick HH16 stage eye stained with DAPI (blue) and α-Laminin antibody (green). First three sections are dorsal to the lens and third one is through the lens. (C) Tangential section of HH16 chick eye labeled with DAPI (blue) and α-Laminin antibody (green). D, dorsal; V, ventral; Di, distal; Pr, proximal; HH, Hamburger Hamilton. Red asterisks indicate superior ocular sulcus. Scale bar is 50 μm.

(TIF)

Click here for additional data file.

Superior ocular sulcus in newt.

Scanning electron microscopy images of newt (Taricha tarosa) ocular development. Panels on left display SEM images of stage 34 embryos after partial dissection of surface tissues. Panels on right show slightly older embryos (stage 36–37), with vasculature intact in the stage 36 example. Red asterisks indicate superior ocular sulcus.

(TIF)

Click here for additional data file.

Dynamics of the zebrafish superior ocular sulcus.

(A) Time-lapse images showing lateral views of the eye of a Tg(rx3:GFP) embryo. The superior ocular sulcus appears as a narrow groove across the dorsal retina at ~20 hpf (red asterisk), becomes wider by 24 hpf (red arrows) and disappears after 26 hpf. (B) Timing of SOS as viewed under a stereomicroscope. The wide and shallow phase is not visible by stereomicroscope, so the red bars indicate the percentage of embryos with a narrow and distinct sulcus.

(TIF)

Click here for additional data file.

Reduced RA signaling does not impair closure of the superior ocular sulcus.

(A) Lateral view of a 28 hpf zebrafish eye following in situ hybridization for cyp1b1. Note that expression extends into the dorsal eye. (B) Quantification of open SOS in 28 hpf embryos from cyp1b1 incrosses treated from 10 hpf with control solution or the Aldh inhibitor DEAB. N = 3 experiments, n = number of embryos. Data are means ± SEM. Statistics is two-way ANOVA with Tukey's test. Scale bar is 50 μm. ns, not significant.

(TIF)

Click here for additional data file.

Human variant in BMPR1A reduces protein function.

(A) One cell-stage zebrafish embryos were injected with caBMPR1A or R471H-caBMPR1A mRNA, and assessed at 24 hpf for morphological abnormalities by categorization according to the pictures shown. (B) Graph showing percentage of embryos injected with caBMPR1A (n = 22 embryos) or R471H-caBMPR1A (n = 23 embryos) that fit into each category of morphological abnormality. (C) qPCR showing equal amounts of injected RNA for each condition. Statistics is two-tailed t test.

(TIF)

Click here for additional data file.

Interaction between Hedgehog and Bone Morphogenetic Protein signaling in formation of the dorsal radial vessel.

Maximum projection confocal images of 34 hpf eyes from Tg(kdrl:eGFP);gdf6a and Tg(kdrl:eGFP);gdf6a zebrafish embryos following treatment with control solution or 10 μM cyclopamine from 10 hpf. Blood vessels fluoresce green and the eye is outlined by dotted lines. DRV is indicated by arrow. Ectopic connection between superficial and hyaloid vasculatures indicated by arrowhead. Top row, right two panels are two examples of vessel overgrowth phenotype in cyclopamine-treated wildtype embryos. Bottom row, middle and right panels show the eyes of cyclopamine-treated gdf6a embryos that either failed to form a DRV (n = 3/6 embryos) or grew a simple DRV that did not make an ectopic connection to the hyaloid vasculature (n = 3/6 embryos), respectively. hv, hyaloid vasculature. Scale bar is 50 μm.

(TIF)

Click here for additional data file.

Retinoic acid signaling and the superior ocular sulcus.

(A) Lateral views of eyes from 28 hpf zebrafish embryos that are gdf6a, gdf6a , or gdf6a and have been processed for in situ hybridization. The top two rows show expression of the retinoic acid-synthesis genes cyp1b1 and aldha1a2. The bottom row shows expression of GFP in transgenic zebrafish carrying a reporter for RA signaling [Tg(12xRARE:GFP)] and are also gdf6a, gdf6a , or gdf6a. Note reduced RA signaling in the superior retina of gdf6a and gdf6a embryos. (B) Graph showing no effect of retinoic acid treatment on SOS closure. Embryos from gdf6a incrosses were grown from 10 hpf in control media, 5 nM retinoic acid, or 10 nM retinoic acid, and assessed at 28 hpf for an open SOS. (C) Graph showing no effect of the cyp1b1 mutation on SOS closure in gdf6a heterozygotes. gdf6a;cyp1b fish were crossed to wildtype or cyp1b fish and the percentage of embryos with an open SOS was assessed at 28 hpf. n = number of embryos, N = 2 (B) or 3 experiments (C). Data are means ± SEM. ns, not significant

(TIF)

Click here for additional data file.

Superior ocular sulcus appears after optic cup and lens formation.

Red arrow points to SOS. Time stamp is hrs:mins. D, dorsal; V, ventral.

(MP4)

Click here for additional data file.

Formation of the optic cup.

Live imaging of the developing eye of a Tg(rx3:GFP) embryo, lateral view. Video was started at 18 hpf.

(MP4)

Click here for additional data file.

Superior ocular sulcus transitions from narrow to wide.

Red arrows define lateral edges of SOS. Asterisk marks growing dorsal radial vessel. Time stamp is hrs:mins. D, dorsal; V, ventral.

(MP4)

Click here for additional data file.

Superior ocular sulcus does not close by epithelial fusion, lateral view.

Lateral view, surface projection of the eye of a Tg(rx3:GFP) embryo, starting at 22 hpf. D, dorsal; V, ventral.

(MP4)

Click here for additional data file.

Superior fissure ocular sulcus does not close by epithelial fusion, dorsal view.

Dorsal view, cut surface projection of the eye of a Tg(rx3:GFP) embryo, starting at 22 hpf (same eye as in S4 Video). Di, distal; Pr, proximal.

(MP4)

Click here for additional data file.

Morphology of superior ocular sulcus in a wildtype embryo.

Surface projection made from a confocal z-stack through the dorsal eye of a 22 hpf Tg(rx3:GFP) embryo.

(MP4)

Click here for additional data file.

Morphology of superior ocular sulcus in a gdf6a heterozygous embryo.

Surface projection made from a confocal z-stack through the dorsal eye of a 22 hpf Tg(rx3:GFP) embryo.

(MP4)

Click here for additional data file.

Morphology of superior ocular sulcus in a gdf6a homozygous mutant embryo.

Surface projection made from a confocal z-stack through the eye of a 22 hpf Tg(rx3:GFP) embryo.

(MP4)

Click here for additional data file.

The dorsal radial vessel grows through the superior ocular sulcus.

Surface projections made from time lapse confocal z-stacks through the eye of a live Tg(kdrl:mCherry;rx3:GFP) embryo, starting at 24 hpf. mCherry expression in the blood vessels is shown in magenta, GFP in the eye and lens is cyan. Scale bar is 50 μm.

(MP4)

Click here for additional data file.