Literature DB >> 29512689

MicroRNA-155 inhibits the osteogenic differentiation of mesenchymal stem cells induced by BMP9 via downregulation of BMP signaling pathway.

Hongxia Liu1, Liang Zhong1, Taixian Yuan1, Sicheng Chen2, Yiqing Zhou1, Liqin An1, Yangliu Guo1, Mengtian Fan1, Ya Li1, Yanting Sun1, Wang Li1, Qiong Shi1, Yaguang Weng1.   

Abstract

Previous studies have indicated that bone morphogenetic protein 9 (BMP9) can promote the osteogenic differentiation of mesenchymal stem cells (MSCs) and increase bone formation in bone diseases. However, the mechanisms involved remained poorly understood. It is necessary to investigate the specific regulatory mechanisms of osteogenic differentiation that were induced by BMP9. During the process of osteogenic differentiation induced by BMP9, the expression of microRNA-155 (miR-155) exhibited a tendency of increasing at first and then decreasing, which made us consider that miR-155 may have a modulatory role in this process, but the roles of this process have not been elucidated. This study aimed to uncover miR-155 capable of concomitant regulation of this process. mmu-miR-155 mimic (miR-155) was transfected into MSCs and osteogenesis was induction by using recombinant adenovirus expressing BMP9. Overexpressed miR-155 in MSCs led to a decrease in alkaline phosphatase (ALP) staining and Alizarin red S staining during osteogenic differentiation, and reduced the expression of osteogenesis-related genes, such as runt-related transcription factor 2 (Runx2), osterix (OSX), osteocalcin (OCN) and osteopontin (OPN). On protein levels, overexpressed miR-155 markedly decreased the expression of phosphorylated Smad1/5/8 (p-Smad1/5/8), Runx2, OCN and OPN. Luciferase reporter assay revealed Runx2 and bone morphogenetic protein receptor 9 (BMPR2) are two direct target genes of miR-155. Downregulation of the expression of Runx2 and BMPR2, respectively could offset the inhibitory effect of miR-155 in the osteogenesis of MSCs. In vivo, subcutaneous ectopic osteogenesis of MSCs in nude mice showed miR-155 inhibited osteogenic differentiation. In conclusion, our results demonstrated that miR-155 can inhibit the osteogenic differentiation induced by BMP9 in MSCs.

Entities:  

Mesh:

Substances:

Year:  2018        PMID: 29512689      PMCID: PMC5881775          DOI: 10.3892/ijmm.2018.3526

Source DB:  PubMed          Journal:  Int J Mol Med        ISSN: 1107-3756            Impact factor:   4.101


Introduction

During the process of bone regeneration, three main phases, inflammation, new bone formation and bone remodeling take place in an orchestrated fashion to repair the injury. Bone remodeling is regulated by both the number and activity of osteoblasts and osteoclasts. Osteoblast lineage commitment, proliferation and differentiation are controlled by a well-defined genetic program. Bone morphogenetic proteins (BMPs) are unique extracellular multifunctional signaling cytokines belonging to the large transforming growth factor-β (TGF-β) superfamily (1–6). BMPs can induce heterogeneous oligomerization of type I and II receptor serine/threonine kinases and Smad1/5/8 phosphorylation. Subsequently, the phosphorylated Smad1/5/8 are associated with Smad4 and translocate into the nucleus where they cooperate with tissue-specific transcription factors to drive osteogenic target gene expression (7). Or through the non-canonical Smad-independent signaling [p38 mitogen-activated protein kinase (MAPK)] pathway to active downstream transcription factors to potentiate the osteoblastogenesis role (8). Bone morphogenetic protein 9 (BMP9), a member of the BMP family, in previous studies was identified it as one of the most osteogenic BMPs (1,4,6,9,10), but the mechanisms involved remain largely unclear. MicroRNAs (miRNAs or miRs) are a class of endogenous noncoding RNAs, ~22 nucleotides in length that are involved in the regulation of gene expression, coordinating a broad spectrum of biological processes (11,12). miRNAs influence the expression of the target gene by binding to its 3′-untranslated region (3′-UTR) and inactivate it by promoting its degradation or translational repression (13,14). Several studies indicated that miRNAs act as key regulators in cell differentiation (15–20), cell growth (21,22), cell death (23), and lipid metabolism (24). Previous studies have shown that miR-206, -204, -133, -135, -125b, -141, -200a and -214 can inhibit osteogenic differentiation (12,16,25-30). On the contrary, miR-15b and miR-29b have been demonstrated to promote osteogenesis (31,32). Apparently, miRNAs are important regulators during the osteogenic differentiation. As a member of the oncomir class of microRNAs, miR-155 is implicated in lymphomagenesis (33-36) and a wide array of nonlymphoid tumors including breast, colon, and lung (33,37-41). In recent years, several studies have focused on miRNAs being modulated by BMP signaling as a means to investigate the role of miRNAs in osteoblasts (17,26,28,29,42). Another study indicated that suppressing the expression and function of miR-155 contributes to mitigate the inhibition of TNF-α on BMP-2-induced osteogenic differentiation (43), indicating that there was a link between miR-155 and BMP signaling. From the early studies we found that during the process of osteogenic differentiation induced by BMP9, the expression of miR-155 has changed. Overexpression of miR-155 in C2C12 myoblasts and mouse embryonic fibroblasts (MEF), induced osteogenesis by BMP9, the expression of osteogenesis-related genes like runt-related transcription factor 2 (Runx2) and alkaline phosphatase (ALP) declined, so we reasonably hypothesized that miR-155 can inhibit this process, but the relevant mechanisms are not clear. The aim of this work is to explore the effect of miR-155 on the osteogenic differentiation induced by BMP9, and investigate the correlation mechanisms.

Materials and methods

Cell lines and culture

The HEK-293 (human embryonic kidney) cell line, C2C12 (myoblasts) cell line, and MEF cell line were obtained from American Type Culture Collection (ATCC, Manassas, VA, USA). The HEK-293 cells, C2C12 cells and MEF cells were all immortalized and maintained in DMEM, supplemented with 10% fetal bovine serum (FBS) (Gibco, Grand Island, NY, USA), 100 U/ml penicillin and 100 µg/ml streptomycin. The cells were maintained at 37°C in a humidified 5% CO2 atmosphere.

Transfection of the miR-155 mimic, miR-155 inhibitor, and shBMPR2

miR-155 mimic, miR-155 inhibitor, and shBMPR2 were purchased from GenePharma (Shanghai, China). The sequences for each oligonucleotide are listed in Table I. Entranster™ R4000 (Engreen Biosystems, Beijing, China) was utilized to transfect miR-155 mimic, miR-155 inhibitor and miR-155 negative control (NC) according to the manufacturer's instructions. To transfect shBMPR2 and it negative control shNC, Lipofectamine 2000 transfection reagent (Invitrogen, Shanghai, China) was used according to the manufacturer's instructions. In this study, C2C12 cells and MEF cells were transfected with with 100 nM of miR-155 mimic, or miR-155 inhibitor or NC in a 24-well plate or 500 nM of the above in a 6-well plate. In a 6-well plate, shNC or shBMPR2 were transfected into cells at 800 ng each well.
Table I

Oligoribonucleotides used in the study.

NameSequence (5′→3′)
mmu-miR-155 mimicF: UUAAUGCUAAUUGUGAUAGGGGU
R: CCCUAUCACAAUUAGCAUUAAUU
mmu-miR-155 inhibitorF: ACCCCUAUCACAAUUAGCAUUAA
Negative control (NC)F: UUCUCCGAACGUGUCACGUTT
R: ACGUGACACGUUCGGAGAATT
shBMPR2F: CACCGCCAAGATGAATACAATCAATTTCAAGAGAATTGATTGTATTCATCTTGGCTTTTTTG
R: GATCCAAAAAAGCCAAGATGAATACAATCAATTCTCTTGAAATTGATTGTATTCATCTTGGC
shNCF: CACCGTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAATTTTTTG
R: GATCCAAAAAATTCTCCGAACGTGTCACGTTCTCTTGAAACGTGACACGTTCGGAGAAC

F, forward; R, reverse. BMPR2, bone morphogenetic protein receptor 2.

Transfection of the BMP9 and si-Runx2

C2C12 cells and MEF cells were cultured in 24-well plates, each well was added with 500 µl DMEM supplemented with 10% FBS, and before using BMP9 and si-Runx2, we tested the titer of these recombinant adenoviruses. Each well contained 3 µl of polybrene to contribute to the adenovirus entry into cells, different volumes of adenovirus was added, until the infection efficiency reached 30%, the volume of the adenovirus was the titer for the corresponding cells, respectively. In a 6-well plate, 12 µl of polybrene and four-fold titer volume of adenovirus were added after that the cells attached.

RNA extraction, reverse transcription and real-time quantitative PCR (RT-qPCR) analysis

Total RNA was extracted from C2C12 cells and MEF cells at the indicated time points using TRIzol reagent (Ambion, Aukland, New Zealand) according to the manufacturer's instructions for the analysis of mRNA and miRNA expression. The concentration and purity of RNA were quantified using spectrophotometer (NanoDrop 1000 Spectrophotometer; Thermo Fisher Scientific Inc., Waltham, MA, USA). The extracted total RNA (2,000 ng) was reverse transcribed using reverse transcription primers according to the manufacturer's instructions (Reverse Transcriptase M-MLV, Takara code: D2639A; Takara Bio Inc., Otsu, Japan). The primers used for reverse transcription PCR (RT-PCR) and RT-qPCR are listed in Table II. RT-qPCR were performed on a Bio-Rad iQ5 instrument (Bio-Rad, Hercules, CA, USA) used cDNA as templates to amplify target genes, mixing with SYBR®-Green PCR Master Mix (Takara Bio, Inc.), Fold-changes in expression were calculated using the 2-∆∆Ct method, and each experiment was performed in triplicate. Data were analyzed using Optical system software, version 2.0. The expression levels of β-actin and the small U6 RNA were used as internal controls for mRNA and miRNA, respectively.
Table II

Primers used in the study.

GenesSequence (5′→3′)
mmu-miR-155RT: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACCCCT
U6RT: AAAATATGGAACGCTTCACGAATTTG
mmu-miR-155F: GGCGTTAATGCTAATTGTGATR: GTGCAGGGTCCGAGGT
U6F: CTCGCTTCGGCAGCACATATACTR: ACGCTTCACGAATTTGCGTGTC
Mouse Runx2F: TCTGACAAAGCCTTCATGTCCR: AAATAGTGATACCGTAGATGCG
Mouse OSXF: GAAGTCCAATGGGGATCTGAR: GAATCCCTTTCCCTCTCCAG
Mouse ALPF: TGACCTTCTCTCCTCCATCCR: CTTCCTGGGAGTCTCATCCT
Mouse OCNF: CTGCTTGTGACGAGCTATCAGR: TGATACCGTAGATGCGTTTGT
Mouse β-actinF: ATGAAGGCGTGGCAACATR: GCCATTGGCTCTGTCCTG
Mouse BMPR2F: GCAGTGAGGTCACTCAAGGAR: CATCATGAGTTCAGCCATCC

RT, reverse transcription; F, forward; R, reverse; Runx2, runt-related transcription factor 2; OSX, osterix; OCN, osteocalcin; BMPR2, bone morphogenetic protein receptor 2.

ALP staining and ALP activity

ALP staining was performed with BCIP/NBT Alkaline Phosphatase Color Development kit (C3206; Beyotime, Shanghai, China) according to the manufacturer's instructions. Briefly, we seeded the C2C12 cells and MEF cells in 24-well plates followed by treatment with NC, miR-155 mimic or miR-155 inhibitor and BMP9 for 7 days. The supernatant was discarded, cells were washed three times using phosphate-buffered saline (PBS). Then 3 ml of ALP developing buffer was mixed with 10 µl BCIP, and 20 µl NBT to form BCIP/NBT working liquid and 200 µl BCIP/NBT was the working liquid in each well of 24-well plates, and the plates were placed in the dark to undergo ALP staining for 30 min. Finally, BCIP/NBT working liquid was removed by suction and the staining observed. Cells were scanned at both a lower (ScanMaker 3600; Shanghai Microtek Technology Co., Ltd., Shanghai, China) and higher magnification under a bright field microscope (T-DH; Nikon Corp., Tokyo, Japan). ALP activity was measured using an established enzymatic assay. ALP substrate was prepared from solution A (8 ng naphtol-AS-TR phosphate/300 ml N,N-dimethylformamide; both from Sigma-Aldrich, St. Louis, MO, USA) and solution B (24 mg fast blue BB salt/30 ml of 100 mmol/l Tris HCl, pH 9.6). The two solutions were combined, 10 mg of MgCl2 was added, the resulting solution was used immediately. Enzymatic activity was determined in cell lysates that were solubilized with 0.1% Triton X-100. Aliquots (5 µl) of each sample were incubated with 15 µl of AP substrate buffer (100 mmol/l diethanolamine, 150 mmol/l NaCl, 2 mmol/l MgCl2 p-nitrophenylphosphate at 2.5 mg/ml) and 5 µl of ALP substrate under the conditions of protection from light for 30 to 40 min at room temperature. ALP activity was tested using a luminometer (Promega, Madison, WI, USA).

Alizarin red S staining

C2C12 cells and MEF cells were seeded in 24-well plates treated with NC, miR-155 mimic or miR-155 inhibitor and BMP9 for 14 days. The supernatant was discarded, and cells washed three times with PBS. The cells were fixed with 0.05% ice-cold glutaraldehyde (Chongqing Chuandong Chemical Group) for 10 min and rinsed with double-distilled H2O. Then stained with 40 mM (2%) Alizarin red S (Sigma-Aldrich) at pH 4.0, rocked gently for ~5 min. The cells were rinsed three times with double-distilled H2O and then rinsed for 15 min with PBS and gently shaken. Finally cells were scanned at both a lower (ScanMaker 3600; Shanghai Microtek Technology Co., Ltd.) and higher magnification under a bright field microscope (T-DH; Nikon Corp.).

Western blot analysis

C2C12 cells and MEF cells were plated into a 10-cm Petri dishes. After treating cells as before, and when cells reached 80% confluence, cell lysate was collected and protein concentrations were determined using the Bio-Rad protein assay kit. The protein (50 µg) was boiled for 5 min in Laemmli buffer [62.5 mM Tris (pH 6.8), 1% sodium dodecyl sulfate (SDS), 20% glycerol, 0.01% bromophenol blue, and 100 mM DTT] before being loaded onto a 12% SDS-polyacrylamide gel and then transferred to PVDF membranes. Specific protein bands were detected with mouse anti-BMPR2 polyclonal antibody (1:200 dilution, cat. no. BM2821; BOSTER), rabbit anti-p-Smad1/5/8 monoclonal antibody (1:1,000 dilution, cat. no. sc-12353), rabbit anti-Smad1/5/8 monoclonal antibody (1:1,000 dilution, cat. no. sc-6031-R, lot no. D1911), rabbit anti-Runx2 monoclonal antibody (1:1,000 dilution, cat. no. sc-10758, lot no. A0810) (all from Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA), rabbit anti-osteocalcin (OCN) polyclonal antibody (1:200 dilution, cat. no. bs-4917R; Beijing Biosynthesis Biotechnology Co., Ltd.), rabbit anti-osteopontin (OPN) polyclonal antibody (1:500 dilution, cat. no. wl00691; Wanleibio, Shenyang, China), or anti-β-actin mouse monoclonal antibody (1:1,000 dilution; Zhongshan Golden Bridge Biotechnology Co., Ltd., Beijing, China) overnight at 4°C, and then washed with TBST three times, each time for 15 min, the membranes were incubated with goat anti-rabbit or goat anti-mouse horseradish peroxidase conjugated secondary antibody (1:5,000 dilution; Zhongshan Golden Bridge Biotechnology Co., Ltd.), for 1 h at 37°C. After that, membranes were washed with TBST three times, each time for 15 min. The secondary antibodies were detected with western chemiluminescence reagent (Millipore Corp., Billerica, MA, USA). The results were recorded using the Bio-Rad electrophoresis documentation system (Gel Doc 1000) and Quantity One software, version 4.5.0.

Luciferase reporter assay

TargetScan (http://www.targetscan.org) and PicTar (http://pictar.mdc-berlin.de/) were utilized to identify the possible target genes of miR-155 in BMP9-induced osteogenic differentiation of C2C12 cells and MEF cells. The 3′-UTR of Runx2 and BMPR2 containing miR-155-binding sequences, and the sequences contained binding sites with miR-155 were synthesised following the manufacturer's instructions (pMIR-REPORT™ system, miRNA expression reporter vector; Ambion, Carlsbad, CA, USA). The sequences contained binding sites with miR-155 are listed in Table III. The annealing fragments were then cloned into the SpeI/HindIII backbone of the pMIR-REPORT microRNA (miRNA) expression reporter (Ambion). Binding-region mutations were achieved using an oligo synthesis following the manufacturer's instructions (Ambion). Transient transfection into HEK-293 cells (1×104 cells/well) was carried out in 24-well plates with Lipofectamine 2000 transfection reagents (Invitrogen) following the manufacturer's instructions. The cells were co-transfected with 800 ng of the luciferase construct plasmid and miR-155 mimic or NC, and luciferase assays were performed using the dual-luciferase reporter assay system (Ambion) according to the manufacturer's instructions. Luminescent signals were quantified using a luminometer (Promega), and each value of luciferase activity was normalized by the luciferase activity of cells that transfected empty vector only.
Table III

The sequences contained binding sites with miR-155.

NameSequence (5′→3′)
WT-Runx2F: CTAGGATGTAGTTTGTTTTCACAATGTATGAAGGAGATGCTCTG
R: AGCTCAGAGCATCTCCTTCATACATTGTGAAAACAAACTACATC
MT-Runx2F: CTAGGATGTAGTTTGTTTTAGTAATGTATGAAGGAGATGCTCTG
R: AGCTCAGAGCATCTCCTTCATACATTACTAAAACAAACTACATC
WT-BMPR2F: CTAGCTTATGGGGTAATTAGCATTATAAGACTTTATAAAAGTGAGCTGATGGCTCTAGC
R: AGCTGCTAGAGCCATCAGCTCACTTTTATAAAGTCTTATAATGCTAATTACCCCATAAG
MT-BMPR2F: CTAGCTTATGGGGTAATTATTAGGATAAGACTTTATAAAAGTGAGCTGATGGCTCTAGC
R: AGCTGCTAGAGCCATCAGCTCACTTTTATAAAGTCTTATCCTAATAATTACCCCATAAG

WT-Runx2, Runx2-3′-UTR-wild-type; MT-Runx2, Runx2-3′-UTR-mutant type; WT-BMPR2, BMPR2-3′-UTR-wild-type; MT-BMPR2, BMPR2-3′-UTR-mutant type.

Ectopic in vivo bone formation assay of transfected MEF cells

All animal experiments were approved by Institutional Animal Care and Use Committee (IACUC) of Chongqing Medical University. The nude mice were purchased from Huafukang (Beijing Hfk Bioscience Co., Ltd., Beijing, China). MEF cells were transfected as described above, and the long-lasting mimic (mmu-agomiR-155) and inhibitor (mmu-antagomiR-155) of miR-155 were used, and the sequences are fully consistent with mmu-miR-155 or mmu-anti-miR-155. The sequence of stable NC is the same as the NC used before. In short, after treating cells like before, cells were collected at 80% confluence and for subcutaneous injection (5×106/injection) into the flanks of the athymic nude mice (5 animals/group, 4–6-week old, female) (44). At 4 weeks after implantation, heterotopic bones were harvested from mice after euthanasia, fixed in 4% paraformaldehyde and scanned using a µCT 40 system (Scanco Medical, Brüttisellen, Switzerland). Parameters computed from these data include bone mineral density (BMD), bone volume (BV/TV), trabecular thickness (Tb.Th), trabecular number (Tb.N) and trabecular separation (Tb.Sp). For histological analysis of bones, after scanning used µCT, decalcified in 10% EDTA for ~4 weeks, before being embedded in paraffin. Sections (5 µm) were cut and stained with hematoxylin and eosin (H&E) or with Masson's trichrome according to the manufacturer's instructions. Bone histomorphometry was performed using a microscope (T-DH; Nikon Corp.).

Statistical analysis

The quantitative experiments were performed in triplicate and/or repeated three times. Data are represented as the mean ± SD. Statistical significance between the control and treatment groups were determined by one-way analysis of variance and the Student's t-test. All statistical analyses were performed using GraphPad Prism 5 (GraphPad Software, Inc., La Jolla, CA, USA). P<0.05 was considered statistically significant.

Results

During the early stage of osteogenic differentiation induced by BMP9, the expression of miR-155 was increased at first and then decreased

Several differential expression miRNAs including miR-21, miR-23b and miR-155 have been previously identified during the early stage of mesenchymal stem cells (MSCs) osteogenesis induced by BMP9 through microarray data analysis (data not shown). Allowing us to consider that there are some associations between miR-155 and BMP9 in osteogenesis. During the early stage of osteogenic differentiation induced by BMP9, we detected the expression of miR-155 by using RT-qPCR on different days. It was found that compared with the expression level of 0 day, the expression level of miR-155 was upregulated in the early stage of BMP9-induced C2C12 cells and MEF cells osteogenic differentiation, and on the 5th day reached the maximum expression, then decreased on the 7th day (Fig. 1A). In our laboratory, BMP9 contains green fluorescence protein (GFP) tag, and so the results of fluorescence microscopy proved that BMP9 was transfected into C2C12 and MEF cells effectively (Fig. 1B). To further confirm the osteoinduction effect of BMP9, RT-qPCR was used to detect the mRNA expression level of osteoblast-specific genes over 7 days, including Runx2 and ALP. The results revealed that successful osteogenic differentiation of the C2C12 and MEF cells was induced (Fig. 1C).
Figure 1

The expression level of miR-155 is increased at first and then decreased in the process of bone morphogenetic protein 9 (BMP9)-induced early osteogenesis. (A) The expression of miR-155 was detected by RT-qPCR. *p<0.05 and ***p<0.001 vs. the value at day 0. (B) BMP9 was transfected into C2C12 cells and mouse embryonic fibroblasts (MEF) cells efficiently. Magnification, ×100. White, white light used as the excitation light; green, blue light used as the excitation light. Multiple of infection (MOI): 5. (C) The expression of runt-related transcription factor 2 (Runx2) and alkaline phosphatase (ALP) in C2C12 cells and MEF cells in differentiation days induced by BMP9 were detected by RT-qPCR. **p<0.01 and ***p<0.001 vs. the value at day 0. Day: osteogenic differentiation day.

Overexpression of miR-155 suppresses BMP9-induced ALP and calcium deposition in MSCs

Subsequently, to investigate the roles of miR-155 in the osteogenic differentiation of C2C12 cells and MEF cells induced by BMP9, the expression level of miR-155 following transfection were tested by RT-qPCR, in the whole study, we set control groups contain BMP9 group and BMP9 + miR-negative control group (BMP9 + NC) (Fig. 3A). After transfecting miR-155 or anti-miR-155 into C2C12 cells and MEF cells, respectively, induced osteogenesis by BMP9 for 7 days. ALP staining results showed that compared with the control groups, overexpressed miR-155 (BMP9 + miR-155) downregulated the early osteogenesis differentiation indicator-ALP activity, but inhibition of miR-155 (BMP9 + anti-miR-155) attenuated this inhibitive effect (Fig. 2A, top panel), quantitative determination of ALP activity, the results were in accordance with the ALP staining of C2C12 cells and MEF cells, respectively (Fig. 2A, bottom panel).
Figure 3

miR-155 downregulates the mRNA expression levels of osteogenesis genes runt-related transcription factor 2 (Runx2), osterix (OSX), alkaline phosphatase (ALP) and osteocalcin (OCN). C2C12 cells and mouse embryonic fibroblasts (MEF) were transfected with NC, miR-155 or anti-miR-155, respectively, then induced osteogenesis by bone morphogenetic protein 9 (BMP9). (A) The expression of miR-155 by RT-qPCR in the third day of differentiation. (B) Runx2 and OSX were tested on the 3rd day of differentiation, ALP and OCN were tested on the 7th day of differentiation in C2C12 cells. (C) Runx2 and OSX were tested on the 3rd day of differentiation, ALP and OCN were tested on the 7th day of differentiation in MEF cells. *p<0.05, **p<0.01 and ***p<0.001.

Figure 2

miR-155 inhibits the osteogenic differentiation of C2C12 cells and mouse embryonic fibroblasts (MEF) cells induced by bone morphogenetic protein 9 (BMP9). (A) Alkaline phosphatase (ALP) staining and ALP activity were performed after transfecting C2C12 cells and MEF cells with NC, miR-155 or anti-miR-155, induced osteogenesis by BMP9 for 7 days. (B) The effect of miR-155 on BMP9-induced matrix mineralization though Alizarin Red S staining on the 14th day of differentiation in C2C12 cells and MEF cells. Each staining was repeated three times for both types of the cells in this experiment, and one of the three independent results is shown. *p<0.05 and ***p<0.001.

We further analyzed the effect of miR-155 on late osteogenic differentiation by Alizarin Red S staining of matrix mineralization. The results were consistent with ALP staining, overexpressed exogenous miR-155 repressed the BMP9-induced calcium deposition of C2C12 cells and MEF cells, and decreased the endogenous miR-155 adverse effect (Fig. 2B). In conclusion, the above results indicated that miR-155 impairs the BMP9-induced osteoblast lineage commitment of MSCs.

miR-155 downregulates the mRNA expression level of osteogenesis-related genes

To detect the influence of miR-155 on the osteogenesis induced by BMP9 on mRNA level, firstly, we used RT-qPCR to measure the expression of miR-155 after transfection to verified that our transfection was successful. The data showed that during osteogenic differentiation induced by BMP9, compared with control group, the intracellular miR-155 level was significantly elevated by transfection with miR-155, whereas transfected with anti-miR-155 led to distinct reduction in miR-155 content (Fig. 3A). RT-qPCR was used to evaluate the expression level of Runx2 and osterix (OSX) on the 3rd day, the expression of ALP and OCN on the 7th day of BMP9-induced osteogenesis. Compared with the control groups, the expression of these osteogenesis markers were decreased by miR-155, conversely, anti-miR-155 increased their expression in the process of osteogenic differentiation induced by BMP9 in C2C12 cells, except the expression of OSX and ALP (Fig. 3B). The results of MEF cells were consis tent with C2C12 cells (Fig. 3C). Taken together, miR-155 could suppress the expression of Runx2, OSX, ALP and OCN, which are bone differentiation related markers.

miR-155 suppresses BMP signaling during the osteogenesis induced by BMP9

Previous studies revealed that Smads, p38 and ERK1/2 are involved in BMP9-induced osteogenic differentiation (45). We hypothesized that miR-155 may through inhibiting canonical Smad-dependent signaling repress the activity of downstream transcription factors to achieve suppressed osteoblastogenesis in MSCs. The expression levels of p-Smad1/5/8 and Runx2 were measured by western blot analysis after treatment of cells as above. Compared with the control group, overexpressed miR-155 group (BMP9 + miR-155) diminished the expression of p-Smad1/5/8 and Runx2, however, downregulated miR-155 group (BMP9 + anti-miR-155) eliminated this inhibitory effect in C2C12 cells (Fig. 4A) and MEF cells (Fig. 5A). Based on these data, we concluded that the negative effect of miR-155 on osteogenic differentiation may be through suppressing canonical BMP (BMP/Smad) signaling.
Figure 4

miR-155 acts as an inhibitor of osteogenesis via suppressing BMP signaling during osteogenesis induced by bone morphogenetic protein 9 (BMP9) in C2C12 cells. (A) After treatment of C2C12 cells, the expression of p-Smad1/5/8 and runt-related transcription factor 2 (Runx2) were detected by western blotting. (B) The protein expression levels of osteocalcin (OCN) and OPN were measured by western blotting. β-actin was used as the internal controls, **p<0.01 and ***p<0.001.

Figure 5

miR-155 acts as an inhibitor of osteogenesis via suppressing BMP signaling during the osteogenesis induced by bone morphogenetic protein 9 (BMP9) in mouse embryonic fibroblasts (MEF) cells. (A) After treatment of MEF cells, the expression of p-Smad1/5/8 and runt-related transcription factor 2 (Runx2) was detected by western blotting. (B) The protein expression levels of osteocalcin (OCN) and osteopontin (OPN) were measured by western blotting. β-actin was used as the internal controls, *p<0.05.

To further examine the role of miR-155 in late stage of osteogenic differentiation, we tested the expression of OCN and OPN by western blot analysis after treating C2C12 cells and MEF cells indicated above for 7 days. The results showed that compared with NC group (BMP9 + NC), exogenous overexpression of miR-155 (BMP9 + miR-155) decreased the expression of OCN and OPN, and downregulated miR-155 group (BMP9 + anti-miR-155) eliminated this inhibitory effect in C2C12 cells (Fig. 4B) and MEF cells (Fig. 5B). The above data demonstrated that inhibition of miR-155 led to BMP signaling that coincided with increased bone formation, strongly suggested that miR-155 suppressed BMP9-induced osteogenic differentiation by repressing BMP signaling.

miR-155 directly targets Runx2 and BMPR2 in BMP signaling

To further study the mechanisms of miR-155 inhibited osteogenic differentiation induced by BMP9, we used biological information analysis to find the potential targets of miR-155 in BMP signaling. From the target prediction tools (TargetScan and PicTar), we found the target binding sites of miR-155 on the 3′-UTR of Runx2 and BMPR2, which can complementary bind with miR-155 seed sequence. In order to evaluate whether Runx2 and BMPR2 are direct targets of miR-155, we measured the mRNA and protein expression levels following the regulation of miR-155 expression by transfecting the MSCs with NC, miR-155, or anti-miR-155. After determining the transfection efficiency (Fig. 6A), we discovered that in overexpressed-miR-155 C2C12 cells, the mRNA expression level of Runx2 and BMPR2 was not significantly altered compared with NC. In anti-miR-155 group, the expression levels had no significant changes as miR-155 group compared with NC (Fig. 6B). While, in MEF cells, the expression of Runx2 was increased in anti-miR-155 group compared with NC group, the expression level was not significantly altered in miR-155 group. The mRNA expression of BMPR2 had no markedly significant differences in different groups (Fig. 6D). However, compared with NC, the protein expression level of Runx2 and BMPR2 was decreased in miR-155 group in C2C12 cells and MEF cells, respectively (Fig. 6C and E). These results demonstrated that miR-155 significantly decreased the protein expression level of Runx2 and BMPR2, but did not markedly altered the mRNA expression levels, as compared with NC, respectively.
Figure 6

miR-155 directly targets runt-related transcription factor 2 (Runx2) and BMPR2. C2C12 cells and mouse embryonic fibroblasts (MEF) were transfected with NC, miR-155 or anti-miR-155, respectively. (A) Detected the expression of miR-155 by RT-qPCR. (B) Tested the expression of Runx2 and BMPR2 in C2C12 cells by RT-qPCR. (C) The expression of Runx2 and BMPR2 in C2C12 cells by western blotting. (D) The expression of Runx2 and BMPR2 in MEF cells by RT-qPCR. (E) The expression of Runx2 and BMPR2 in MEF cells by western blotting. (F) Putative binding sites for miR-155 in the 3′-untranslated region (3′-UTR) of Runx2 and BMPR2 as predicted by TargetScan and PicTar. Mutated nucleotides in mutant Runx2 3′-UTR and BMPR2 3′-UTR seed sequences are represented in blue. (G) Luciferase reporter assays in HEK-293 cells. Cells were co-transfected with WT-Runx2, or MT-Runx2, or WT-BMPR2 or MT-BMPR2 reporter construct or miR-155 overnight. Forty-eight hours post transfection luciferase activities were tested. Results were normalized to the value of cells that transfected pMIR-REPORT only. β-actin was used as the internal controls for western blotting, **p<0.01 and ***p<0.001.

To test whether miR-155 directly binds to the 3′-UTR of Runx2 and BMPR2, luciferase reporter assays were performed in HEK-293 cells. We directly designed and synthesized sequences matching miR-155 target sites and cloned these wild-type and mutant-type into the multiple cloning sites of pMIR-REPORT luciferase, termed WT-Runx2, MT-Runx2, WT-BMPR2 and MT-BMPR2 (Fig. 6F). Luciferase levels were significantly reduced when cells were co-transfected with WT-Runx2 and miR-155 compared with the cells that co-transfected with WT-Runx2 and NC. However, this difference was abolished when the binding site was mutated suggesting a specific Runx2miR-155 direct interaction (Fig. 6G). For BMPR2, the result was the same as Runx2, when co-transfected with WT-BMPR2 and miR-155 into HEK-293 cells, luciferase activity was decreased remarkable, mutated binding site could offset this depressant effect demonstrating a specific BMPR2miR-155 direct interaction (Fig. 6G). In conclusion, the results suggested that Runx2 and BMPR2 are direct targets of miR-155.

miR-155 decreases the the expression of Runx2 and BMPR2 in the osteogenic differentiation induced by BMP9

To validate the role of Runx2 and BMPR2 in miR-155 inhibited osteogenic differentiation of MSCs induced by BMP9, we tested the expression changes of Runx2 and BMPR2 under the influence of miR-155 in osteogenesis. In C2C12 cells and MEF cells, in the process of differentiation, compared with NC, miR-155 repressed the expression of Runx2 at mRNA level (Fig. 3B and C) and protein level (Figs. 4A and 5A), and anti-miR-155 reduced the inhibitory effect of miR-155 on the expression of Runx2 and BMPR2. In C2C12 and MEF cells, miR-155 had no obvious influence at the expression of mRNA level, compared with NC during the differentiation (Fig. 7A). However, it reduced the protein expression level of BMPR2, and anti-miR-155 promoted the protein level in C2C12 cells compared with NC (Fig. 7B).
Figure 7

During the osteogenic differentiation induced by bone morphogenetic protein 9 (BMP9), miR-155 decreases the expression of BMPR2. (A) The mRNA expression of BMPR2 in C2C12 cells and mouse embryonic fibroblasts (MEF) cells by RT-qPCR. (B) The protein expression of BMPR2 in C2C12 cells and MEF cells by western blot. β-actin was used as the internal controls, *p<0.05, **p<0.01 and ***p<0.001.

Knockdown of Runx2 and BMPR2 reduce the inhibitory effect of miR-155 on the osteogenic differentiation induced by BMP9

To further verify the association between miR-155 and its target genes, Runx2, and BMPR2, we blocked the expression of Runx2 by si-Runx2, and blocked the expression of BMPR2 by shBMPR2. Through blocking the target genes of miR-155, the effect of miR-155 on osteogenesis of MSCs was evaluated, to speculate on the function of the target genes of miR-155. After transfecting si-Runx2, shBMPR2 or their controls into C2C12 cells and MEF cells, respectively, used RT-qPCR to examine the interfering efficiency, data showed that compared with the control groups, the expression of Runx2 and BMPR2 was significantly decreased (Fig. 8A). The results of western blot analysis shown that the protein expression of Runx2 and BMPR2 was significantly reduced compared with their control group, respectively (Fig. 8B).
Figure 8

Interference of runt-related transcription factor 2 (Runx2) and BMPR2 in C2C12 cells and mouse embryonic fibroblasts (MEF), respectively. (A) The interference efficiency of si-Runx2 and shBMPR2 in C2C12 cells and mouse embryonic fibroblasts (MEF) after transfection by RT-qPCR. (B) The interference efficiency of si-Runx2 and shBMPR2 in C2C12 cells and MEF cells after transfection by western blotting. β-actin was used as the internal controls, ***p<0.001.

In C2C12 cells, the expression of Runx2, OSX, ALP and OCN were distinctly decreased when transfected with si-Runx2 (BMP9 + si-Runx2) compared with RFP (BMP9 + RFP); and in co-transfection with miR-155 and si-Runx2 group (BMP9 + miR-155 + si-Runx2), the expression of these four bone-related genes were significantly increased compared with co-transfection with miR-155 and RFP group (BMP9 + miR-155 + RFP) (Fig. 9A). In the process of osteogenesis, after transfecting shBMPR2 (BMP9 + shBMPR2), the expression of Runx2, OSX, ALP and OCN were markedly decreased compared with control group (BMP9 + shNC); in co-transfected miR-155 and sh-BMPR2 group (BMP9 + miR-155 + sh-BMPR2), the expression of these four bone differentiation related genes was notably increased compared with co-transfected with miR-155 and shNC group (BMP9 + miR-155 + shNC) (Fig. 9B). The results obtained from MEF cells coincided with the results of C2C12 cells (Fig. 10), when co-transfected with miR-155 and si-Runx2 or sh-BMPR2, the expression of Runx2, OSX, ALP and OCN was remarkably increased compared with co-transfected with miR-155 and RFP or shNC, respectively. These data indicated that knockdown of Runx2 and BMPR2, respectively, the effect of miR-155 on the osteogenic differentiation induced by BMP9 was reduced. In conclusion, miR-155 inhibited osteogenic differentiation induced by BMP9 may be through repression of the expression of its target genes-Runx2 and BMPR2, which are, at least partially, quite important components in BMP signaling.
Figure 9

Knockdown of runt-related transcription factor 2 (Runx2) and BMPR2 separately reduced the effect of miR-155 in C2C12 cells. (A and B) C2C12 cells were co-transfected with RFP, or si-Runx2, or shNC, or shBMPR2, or miR-155, then induced osteogenic differentiation by bone morphogenetic protein 9 (BMP9) for 3 days to test the expression of Runx2, osterix (OSX), and induced for 7 days to test the expression of alkaline phosphatase (ALP), osteocalcin (OCN) used RT-qPCR. *p<0.05, **p<0.01 and ***p<0.001.

Figure 10

Knockdown runt-related transcription factor 2 (Runx2) and BMPR2 separately reduced the effect of miR-155 in mouse embryonic fibroblasts (MEF) cells. (A and B) MEF cells were co-transfected with RFP or si-Runx2 or shNC or shBMPR2 and miR-155, then induced osteogenic differentiation by BMP9 for 3 days to test the expression of Runx2, osterix (OSX), was induced for 7 days to test the expression of alkaline phosphatase (ALP) and osteocalcin (OCN) by RT-qPCR. *p<0.05, **p<0.01 and ***p<0.001.

Effect of miR-155 on in vivo ectopic bone formation of BMP9

To determine the consequences of miR-155 on osteogenic differentiation induced by BMP9 in vivo, we performed µCT analysis of heterotopic bones from 10-week-old female nude mice. The microarchitecture of bones were in accordance with data from cell culture experiments, µCT images of ectopic bones showed decreased trabecular bone volume in BMP9 + agomiR-155 group compared to BMP9 + NC group, while in BMP9 + antagomiR-155 group, the trabecular bone volume was increased compared with BMP9 + NC group (Fig. 11A). In µCT analyses, BMP9 + agomiR-155 group exhibited significant decrease in BMD, BV/TV and Tb.Th, but a significant increase in Tb.SP, there were no variances in Tb.N compared with BMP9 + NC group, respectively. On the contrary, antago-miR-155 elevated BV/TV and Tb.Th of the bones consequently, and had no effect on Tb.N, Tb.SP and BMD in the ectopic bone induction of BMP9 as well (Fig. 11B). After the µCT scan, all specimens were subjected to a histological study involving H&E staining and Masson's trichrome staining. In histological analyses, the results correspond to the results that we gained from cell culture in vitro. agomiR-155 inhibited the osteogenic differentiation of MEF cells induced by BMP9 in vivo, decreased trabecular bone mass, whereas antagomiR-155 reversed this phenomenon (Fig. 11C). The results of Masson's trichrome staining were very similar to the H&E staining in all the groups, showing that the chondrocytes were stained in BMP9 + antagomir-155 group more, but in BMP9 + agomiR-155 group, the staining was lighter compared with BMP9 + NC, respectively (Fig. 11D). Given the above, in vivo, agomiR-155 depressed the ectopic bone formation of MEF cells induced by BMP9, antagomiR-155 facilitated ectopic bone formation, conversely.
Figure 11

miR-155 repressed ectopic bone formation induced by bone morphogenetic protein 9 (BMP9) in vivo. Ectopic bones were harvested 6 weeks after treated-mouse embryonic fibroblasts (MEF) cells were injected subcutaneously in 4-week-old female nude mice. (A) µCT with representative image of the ectopic bones. Scale bar, 1 mm. (B) µCT quantification of the ectopic bones from 10-week-old female nude mice, which were injected with transfected-MEF cells at 4 weeks. Parameters include: trabecular number, thickness, separation, volume and BMD. n=3, *p<0.05, **p<0.01 and ***p<0.001. (C) Histological images of 6-week ectopic bones from each group upon H&E staining. Scale bars, 100 µm. (D) Histological images of 6-week ectopic bones from each group upon Masson's trichrome staining. Scale bars, 100 µm.

Discussion

Osteoblasts are a class of bone-forming cells that originate from bone marrow stromal (skeletal or mesenchymal) stem cells and are responsible for bone growth during development and bone formation during remodeling of the post-natal skeleton. Previous studies identified BMP9 as one of the most powerful osteogenic BMPs, both in vitro and in vivo (2,4,9,29). As one of the most osteogenic BMPs, BMP9 can induce MSCs to differentiate into osteoblasts (46–48). But the specific mechanisms of BMP9 osteoinduction are not very clear, it is necessary to investigate the complete regulatory mechanisms of BMP9-induced osteogenic differentiation. In this study, during the early stage of BMP9-induced osteogenic differentiation of MSCs, the expression of miR-155 presented early increased and later decreased trend, indicated that there are some relationship between miR-155 and BMP9. A one study indicated that miR-155 could modulate the inhibitory effect of TNF-α on BMP-2-induced osteogenic differentiation in MC3T3-E1 cells (43), suggested potential relationships among them. Based on the staining experiments, we speculated miR-155 may be a negative regulator in osteogenic differentiation. The results of in vitro supported our hypothesis suggesting that miR-155 inhibits the osteogenic differentiation of MSCs induced by BMP9 may be via suppressing Smad/BMP signaling activity and repressing the expression of Runx2 and BMPR2. Although, in some cases, anti-miR-155 had a modest effect on the expression of bone-related genes compared with NC, suggested that anti-miR-155 could reverse the inhibitory effect of miR-155 on the osteogenic differentiation of MSCs induced by BMP9, sufficiently. In vivo, agomiR-155 repressed the ectopic bone formation, providing more believable evidence to prove our hypothesis. Early studies revealed that canonical Smad-dependent signaling pathway and non-canonical Smad-independent signaling (p38 MAPKs) pathway are involved in BMP9-induced osteogenic differentiation of MSCs. MAPKs are a group of well-described serine/threonine-specific protein kinases generally expressed in all cell types (9,29,48). At least four subfamilies of mammalian MAPKs have been identified, including ERK1/2, ERK5 (also known as MAPK7 or BMK1), the Jun amino-terminal kinases (JNKs) and p38 MAPKs. ERK1/2, JNKs, and p38 are involved in BMP9-induced osteogenic differentiation of MSCs (44,45,49,50). Whether miR-155 influence the non-canonical Smad-independent signaling (p38 mitogen-activated protein kinase, MAPK) pathway has not been investigated, to study the mechanisms further, we can focus on this aspect. As Runx2 and BMPR2 were verified as the target genes of miR-155 in our study, they were interfered by siRNA, or shRNA to block the targets of miR-155. The results showed that miR-155 failed to inhibit osteogenic differentiation, suggesting miR-155 may play negative regulatory roles in BMP9-induced osteogenic differentiation through repressed expression of Runx2 and BMPR2. More regulatory factors and the corresponding mechanisms in the process of BMP9-induced osteogenic differentiation need to be explored. Finding more target genes of miR-155 in BMP signaling is beneficial to understand the mechanism of action of miR-155, promote the clinic application of BMP9 finally.
  50 in total

1.  Transcriptional characterization of bone morphogenetic proteins (BMPs)-mediated osteogenic signaling.

Authors:  Ying Peng; Quan Kang; Hongwei Cheng; Xinmin Li; Michael H Sun; Wei Jiang; Hue H Luu; Jae Yoon Park; Rex C Haydon; Tong-Chuan He
Journal:  J Cell Biochem       Date:  2003-12-15       Impact factor: 4.429

Review 2.  MicroRNAs involved in skeletal muscle differentiation.

Authors:  Wen Luo; Qinghua Nie; Xiquan Zhang
Journal:  J Genet Genomics       Date:  2013-02-20       Impact factor: 4.275

Review 3.  The function of microRNAs, small but potent molecules, in human prostate cancer.

Authors:  S Sevli; A Uzumcu; M Solak; M Ittmann; M Ozen
Journal:  Prostate Cancer Prostatic Dis       Date:  2010-06-29       Impact factor: 5.554

4.  Crystal structure of BMP-9 and functional interactions with pro-region and receptors.

Authors:  Monica A Brown; Qinghai Zhao; Kent A Baker; Chethana Naik; Cecil Chen; Laurie Pukac; Mallika Singh; Tatiana Tsareva; Yanick Parice; Angela Mahoney; Viktor Roschke; Indra Sanyal; Senyon Choe
Journal:  J Biol Chem       Date:  2005-04-25       Impact factor: 5.157

5.  Unique microRNA molecular profiles in lung cancer diagnosis and prognosis.

Authors:  Nozomu Yanaihara; Natasha Caplen; Elise Bowman; Masahiro Seike; Kensuke Kumamoto; Ming Yi; Robert M Stephens; Aikou Okamoto; Jun Yokota; Tadao Tanaka; George Adrian Calin; Chang-Gong Liu; Carlo M Croce; Curtis C Harris
Journal:  Cancer Cell       Date:  2006-03       Impact factor: 31.743

6.  MicroRNA-204 regulates Runx2 protein expression and mesenchymal progenitor cell differentiation.

Authors:  Jian Huang; Lan Zhao; Lianping Xing; Di Chen
Journal:  Stem Cells       Date:  2010-02       Impact factor: 6.277

7.  Insulin-like growth factor 2 (IGF-2) potentiates BMP-9-induced osteogenic differentiation and bone formation.

Authors:  Liang Chen; Wei Jiang; Jiayi Huang; Bai-Cheng He; Guo-Wei Zuo; Wenli Zhang; Qing Luo; Qiong Shi; Bing-Qiang Zhang; Eric R Wagner; Jinyong Luo; Min Tang; Christian Wietholt; Xiaoji Luo; Yang Bi; Yuxi Su; Bo Liu; Stephanie H Kim; Connie J He; Yawen Hu; Jikun Shen; Farbod Rastegar; Enyi Huang; Yanhong Gao; Jian-Li Gao; Jian-Zhong Zhou; Russell R Reid; Hue H Luu; Rex C Haydon; Tong-Chuan He; Zhong-Liang Deng
Journal:  J Bone Miner Res       Date:  2010-11       Impact factor: 6.741

8.  Bone Morphogenetic Protein (BMP) signaling in development and human diseases.

Authors:  Richard N Wang; Jordan Green; Zhongliang Wang; Youlin Deng; Min Qiao; Michael Peabody; Qian Zhang; Jixing Ye; Zhengjian Yan; Sahitya Denduluri; Olumuyiwa Idowu; Melissa Li; Christine Shen; Alan Hu; Rex C Haydon; Richard Kang; James Mok; Michael J Lee; Hue L Luu; Lewis L Shi
Journal:  Genes Dis       Date:  2014-09

9.  microRNA-155 regulates the generation of immunoglobulin class-switched plasma cells.

Authors:  Elena Vigorito; Kerry L Perks; Cei Abreu-Goodger; Sam Bunting; Zou Xiang; Susan Kohlhaas; Partha P Das; Eric A Miska; Antony Rodriguez; Allan Bradley; Kenneth G C Smith; Cristina Rada; Anton J Enright; Kai-Michael Toellner; Ian C M Maclennan; Martin Turner
Journal:  Immunity       Date:  2007-12-06       Impact factor: 31.745

10.  MicroRNA Response Elements-Mediated miRNA-miRNA Interactions in Prostate Cancer.

Authors:  Mohammed Alshalalfa
Journal:  Adv Bioinformatics       Date:  2012-11-04
View more
  16 in total

Review 1.  The Emerging Role of Non-Coding RNAs in Osteogenic Differentiation of Human Bone Marrow Mesenchymal Stem Cells.

Authors:  Xiaoying Chen; Wei Xie; Ming Zhang; Yuhan Shi; Shaofen Xu; Haoyu Cheng; Lihong Wu; Janak L Pathak; Zhichao Zheng
Journal:  Front Cell Dev Biol       Date:  2022-05-16

Review 2.  MicroRNAs and long noncoding RNAs: new regulators in cell fate determination of mesenchymal stem cells.

Authors:  Zixiang Wu; Shujing Liang; Wenyu Kuai; Lifang Hu; Airong Qian
Journal:  RSC Adv       Date:  2019-11-14       Impact factor: 4.036

3.  Long Noncoding RNA GAS5 Inhibits Osteogenic Differentiation through MicroRNA 382-3p/TAF1 Signaling.

Authors:  Yuxin Song; Hui Zhang; Zhengdong Song; Yang Yang; Suifeng Zhang; Wenji Wang; Shanyong Zhang
Journal:  Mol Cell Biol       Date:  2021-12-13       Impact factor: 5.069

4.  MiR-155 inhibition alleviates suppression of osteoblastic differentiation by high glucose and free fatty acids in human bone marrow stromal cells by upregulating SIRT1.

Authors:  Bo Qu; Jun He; Zhimou Zeng; Hongsheng Yang; Zhanli Liu; Zongrui Cao; Hua Yu; Wen Zhao; Xianming Pan
Journal:  Pflugers Arch       Date:  2020-04-04       Impact factor: 3.657

5.  MICROmanagement of Runx2 Function in Skeletal Cells.

Authors:  Benjamin J Wildman; Tanner C Godfrey; Mohammad Rehan; Yuechuan Chen; Lubana H Afreen; Quamarul Hassan
Journal:  Curr Mol Biol Rep       Date:  2019-01-24

6.  [The regulatory role of microRNA in osteogenic differentiation of mesenchymal stem cells and its application as a therapeutic target and diagnostic tool in orthopedic diseases].

Authors:  Xiaolong Li; Qingquan Kong
Journal:  Zhongguo Xiu Fu Chong Jian Wai Ke Za Zhi       Date:  2020-10-15

Review 7.  The role of microRNAs in bone development.

Authors:  Austin P Hensley; Audrey McAlinden
Journal:  Bone       Date:  2020-11-19       Impact factor: 4.626

Review 8.  Regulation and Role of Transcription Factors in Osteogenesis.

Authors:  Wilson Cheuk Wing Chan; Zhijia Tan; Michael Kai Tsun To; Danny Chan
Journal:  Int J Mol Sci       Date:  2021-05-21       Impact factor: 5.923

Review 9.  Perspectives of small molecule inhibitors of activin receptor‑like kinase in anti‑tumor treatment and stem cell differentiation (Review).

Authors:  Xueling Cui; Shumi Shang; Xinran Lv; Jing Zhao; Yan Qi; Zhonghui Liu
Journal:  Mol Med Rep       Date:  2019-04-30       Impact factor: 2.952

Review 10.  Role of MicroRNAs in Bone Pathology during Chikungunya Virus Infection.

Authors:  Enakshi Roy; Siddappa N Byrareddy; St Patrick Reid
Journal:  Viruses       Date:  2020-10-23       Impact factor: 5.048

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.