Occurrence of Helicobacter pylori and its major virulence genotypes in dental plaque samples of patients with chronic periodontitis in Iran.

AIM: This study was aimed to investigate the presence of H. pylori and its virulence genotypes in dental plaques of Iranian patients with chronic periodontitis.
BACKGROUND: Helicobacter pylori is a Gram-negative bacterium that is associated with atrophic gastritis, peptic ulcer, and gastric cancer. Several studies have detected this bacterium in the oral cavity, suggesting it as a potential reservoir.
METHODS: A hundred individuals were divided in 2 groups: 50 patients with chronic periodontitis (case group), and 50 subjects in non-periodontitis (control group). Supragingival and subgingival plaque samples were collected from the individuals using wood wedges and sterile paper points respectively, and prepared for PCR analysis.
RESULTS: Totally, H. pylori DNA was detected in 5 out of 100 (5%) dental plaques. Of 5 dental plaques positive for H. pylori, cagA gene was detected in 4 specimen, 3 in periodontitis group and one in non-periodontitis group. The H. pylori vacA s1m1 genotype was predominantly detected in 2/5 samples. The babA2 gene was detected in all (5/5) H. pylori-positive dental plaques. There was no significant correlation between the presence of H. pylori genotypes from dental plaques and chronic periodontitis (P > 0.05).
CONCLUSION: Our results revealed that the rate of H. pylori is very low in the dental plaques of Iranian patients with chronic periodontitis. Majority of H. pylori strains from oral cavity were highly virulent based on the main clinically virulence factors they carried.

Introduction

Helicobacter pylori (H. pylori) is a spiral-shaped Gram-negative bacterium discovered by Warren and Marshall in 1982 (1). This highly prevalent organism is considered as the main risk factor for different gastroduodenal diseases such as chronic active gastritis, peptic ulcers and gastric cancer (2, 3). Several studies have reported the presence of H. pylori in dental plaque and saliva, implicating the oral cavity as a potential extragastric reservoir for H. pylori that may lead to reinfection of the stomach after eradication therapy (4-6). However, it is still unclear whether the oral cavity is a permanent or transient reservoir of this bacterium. Some researchers believe that H. pylori may be regarded as a member of the microbiota of the human oral cavity maintaining a commensal interplay with the host (7-9). In contrast, other authors have suggested that H. pylori only transiently colonizes oral cavities due to ingestion of contaminated foods or as a result of occasional gastroesophageal reflux (10, 11).

Genetic studies show that H. pylori strains display high variability in the gene content, and extreme heterogeneity has been observed among strains from different geographical regions (12, 13). Several H. pylori virulence factors have been identified that are associated with severe clinical outcomes. The cytotoxin associated antigen (cagA) gene is the most studied virulence factor of H. pylori, located at the end of an approximately 40 kb cluster of genes called cag pathogenicity island (cagPAI) (14, 15). The cagA gene is present in 60-70% of H. pylori strains based on the geographical origin, and is associated with severe gastroduodenal diseases including atrophic gastritis, peptic ulcer and gastric adenocarcinoma (16, 17).

The vacuolating cytotoxin (vacA) gene is another important virulence factor of H. pylori, which is supposed to be associated with the risk of developing peptic ulcers and gastric cancer (18, 19). The vacA gene is present in all H. pylori strains and has a mosaic structure consisting of allelic variations in its signal (s) and mid (m) regions, each having two distinct alleles (s1/s2, m1/m2) with different biological activities (20, 21). Strains with vacA s1m1 genotype produce large amounts of toxin and are strongly associated with a higher degree of inflammation and epithelial damage in the gastric mucosa; s1m2 strains produce moderate amounts of toxin while the s2m2 strains produce very little or no toxin (20).

In addition to the afore-mentioned factors, the babA2 gene encodes a blood group antigen-binding adhesion (babA), which has been shown to mediate adherence of H. pylori to human lewisb blood group antigens on gastric epithelial cells. Several studies suggested that the presence of babA2 was associated with an increased risk of peptic ulcers and gastric cancer in Western populations (22, 23).

Dental plaque is a complex well-organized polymicrobial community that forms a biofilm in which several different bacterial species are intimately associated with each other and with the solid substratum through specific interactions (24, 25). Insufficient oral hygiene measures enhance the formation of dental plaque on the supragingival and subgingival tooth surfaces, where tissue destruction results in progressive deepening of the periodontal pockets (26, 27). Several studies have reported the presence of H. pylori in patients with gingivitis or chronic periodontitis, suggesting that progression of periodontal pocket and inflammation may favor colonization by this pathogen (28-30). H. pylori has also been proposed to have a special preference for the activated state of inflammation in periodontitis, and many studies have reported that carriage of H. pylori may be associated with periodontal disease (27, 29, 30).

Several studies have reported that H. pylori infection is common in Iran as in other developing countries (31-34). However, there are a few reports about the prevalence of H. pylori in the oral cavity of Iranian patients with chronic periodontal disease. Since poor oral hygiene measures are strongly associated with inflammatory responses in the periodontal disease, it seems biologically reasonable to investigate the presence of H. pylori in relation to periodontal conditions (28). Moreover, the prevalence and distribution of virulence genotypes of H. pylori strains in the oral cavity has been rarely investigated. Therefore, in this study we aimed to investigate the occurrence of H. pylori in dental plaque samples of individuals with or without chronic periodontitis, and also to determine the related virulence genotypes including cagA, vacA subtypes and babA2 in an Iranian population.

Methods

Study population and sample collection

The population of this study consisted of 50 patients with chronic periodontitis (case group), and 50 individuals without periodontal disease (control group) whom referred for treatment to Department of Periodontics and Implant of Tehran University of Medical Sciences, between September and December 2014. Written informed consent was obtained from all individuals in order to be included in the study. The study protocol was approved by the scientific research ethical committee of Tehran University of Medical Sciences.

Supragingival plaque samples were collected from both groups, control and case, using sterile wood wedges by scrapping the posterior tooth surfaces. Cotton rolls and air-drying with syringe were used to avoid saliva contamination of the plaque samples. Sterile paper points were also used to collect subgingival plaque samples from all patients with periodontal disease (case group). Subgingival plaque was obtained after removal of supragingival plaque by inserting two sterile paper points into the gingival sulcus/pocket for 20 seconds. Subgingival sampling sites in periodontitis patients exhibited clinical probing depth ≥5 mm and bleeding on probing. Each sample was immediately placed in a sterile tube containing 0.5 ml of Tris-EDTA buffer and mixed well by vortexing for 30-60 seconds. All samples were then immediately placed in coolers containing dry ice, transported to the laboratory, and stored at -20° C until DNA extraction.

Preparation of Genomic DNA

To prepare DNA from dental plaques, the samples were thawed at ambient temperature, and centrifuged at 12,000 × g for 15 min. The supernatant was discarded and the precipitate containing nucleic acids was kept on ice and used for DNA extraction. Then DNA was extracted from each sample using QIAamp DNA Mini Kit (Qiagen, Hilden, Germany) according to manufacturer’s instructions. The concentration and quality of DNA preparations were determined using a NanoDrop spectrophotometer, by measuring absorbance at wavelengths of A260 and A280 nm and also by agarose gel electrophoresis.

PCR Amplification

DNA extracted from dental plaque samples of all individuals was subjected to PCR assay using specific primers. To confirm the presence of H. pylori DNA in dental plaques, the Helicobacter genus- and species-specific PCR reactions were performed using primers for the 16S rRNA and ureC (glmM) genes (32). PCR-based genotyping was carried out on all H. pylori-positive DNA samples for the detection of cagA gene, vacA alleles (s1, s2, m1 and m2) and babA2 in separate reactions using previously described primers (31, 32). The sequences of all oligonucleotide primers used in this study are listed in Table 1. All PCR reactions were performed in a 25 µl reaction mixture containing 5 µl of template DNA (approximately 100 ng), 0.1 mM of each primer, 2.5 µl of 10X PCR buffer, 100 mM of each dNTPs, 1 mM MgCl2, and 1.5 U of SuperTaqTM DNA polymerase (HT Biotechnology Ltd., Cambridge, UK). PCR was performed in a thermocycler (Eppendorf, Hamburg, Germany) as follows: initial denaturation at 94°C for 4 min, which was followed by 35 cycles of denaturation at 94°C for 1 min, annealing at the indicated temperature for each reaction in Table 1 for 45 s, extension at 72°C for 1 min, and then final extension at 72°C for 10 min. Five-microlitre aliquots of the amplified products were analyzed by electrophoresis in a 1.2% (w/v) agarose gel (Roche Diagnostics, Mannheim, Germany) and stained with ethidium bromide (0.5 µg/ml). Stained amplicons were visualized on a UV transilluminator at 260 nm, and photographed (BioDoc-It System, UVP, USA). DNA extracted from H. pylori J99 (CCUG 47164) was included in every set of reaction as positive control. A no-template added reaction also served as negative control in each PCR experiment.

Table 1

Details of oligonucleotide primer sequences used in this study

Target gene	Primer designation	Oligonucleotide sequence (5΄- 3΄)	Annealing temperature (°C)	PCR product (bp)
16S rRNA	C97-20H3A-20	GGCTATGACGGGTATCCGGCGCCGTGCAGCACCTGTTTTC	58	764
ureC fragment (glmM)	GlmM2-FGlmM1-R	GGATAAGCTTTTAGGGGTGTTAGGGGGCTTACTTTCTAACACTAACGCGC	56	296
cagA	9308993261	AATACACCAACGCCTCCAAGTTGTTGCCGCTTTTGCTCTC	57	400
vacA s1/s2	VA1-FVA1-R	ATGGAAATACAACAAACACACCTGCTTGAATGCGCCAAAC	57	259/286
vacA m1/m2	VAG-FVAG-R	CAATCTGTCCAATCAAGCGAGGCGTCAAAATAATTCCAAGG	57	570/645
babA2	bab7-Fbab7-R	CCAAACGAAACAAAAAGCGTGCTTGTGTAAAAGCCGTCGT	52	271

Statistical analysis

Statistical analysis of the data was performed using SPSS software version 21 (IBM Corporation, NY, USA). The Chi-square and Fischer’s exact tests were used to analyze the detection frequency of H. pylori in dental plaques of patients with and without periodontitis, and the possible association between H. pylori genotypes and periodontal disease. A P value of less than 0.05 was considered statistically significant.

Results

Prevalence of in dental plaque samples

Of 50 patients with chronic periodontitis (case group), randomly 25 (50%) were women and 25 (50%) were men with a mean age of 41.86 years (range 16 to 70 years). Among 50 individuals without periodontal disease (control group), 31 (62%) were women and 19 (38%) were men with a mean age of 36.5 years (range 17 to 75 years). Demographic characteristics of the patients with chronic periodontitis, and individuals without periodontal disease are presented in Table 2. Totally, H. pylori DNA was detected in 5 out of 100 (5%) dental plaque samples (Table 3). In the periodontitis group H. pylori DNA was detected in 4/50 (8%) dental plaque samples. H. pylori DNA was present in only one dental plaque sample from the individuals in non-periodontitis group. The prevalence of H. pylori in the dental plaques of patients with periodontitis was higher than in plaque samples from subjects without periodontal disease. However, no significant correlation was found between the presence of H. pylori in dental plaque and periodontal disease (P > 0.05).

Table 2

Demographic characteristics of patients with chronic periodontitis, and non-periodontitis

Demographic and clinical complication	Periodontitis group (n = 50)No. (%)	Non-periodontitis group (n = 50)No. (%)
Age (years)
MeanRange	41.8616-70	36.5017-75
Gender
MaleFemale	25 (50)25 (50)	19 (38)31 (62)
Antibiotic consumption
Two monthsSix months	15 (30)13 (26)	13 (26)13 (26)
Smoking	9 (18)	1 (2)
Alcohol consumption	3 (6)	2 (4)
Gastritis	11 (22)	5 (10)
Dental scaling	8 (16)	9 (18)

Table 3

Frequency of H. pylori and its virulence genotypes in the dental plaque of chronic periodontitis patients (case group), and non-periodontitis group (control group

H. pylori genotypes	Periodontitis group (n = 50)No. (%)	Non-periodontitis group (n = 50)No. (%)	Total (n = 100) (%)
H. pylori in dental plaque
PresentAbsent	4 (8)46 (92)	1 (2)49 (98)	5 (5)95 (95)
H. pylori history in stomach
YesNo	5 (10)45 (90)	2 (4)48 (96)	7 (7)93 (93)
cagA	3 (6)	1 (2)	4 (4)
vacAs1vacAs2	3 (6)1 (2)	0 (0)1 (2)	3 (3)2 (2)
vacAm1vacAm2	3 (6)1 (2)	0 (0)1 (2)	3 (3)2 (2)
vacAs1m1vacAs1m2vacAs2m1vacAs2m2	2 (4)1 (2)1 (2)0 (0)	0 (0)0 (0)0 (0)1 (2)	2 (2)1 (1)1 (1)1 (1)
babA2	4 (8)	1 (2)	5 (5)

Virulence genotyping

Of 5 dental plaque samples positive for H. pylori, the cagA gene was detected in 4 specimen, 3 in periodontitis group and one in non-periodontitis group (Table 3). The H. pylori vacA s1m1 genotype was detected in 2/5 samples, while the vacA s1m2, s2m1 and s2m2 genotypes all were present with the same prevalence (1/5) among the H. pylori-positive dental plaque samples. The babA2 gene was detected in all (5/5) H. pylori-positive dental plaque samples, 4 in periodontitis group and one in non-periodontitis group. There was no significant correlation between H. pylori genotypes from dental plaque samples and chronic periodontitis (P > 0.05).

Discussion

H. pylori infection is the most prevalent chronic bacterial disease affecting approximately half of the world’s population, and its prevalence shows wide geographical variations in different regions of the world. In developing countries, more than 80% of the population is infected that is inversely associated with socioeconomic status (2, 12). It is assumed that existence of H. pylori in the oral cavity, oral lesions and dental plaques may play an important role in the pathogenesis of reinfection. The presence of this organism may be very low within the mouth and the numbers of bacteria seem to vary in different niches in the oral cavity, such as dental plaque, tongue, and saliva as well as in oral ulcer lesions (35-39). There are many conflicting reports about the detection rate of H. pylori from dental plaques, ranging from 0-100% in different studies around the world (40). These noticeable variations in the prevalence of H. pylori in dental plaque samples basically arise from several methodological differences, such as differences in study designs, characteristics of the sample population, different methods used for plaque sampling, different assays exploited to identify the bacteria in dental specimen, and also differences in geographical regions.

The prevalence of H. pylori has been reported to be very low in dental plaque of Iranian patients with periodontal disease, and varied from 0 to 5.9% in recent studies (41, 42). In this study, we investigated the presence of H. pylori in the dental plaque samples of 100 participants enrolled, including 50 patients with chronic periodontitis and 50 individuals without periodontal disease. The supragingival and subgingival plaque samples were collected from these people using wood wedges and paper points, respectively. The results of the present study showed that H. pylori DNA was present totally in 5 (5%) dental plaque samples of all enrolled participants. We detected H. pylori DNA in 4 (8%) dental plaque samples of the patients with chronic periodontitis, and in only one dental plaque sample from the individuals in the non-periodontitis group. Our results are in agreement with the findings of previous studies from Iran which reported a very low prevalence of H. pylori in dental plaques among Iranian population (41, 42). Similar results have also been obtained from the previous studies conducted in South Africa, Brazil, Germany and Argentina where a low detection rate (1.7%, 2%, 5.4% and 10.2%, respectively) of H. pylori DNA was reported in dental plaques of the studied population (6, 43-45). On the other hand, our results are in contrast with the results of the other studies performed in some Asian countries such as Japan, India, Taiwan, Pakistan and China where a higher rate (38.3%, 42%, 43%, 51.6%, and 82.3%, respectively) of H. pylori infection was detected in dental plaques of the participants in the regions mentioned (46-50). Although the prevalence of H. pylori in dental plaque samples of patients with chronic periodontitis was higher than non-periodontitis group (4/50 versus 1/50, respectively), we did not find any significant correlation between the presence of H. pylori in dental plaque and periodontal disease.

H. pylori cagA-positive strains deliver the CagA oncoprotein into gastric epithelial cells in phosphorylated and non-phosphorylated forms, which promotes potent proinflammatory and proliferative responses associated with development of chronic gastritis and gastric cancer (51-53). The prevalence of cagA gene among H. pylori strains in Iranian population has been reported to vary from 62 to 94% in different studies (31, 33, 42, 54). In this study, 80% (4/5) of the dental plaque samples that were H. pylori-positive showed cagA genotype, which was in agreement with a recent study performed in Northern Brazil where 82% (58/71) of dental plaque specimen also exhibited cagA genotype (55). In addition, 75% (3/4) of cagA-positive dental plaque samples were observed in the periodontitis group, which was higher than non-periodontitis group with only one (1/4) cagA-positive sample. Our results were also consistent with a previous report from Iran by Momtaz et al. (56), who reported the cagA genotype in saliva samples with nearly the same prevalence (83%) as ours in plaque samples. However, our data was in contrast with another report from Brazil where the cagA gene was detected in 36.6% (11/30) of dental plaque samples (38).

It is presumed that gastric epithelial cell injury is caused by VacA cytotoxin, which induces multiple cellular effects such as host cell vacuolation, immune modulation and cell death. Additionally, the vacA alleles vary between H. pylori strains and these genotypic variations are associated with different risks for developing various clinical disorders of the upper gastrointestinal tract (21, 57). It has been reported that the vacA s1 and m1 genotypes are associated with higher degrees of lymphocytic and neutrophilic infiltrates, inflammation and severe H. pylori-related diseases, especially in Western countries, compared to that with vacA s2 and m2 strains that are rarely associated with peptic ulcer disease and gastric cancer (18, 58-61). The frequency of the vacA s1 and m1 genotypes in the Middle Eastern strains has been reported to be 71.5% and 32.8%, respectively, which is in concordance with our study (57). The vacA s1m1 genotype was predominantly detected in the H. pylori-positive dental plaque samples of patients with periodontitis (40%), which is in agreement with the results obtained in Northern Brazil (37%) (55). Meanwhile, vacA s1m2 and s2m1 genotypes were equally present in dental plaques of patients with periodontitis. However, the vacA s2m2 genotype that is believed to have low or non-cytotoxic activity was only found in the non-periodontitis group of the studied samples. Additionally, more than half of the H. pylori-positive plaque samples (60%) in this study that showed the babA2 gene were simultaneously positive for the presence of cagA and vacAs1 genotypes in patients with chronic periodontitis. This finding agrees with a previous report from Germany by Gerhard et al. (22), where they observed a significant association among H. pylori strains with triple positive genotypes, vacAs1, cagA and babA2. However, we did not find any significant association between the presence of this triple-positive genotype and chronic periodontal disease.

In conclusion, our findings revealed that the rate of H. pylori is very low in the dental plaques of Iranian patients with chronic periodontitis. Our results also showed that most of the H. pylori strains from oral cavity were highly virulent on the basis of the main clinically virulence factors they carried. In addition, the presence of the over-mentioned virulent genotypes of H. pylori strains in the dental plaque suggests that the oral cavity may serve as an important reservoir for reinfection, potentially affecting the eradication therapy of the H. pylori-associated gastroduodenal diseases. To our knowledge, this is the first study pursuing the detection of H. pylori DNA and its cagA, vacA and babA2 virulence genotypes in dental plaques by using molecular methods in an Iranian population. However, future epidemiological research efforts with larger samples can help us to elucidate which variables influence the presence of H. pylori in the oral cavity and what are the clinical implications of virulence-associated genotypes in our understanding of the pathogenesis of H. pylori infection and related gastric disorders and especially chronic periodontal disease,

Conflict of interests

The authors do not have any conflict of interest to be declared in the present study.