Heavy Metal Resistance Genes Are Associated with blaNDM-1- and blaCTX-M-15-Carrying Enterobacteriaceae.

The occurrence of heavy metal resistance genes in multiresistant Enterobacteriaceae possessing blaNDM-1 or blaCTX-M-15 genes was examined by PCR and pulsed-field gel electrophoresis with S1 nuclease. Compared with clinical susceptible isolates (10.0% to 30.0%), the pcoA, merA, silC, and arsA genes occurred with higher frequencies in blaNDM-1-positive (48.8% to 71.8%) and blaCTX-M-15-positive (19.4% to 52.8%) isolates, and they were mostly located on plasmids. Given the high association of metal resistance genes with multidrug-resistant Enterobacteriaceae, increased vigilance needs to be taken with the use of heavy metals in hospitals and the environment.

TEXT

The increasing spread of multidrug-resistant superbugs in clinical environments has prompted worldwide concern, because antibiotic resistance genes, such as blaNDM-1 and blaCTX-M-15, limit treatment options to combat bacterial infections (1–4). Note that in addition to emerging antibiotic resistance, heavy metals represent another major source of environmental contamination that may select for antibiotic resistance (5). Heavy metal compounds for growth promotion and therapeutic treatment, like zinc and copper, have been used in pig and poultry production; and unlike antibiotic food additives, metals can accumulate in soil, water, aquacultural and marine antifouling treatments, and industrial effluent (6). It has been proposed that antibiotic-resistant bacteria are enriched at locations contaminated with metals, and genes conferring coselection to heavy metals and antibiotics are often found together in many clinical isolates (7–11). Furthermore, genes conferring heavy metal tolerance may coexist on the same genetic element (e.g., plasmid), which may further promote codissemination and resistance (10, 12). Here, we characterize the phenotype and genotype of heavy metal resistance in a collection of clinical Gram-negative isolates, including Klebsiella pneumoniae, Escherichia coli, Enterobacter cloacae, Klebsiella oxytoca, and Providencia stuanti, isolated from the United Kingdom and India.

A total of 95 nonduplicate isolates were tested in this study (Table 1): 39 blaNDM-1-positive isolates originated from human lower respiratory and urinary tract samples from the United Kingdom and Chennai and Haryana, India, as previously described (13); 36 blaCTX-M-15-carrying isolates originated from patients with burns, bacteremia, and urinary tract infections (UTIs) from various Indian hospitals (Haryana, Mumbai, Kolkata, Kerala, Delhi, and Vellore); and 20 control E. coli and K. pneumoniae isolates susceptible to all known antibiotic classes as control samples were provided by Specialist Antimicrobial Chemotherapy Unit (SACU), Public Health Wales. MICs of four heavy metal ions, i.e., CuSO4.5H2O for copper (Cu2+), HgCl2 for mercury (Hg2+), AgNO3 for silver (Ag+), and AsNaO2 for arsenic (As3+), were measured by agar dilution using Mueller-Hinton agar (Becton Dickinson, USA). E. coli (ATCC 25922) was used as a negative control. MIC levels of ≥10 mM for Cu2+, ≥2 mM for As3+, ≥32 μM for Hg2+, and ≥ for 128 μM Ag+ were regarded as resistance (8, 14, 15). High MIC values for Cu2+ (10 mM), As3+ (20 mM), and Hg2+ (128 μM) were obtained in most of the blaNDM-1-positive isolates, with high resistance rates of 79.5% (31/39), 76.9% (30/39), and 64.1% (25/39), respectively. Similarly, with blaCTX-M-15-positive strains, 91.7% (33/36), 63.9% (23/36), and 52.8% (19/36) of isolates were resistant to Cu2+, As3+, and Hg2+, respectively. High MIC values (128 to 256 μM) for Ag+ were observed for all isolates. Antibiotic-susceptible control strains also gave high rates of resistance to Cu2+ (90% [18/20]) but remained sensitive to Hg2+ (15.0% [3/20]) and As3+ (25.0% [5/20]).

TABLE 1

Phenotypic and genotypic resistances to heavy metals in 95 clinical strains in this study

Strain and identification no.	Bacterial organism	Phenotype (MIC)				Genotype
		Ag (μM)	Hg (μM)	Cu (mM)	As (mM)
blaNDM-1 (n = 39)
N1	K. pneumoniae	128	128	10	0.625	merA, silC
N2	K. pneumoniae	128	128	10	2.5	arsA, merA
N3	C. freundii	128	128	10	2.5	arsA, merA
N4	E. cloacae	128	16	10	20	pcoA, silC
N5	Enterobacter spp.	128	16	5	1.25	Negative
N6	E. coli	128	128	10	20	arsA, merA, pcoA, silC
N7	K. pneumoniae	128	128	10	10	arsA, merA, pcoA, silC
N8	K. pneumoniae	128	128	10	20	arsA, merA, pcoA, silC
N9	K. pneumoniae	128	16	10	0.625	pcoA, silC
N10	K. pneumoniae	128	16	10	0.625	silC
N11	K. pneumoniae	128	16	10	0.625	silC
N12	K. pneumoniae	256	128	10	10	arsA, merA, pcoA, silC
N13	C. freundii	256	128	10	10	arsA, merA, pcoA, silC
N14	E. coli	128	128	10	10	arsA, merA, pcoA, silC
N15	E. coli	128	16	5	1.25	pcoA, silC
N16	K. pneumoniae	128	128	10	1.25	arsA, merA, pcoA,silC
N17	K. pneumoniae	128	128	10	20	arsA, merA, pcoA, silC
N18	K. pneumoniae	128	64	10	10	arsA, merA, pcoA, silC
N19	K. pneumoniae	128	128	10	20	arsA, merA, pcoA, silC
N20	E. coli	128	16	5	2.5	Negative
N21	K. pneumoniae	128	128	10	2.5	merA, pcoA, silC
N22	K. pneumoniae	128	128	10	2.5	merA, pcoA, silC
N23	E. coli	128	128	5	0.625	Negative
N26	Enterobacter spp.	128	128	10	10	arsA, merA, pcoA
N27	K. pneumoniae	128	128	5	10	arsA, merA, pcoA, silC
N28	K. oxytoca	128	16	10	5	arsA, merA, pcoA, silC
N29	E. coli	128	16	10	10	arsA, silC
N31	E. cloacae	128	16	10	20	pcoA, arsA, silC
N32	E. cloacae	128	16	10	0.625	pcoA, silC, merA, arsA
K15	K. pneumoniae	128	16	10	5	merA, pcoA, silC
K7	K. pneumoniae	128	128	10	2.5	merA, pcoA, silC
IR25	K. pneumoniae	128	128	10	5	merA
IR18k	K. pneumoniae	128	128	10	20	merA
IR28k	K. pneumoniae	128	128	10	20	merA, pcoA, silC
IR29	E. coli	128	128	5	5	merA, pcoA, silC
IR26	E. coli	128	128	5	5	Negative
IR22	E. coli	128	16	5	5	Negative
IR61	K. oxytoca	128	16	10	20	Negative
IR5	E. coli	128	128	10	20	arsA, merA, pcoA, silC
blaCTX-M-15 (n = 36)
A5/3	K. pneumoniae	128	16	10	5	arsA, pcoA, silC
A5/7	K. pneumoniae	128	128	10	20	arsA, merA, pcoA, silC
A5/4	K. pneumoniae	128	128	5	5	pcoA, silC
C5/8	K. pneumoniae	128	64	10	0.625	arsA, merA
C5/7	K. pneumoniae	128	128	10	10	arsA, merA, pcoA, silC
C5/5	K. pneumoniae	128	16	10	5	Negative
D5/12	K. pneumoniae	128	128	10	0.15	merA
D5/4	K. pneumoniae	128	16	10	0.625	pcoA, arsA
E5/14	K. pneumoniae	128	16	10	5	merA, pcoA, silC
E5/17	K. pneumoniae	128	128	10	2.5	arsA, merA, pcoA, silC
G5/2	K. pneumoniae	128	16	10	5	arsA, pcoA, silC
G5/6	K. pneumoniae	128	128	10	0.3	merA
G5/11	K. pneumoniae	128	128	10	0.3	merA, pcoA, silC
I5/5	K. pneumoniae	128	128	10	20	merA, pcoA, silC
F5/6	K. pneumoniae	128	16	10	0.3	Negative
E5/19	K. pneumoniae	128	128	10	5	merA, pcoA, silC
A4/8	E. coli	128	16	10	0.3	Negative
F4/3	E. coli	128	16	10	5	Negative
B4/6	E. coli	128	16	10	2.5	Negative
A4/11	E. coli	128	16	10	5	Negative
C4/3	E. coli	128	128	10	2.5	merA
E4/4	E. coli	128	128	10	2.5	Negative
D4/12	E. coli	128	16	10	2.5	merA
C4/12	E. coli	128	64	10	2.5	merA
G4/12	E. coli	128	16	10	2.5	Negative
I4/9	E. coli	128	128	10	2.5	merA
I4/3	E. coli	128	16	10	0.3	Negative
I4/13	E. coli	128	16	5	2.5	merA, pcoA, silC
H4/5	E. coli	128	16	10	0.3	Negative
H6/20	Salmonella spp.	128	128	10	0.15	Negative
G6/9	Salmonella spp.	128	16	10	0.625	merA, pcoA, silC
G6/13	Salmonella spp.	128	64	10	0.15	merA, silC
I2/5	Enterobacter spp.	128	128	10	20	pcoA, silC
I2/2	Enterobacter spp.	128	128	10	20	pcoA, silC
F2/6	Enterobacter spp.	128	128	0.625	0.15	merA
B1/10	P. stuanti	128	128	10	20	merA
Susceptible (n = 20)
Kpff160	K. pneumoniae	128	128	10	10	arsA, merA, pcoA, silC
Kpff217	K. pneumoniae	128	16	10	0.3	pcoA, silC
KpFF11	K. pneumoniae	128	128	10	5	arsA, merA, pcoA, silC
KpFF197	K. pneumoniae	128	16	10	0.625	silC
KpFF177	K. pneumoniae	128	16	10	0.3	pcoA
KpFF296	K. pneumoniae	128	16	10	10	arsA, pcoA, silC
KpFF101	K. pneumoniae	256	16	10	10	Negative
KpFF264	K. pneumoniae	128	16	10	0.15	Negative
KpFF267	K. pneumoniae	128	16	10	0.15	Negative
KpFF153	K. pneumoniae	128	16	10	0.3	pcoA
Ec66	E. coli	128	8	10	0.15	Negative
Ec9	E. coli	128	16	10	0.15	Negative
Ec63	E. coli	128	8	10	0.15	Negative
Ec59	E. coli	128	8	5	0.15	Negative
Ec60	E. coli	128	16	5	0.15	Negative
Ec166	E. coli	128	8	10	0.15	Negative
Ec284	E. coli	128	8	10	0.625	Negative
Ec61	E. coli	128	128	10	5	Negative
Ec141	E. coli	128	16	10	0.15	Negative
Ec98	E. coli	128	16	10	0.15	Negative
Transconjugants and controls
25922	E. coli	64	16	5	0.15	Negative
GFP	E. coli	64	16	5	1.25	Negative
TCE5/19	E. coli	64	16	5	2.5	pcoA
TCN12	E. coli	128	64	5	10	arsA, pcoA, merA
TCN22	E. coli	128	8	5	2.5	pcoA

The presence of four heavy metal resistance genes was confirmed by PCR: merA for Hg2+, arsA for As3+, pcoA for Cu2+, and silC for Ag+. Primers were designed by primer 3 (Geneious Pro 5.5.6) and the NCBI primer designing tool (https://www.ncbi.nlm.nih.gov/tools/primer-blast/) (Table 2). PCRs were performed under the following conditions: initial denaturation at 95°C for 5 min, followed by 30 cycles of denaturation at 95°C for 45 s, annealing at 58°C to 60°C for 45 s and extension at 72°C for 45 s, and final extension at 72°C for 5 min. The purified PCR products were randomly selected for following sequencing analyses (Eurofins Genomics, Germany). The silC, merA, pcoA, and arsA genes were dispersed throughout our blaNDM-1-positive isolates, with 28/39 (71.8%), 26/39 (66.7%), 25/39 (64.1%), and 19/39 (48.7%), respectively (Fig. 1). Similarly, in blaCTX-M-15-producing isolates, the most prevalent heavy metal resistance gene was merA (19/36 [52.8%]). The genes arsA, pcoA, and silC were only detected in 7 (19.4%), 15 (41.7%), and 15 (41.7%) isolates, respectively. In contrast, the relatively low prevalences of pcoA, silC, arsA, and merA genes were identified in susceptible isolates, with detection rates of 30.0% (6/20), 25.0% (5/20), 20% (4/20), and 10% (2/20), respectively (Fig. 1). In addition, statistical comparisons with these metal resistance genes in three groups of isolates were conducted using chi-square and Fisher's exact tests, where a P value of ≤0.05 was considered significant. The prevalences of silC (71.8% versus 25.0%; P = 0.0009), merA (66.7% versus 10.0%; P < 0.0001), pcoA (64.1% versus 30.0%; P = 0.0158), and arsA (48.7% versus 20.0%; P = 0.0482) genes detected in blaNDM-1-positive isolates were all markedly higher than those in susceptible isolates. Furthermore, the detection rates of silC (71.8% versus 41.7%; P = 0.0108) and arsA (48.7% versus 19.4%; P = 0.0144) in blaNDM-1-positive isolates were significantly higher than those in blaCTX-M-15- producing isolates (Fig. 1).

TABLE 2

Details of primers used for heavy metal resistance gene detection in this study

Metal ion	Primer	Sequence (5′→3′)	Temperature (°C)	Size (bp)	GenBank accession no. or GeneID
Hg2+	merA_F1	CTGCGCCGGGAAAGTCCGTT	58	1,035	DQ126685
	merA_R1	GCCGATGAGCCGTCCGCTAC
	merA_F2	GAGCTTCAACCCTTCGACCA	60	849	575669924
	merA_R2	AGCGAGACGATTCCTAAGCG
As3+	arsA_F1	CAGTACCGACCCGGCCTCCA	58	861	CP000648
	arsA_R1	AGGCCGTGTTCACTGCGAGC
	arsA_F2	GGCTGGAAAAACAGCGTGAG	58	1,002	387605479
	arsA_R2	CCTGCAAATTAGCCGCTTCC
Cu2+	pcoA_F	CGGCCAGGTTCACGTCCGTC	58	1,371	NC_009649
	pcoA_R	TGCCAGTTGCCGCATCCCTG
Ag+	silC_F1	CGTAGCGCAAGCGTGTCGGA	58	1,090	NC_009649
	silC_R1	ATATCAGCGGCCCGCAGCAC
	silC_F2	TTCAACGTCACGGATGCAGA	60	872	157412014
	silC_R2	AGCGTGTCGGAAACATCCTT

FIG 1

Occurrence of heavy metal resistance genes in 95 clinical isolates. P values were calculated using chi-square and Fisher's exact tests. *, 0.01 < P ≤ 0.05; **, 0.001 < P ≤ 0.01; ***, P ≤ 0.001. ns, not significant.

Previous studies have proposed the role of plasmids in conferring resistance to both antibiotics and heavy metals (7, 16, 17). In this study, the locations of the pcoA, merA, silC, and arsA genes were analyzed by pulsed-field gel electrophoresis with S1 nuclease (S1-PFGE) (Invitrogen Abingdon, UK). In brief, isolates carrying heavy metal resistance genes were randomly selected, and genomic DNA in agarose blocks was digested with S1 nuclease and probed. In-gel hybridization was performed with pcoA, merA, silC, and arsA gene probes labeled with 32P with a random primer method (Stratagene, Amsterdam, Netherlands). The results showed that pcoA, merA, silC, and arsA genes are located on a diverse range of plasmid backbones, differing from 50 to 500 kb in size (Fig. 2; see also Fig. S1 in the supplemental material). Heavy metal resistance genes were carried on more than one plasmid in many strains, and chromosomally located genes were identified (Fig. 2 and Fig. S1), suggesting significant plasticity.

FIG 2

PFGE analysis of blaNDM-1-positive strains digested with S1 nuclease and hybridization with the pcoA gene probe (a) and silC gene probe (b). (a) Isolate order of lanes 1 to 14: N1, N2, N3, N4, N5, N6, N7, N8, N9, N10, N11, N12, N13, and N14. (b) Isolate order of lanes 1 to 14: N16, N17, N18, N19, N20, N21, N22, N23, 3, 26, N27, N28, N29, N31.

Conjugation experiments were performed, as described previously (13), to investigate cotransfer of heavy metal and antibiotic resistance genes. Conjugations were performed with blaNDM-1- and blaCTX-M-15-positive donors with the rifampin-resistant recipient E. coli UAB190. Selection of blaCTX-M-15-positive transconjugants was performed on Brilliance UTI clarity agar (Oxoid, Ltd., Basingstoke, UK) supplemented with rifampin 100 mg/liter (Sigma-Aldrich, St. Louis, MO, USA) and cefotaxime 2 mg/liter. blaNDM-1-positive transconjugants were selected using rifampin with meropenem 0.5 mg/liter (AstraZeneca, London, UK). PCR for blaNDM-1 and blaCTX-M-15 genes was used for further confirmation of gene transfer (13, 18). Plasmid incompatibility groups were characterized by PCR-based replicon typing as previously described (19). A total of 18 and 14 transconjugants were obtained in E. coli UAB190 from 39 blaNDM-1 and 36 blaCTX-M-15 isolates, respectively. In 11 of 18 transconjugants, blaNDM-1 was located on IncA/C-type plasmids; 78.6% (11/14) of plasmids carrying blaCTX-M-15 belonged to IncFII, reflective of global molecular epidemiology (2, 20). Plasmids carrying blaNDM-1 from 6 transconjugants could not be typed. The heavy metal resistance genes arsA, merA, and pcoA were found on 2 blaNDM-1- and 1 blaCTX-M-15-positive plasmids, respectively (Table 1).

Our data indicate the abundance and mobility of heavy metal resistance genes (pcoA, merA, silC, and arsA) that can contribute to antibiotic-resistant gene dissemination and maintenance. Furthermore, many of these genes are found on transmissible plasmids. Therefore, our findings suggest that the coselection of heavy metal resistance genes in blaNDM-1- and blaCTX-M-15-positive isolates has significant implications for hospital and environmental (industrial waste) contamination with heavy metals.