Literature DB >> 29489751

Recognition of DHN-melanin by a C-type lectin receptor is required for immunity to Aspergillus.

Mark H T Stappers1, Alexandra E Clark1, Vishukumar Aimanianda2, Stefan Bidula1, Delyth M Reid1, Patawee Asamaphan1, Sarah E Hardison1, Ivy M Dambuza1, Isabel Valsecchi2, Bernhard Kerscher1, Anthony Plato1, Carol A Wallace1, Raif Yuecel3, Betty Hebecker1, Maria da Glória Teixeira Sousa1, Cristina Cunha4,5, Yan Liu6, Ten Feizi6, Axel A Brakhage7, Kyung J Kwon-Chung8, Neil A R Gow1, Matteo Zanda9, Monica Piras9, Chiara Zanato9, Martin Jaeger10, Mihai G Netea10, Frank L van de Veerdonk10, João F Lacerda11,12, António Campos13, Agostinho Carvalho4,5, Janet A Willment1, Jean-Paul Latgé2, Gordon D Brown1.   

Abstract

Resistance to infection is critically dependent on the ability of pattern recognition receptors to recognize microbial invasion and induce protective immune responses. One such family of receptors are the C-type lectins, which are central to antifungal immunity. These receptors activate key effector mechanisms upon recognition of conserved fungal cell-wall carbohydrates. However, several other immunologically active fungal ligands have been described; these include melanin, for which the mechanism of recognition is hitherto undefined. Here we identify a C-type lectin receptor, melanin-sensing C-type lectin receptor (MelLec), that has an essential role in antifungal immunity through recognition of the naphthalene-diol unit of 1,8-dihydroxynaphthalene (DHN)-melanin. MelLec recognizes melanin in conidial spores of Aspergillus fumigatus as well as in other DHN-melanized fungi. MelLec is ubiquitously expressed by CD31+ endothelial cells in mice, and is also expressed by a sub-population of these cells that co-express epithelial cell adhesion molecule and are detected only in the lung and the liver. In mouse models, MelLec was required for protection against disseminated infection with A. fumigatus. In humans, MelLec is also expressed by myeloid cells, and we identified a single nucleotide polymorphism of this receptor that negatively affected myeloid inflammatory responses and significantly increased the susceptibility of stem-cell transplant recipients to disseminated Aspergillus infections. MelLec therefore recognizes an immunologically active component commonly found on fungi and has an essential role in protective antifungal immunity in both mice and humans.

Entities:  

Mesh:

Substances:

Year:  2018        PMID: 29489751      PMCID: PMC5857201          DOI: 10.1038/nature25974

Source DB:  PubMed          Journal:  Nature        ISSN: 0028-0836            Impact factor:   49.962


C-type lectin receptors (CLRs) involved in antifungal immunity belong primarily to the Dectin-1 and Dectin-2 clusters of receptors located near the Natural Killer Gene complex (NKC)1. To identify new CLRs within these clusters that recognise fungi, we generated soluble protein chimeras consisting of the C-type lectin-like domain (CTLD) of murine receptors fused to the Fc region of human IgG14 (Fc-MelLec, Extended data Fig. 1a) and used these chimeric proteins as probes to screen for recognition of fungi by flow cytometry. Using this approach, we identified the CTLD of MelLec (CLEC1A5, Extended data Fig. 1b), which bound Aspergillus fumigatus conidia (Fig. 1a). MelLec did not recognise other commonly occurring fungi, such as Candida albicans yeast and filamentous cells or Saccharomyces cerevisiae yeasts, but did recognise other melanised fungal species, including Fonsecaea pedrosoi and Cladosporium cladosporioides (Fig. 1b, Extended data Fig. 1c,e). This indicated that the ligand recognised by MelLec was not ubiquitously found in all fungi, unlike the ligands of other anti-fungal CLRs, such as Dectin-11. Notably, the ability of MelLec to recognise A. fumigatus was restricted to conidia, and recognition was rapidly lost following conidial swelling, germination and hyphal growth (Fig. 1a,c and Extended data Fig. 2d). Visualising binding to conidia by immunofluorescence microscopy, revealed a punctate staining pattern suggestive of restricted distribution of the moiety recognised by MelLec on these spores (Fig. 1c). Conidia are covered by a hydrophobic rodlet layer which masks underlying cell wall components from immune recognition6. Removal of this rodlet layer with NaOH6 led to increased and uniform binding of MelLec over the entire conidial surface (Fig. 1d). Indeed, uniform staining was obtained with rodlet-deficient conidia (ΔrodA), confirming that the ligand of MelLec was being partially masked by the surface hydrophobin layer (Fig. 1e). Recognition of A. fumigatus conidia by MelLec could also be demonstrated in a cellular context using MelLec reporter cells4 (Extended data Fig. 1f).
Extended data Figure 1

MelLec recognises ligands on selected fungi and fungal morphotypes.

Cartoon representation of the structure of Fc-MelLec (a) and the full length receptor (b). Lollipop structures represent predicted glycosylation sites. c, Fc-MelLec or Fc-CLEC12b (Fc-control) staining of C. albicans hyphae, generated in RPMI with 10% foetal bovine serum for 90 min. Fungal particles were analysed by flow cytometry. Experiment was repeated independently twice, with similar results. d, Representative light microscope images and immunofluorescence micrographs using Fc-MelLec or anti-galactomannan (GM, control) as probes to detect ligands on A. fumigatus mycelium. e, Representative light microscope and immunofluorescence micrographs showing the surface distribution of MelLec ligands on Cladosporium cladosporioides using Fc-MelLec as a probe. Lower panels show fungal cells following treatment with 1M NaOH. d-e Experiments were repeated 3 times independently, with similar results. f, IL-2 production by MelLec-expressing BWZ reporter cells following stimulation by αMelLec antibody crosslinking or with ΔrodA (1:1, 5:1, 10:1) or ΔrodAΔpksP (5:1, 10:1) A. fumigatus conidia, as indicated. Values shown are mean ± SD. Experiment was repeated 3 times independently, with similar results.

Figure 1

MelLec recognises selected fungi.

Representative histograms showing (a) A. fumigatus conidia and germlings (cultured for 8 h at 37°C), or (b) yeasts of C. albicans and S. cerevisiae, and conidia of F. pedrosoi, stained with Fc-MelLec or Fc-CLEC12b29 (Fc-control) and analysed by flow cytometry. Representative light microscope images and immunofluorescence micrographs using Fc-MelLec to detect ligands on A. fumigatus following conidial swelling and germination over time, as indicated (c), following treatment with 1M NaOH (d), and on rodlet-deficient (ΔrodA) conidia (e). a-e, Experiments were repeated at least 3 times independently, with similar results.

Extended data Figure 2

Glycan microarray analyses of murine Fc-MelLec and human Langerin.

These 496 lipid-linked probes are arranged according to their backbone sequences as annotated in the coloured panels below the figure. Lac, lactose; LacNAc, N-acetyllactosamine; LNnT, lacto-N-neotetraose; LNT, lacto-N-tetraose; PolyLac, polylactosamine; GAGs, glycosaminoglycans; Misc., miscellaneous. The signals are means of fluorescence intensities of duplicate spots, printed at 5 fmol per spot level with error bars representing half of the difference between the two values. The signals shown together with the probe sequences are in Supplementary Table 1. ns, not significant.

All characterised CLRs involved in fungal sensing recognise carbohydrate components of the fungal cell wall1. Consistent with this possibility, MelLec ligand(s) were detected by ELISA primarily in the alkali insoluble fraction of the A. fumigatus conidial cell wall whose primary constituents are carbohydrates (β-glucan, chitin and galactomannan) and melanin7 (Fig. 2a). Using the Fc-MelLec fusion protein as a probe to screen a neoglycolipid-based glycan microarray containing almost 500 structures, including oligosaccharides derived from glucans and chitin that are found in fungi8 (Supplementary Table 1), did not reveal any carbohydrate ligands for MelLec, unlike the C-type lectin Langerin, which was used as a control (Extended data Fig. 2). We then used Fc-MelLec to screen A. fumigatus conidia that were mutated in a variety of relevant cell-wall biosynthetic pathways by flow cytometry and immunofluorescence microscopy. Using this approach, we found that the ability of Fc-MelLec to detect conidia was lost specifically in the ΔpksP mutant, which is deficient in the ability to synthesise heptaketide naphthopyrone (YWA1), the first intermediate of the DHN-melanin biosynthetic pathway2,9 (Fig. 2b and Extended data Fig. 3a). We could also confirm loss of the MelLec ligand on ΔrodAΔpksP double mutant conidia10, lacking both melanin and the hydrophobin layer, using flow cytometry, immunofluorescence microscopy and our MelLec reporter cells (Extended data Fig. 1f and 3b,c). Loss of pksP did not affect conidial recognition by Fc-Dectin-1 (Extended data Fig. 3c,d). Moreover, we could demonstrate a direct interaction of MelLec with A. fumigatus melanin ghosts (Extended data Fig. 3e). MelLec specifically recognised DHN-melanin, since this receptor did not detect melanin synthesised via other pathways, such as the L-Dopa pathway that is present in Cryptococcus neoformans, and in mammalian B16 melanoma cells11 (Extended data Fig. 3f). In addition to A. fumigatus, we could show that MelLec recognised other pigmented fungi that produced DHN-melanin, including F. pedrosoi and C. cladosporioides12 (Fig. 1b and Extended data Fig. 1e).
Figure 2

MelLec recognises DHN-melanin.

a, Detection of MelLec ligands in alkali insoluble or soluble A. fumigatus cell wall fractions by ELISA. Values show mean ± SD. b, Representative histograms showing ΔrodA or ΔpksP A. fumigatus conidia, stained with Fc-MelLec or Fc-CLEC12b (Fc-control) and analysed by flow cytometry. c, The biosynthetic pathway of DHN-melanin (left) and representative immunofluorescence micrographs using Fc-MelLec to detect ligands on A. fumigatus strains deficient in these enzymes (right). The conidial rodlet layer was removed with 1M NaOH prior to staining. d, Detection of YWA1 by Fc-MelLec and Fc-control by ELISA. Values show mean ± SD. a-d, Experiments were repeated at least 3 times independently, with similar results.

Extended data Figure 3

MelLec recognises DHN-melanin.

a, Representative immunofluorescence micrographs using Fc-MelLec as a probe showing the surface distribution of MelLec-ligands on A. fumigatus wild-type and a variety of melanin deficient mutants, as indicated. Lower panels show conidia treated with 1M NaOH. b, Representative immunofluorescence and light micrograph images of ΔrodAΔpksP A. fumigatus conidia stained with Fc-MelLec or ConA-FITC, as indicated. c, Representative histograms showing the presence or absence of MelLec or Dectin-1 ligands on ΔrodA or ΔrodAΔpksP A. fumigatus conidia, as indicated. Fungal particles were stained with Fc-MelLec (red) or Fc-Dectin-1 (green) and analysed by flow cytometry. Grey histograms indicate secondary only control. d, Representative histogram showing the presence Dectin-1 ligands on ΔpksP A. fumigatus conidia. Fungal particles were stained with Fc-Dectin-1 (green) or Fc-CLEC12b (Fc-control; blue) and analysed by flow cytometry. e, Representative histogram showing the presence MelLec ligands on melanin ghosts of A. fumigatus conidia. Fungal particles were stained with Fc-MelLec (red) or Fc-CLEC12b (Fc-control; blue) and analysed by flow cytometry. a-e, Experiments were repeated 3 times independently, with similar results. f, Flow cytometric analysis of melanised (red) and non-melanised (grey) Cryptococcus neoformans yeast and melanin ghosts, and B16 melanoma cells47, stained with Fc-MelLec, as indicated. Experiment was repeated independently twice, with similar results.

Although its tertiary structure is unresolved11, the biosynthetic pathway of DHN-melanin is well characterised in A. fumigatus3. To determine at which stage MelLec ligand(s) were being synthesised in the pathway, we screened mutants of A. fumigatus that were deficient in the enzymes catalysing each step, using Fc-MelLec and immunofluorescence microscopy, or ELISA. We confirmed that MelLec recognition was lost in ΔpksP conidia, however, MelLec recognition was unaffected in mutants deficient in all other stages of the DHN-melanin biosynthetic pathway (Fig. 2c and Extended data Fig. 4a). Using a pre-adsorption assay, we could show that recognition of wild-type conidia could be inhibited by pre-treating Fc-MelLec with Δayg1 ghosts (defective in the second biosynthetic step, where MelLec ligands are still present), but not ghosts of ΔpksP (the first biosynthetic step, which lack MelLec ligands; Extended data Fig. 4b). We purified heptaketide naphthopyrone (YWA1) from Δayg1 conidia13 and demonstrated that pre-treatment with this compound inhibited the ability of Fc-MelLec, but not Fc-Dectin-1, to detect ΔrodA or NaOH-treated wild-type conidia (Extended data Fig. 4c-d). Moreover, we could demonstrate a direct interaction of MelLec with purified YWA1 (Fig. 2d) by ELISA. This suggested that the ability of MelLec to recognise this compound, as well as all the other melanin biosynthetic intermediates (Fig. 2c), was through recognition of the conserved naphthalene-diol unit, present in each of the intermediates. Indeed, we were able to show direct interaction of MelLec with 1,8-dihydronaphthalene (1,8-DHN), another upstream intermediate of the melanin biosynthetic pathway, by ELISA (Extended data Fig. 4e). Moreover, the structural isomers 1,2-DHN and 1,4-DHN, which contain the naphthalene-diol unit but are not melanin intermediates, were also recognised by MelLec (Extended data Fig. 4f). This suggests that the position of at least one of the hydroxyls (on carbon 2, 4 or 8) on the naphthalene-diol unit is not important for MelLec recognition. In contrast, naphthalene and 1-naphthol were not recognised by MelLec (Extended data Fig. 4g), indicating that the ligand of MelLec is a naphthalene-diol.
Extended data Figure 4

MelLec recognises naphthalene-diol.

a, Detection of MelLec ligands in ghosts of melanin mutants of A. fumigatus by ELISA, as indicated. Values show mean ± SD. b, Representative immunofluorescence and light micrograph images of Fc-MelLec ligands on NaOH-treated A. fumigatus B5233 conidia following pre-treatment with ghosts of ΔpksP or Δayg1 conidia, as indicated. c, Representative immunofluorescence and light micrograph images of MelLec ligands on NaOH-treated wild-type A. fumigatus conidia following pre-treatment with or without heptaketide naphthopyrone (YWA1). a-c, Experiments were repeated at least 3 times independently, with similar results. d, Detection of Fc-MelLec or Fc-Dectin-1 ligands on ΔrodA conidia following pre-treatment with (blue) or without (red) heptaketide naphthopyrone (YWA1). Experiment was repeated independently twice, with similar results. Detection of 1,8-DHN (e) and 1,2-DHN and 1,4-DHN (f) by Fc-MelLec and Fc-control using ELISA, as indicated. Values show mean ± SD. g, Detection of 1,8-DHN, naphthalene and 1-naphthol by Fc-MelLec using ELISA, as indicated. Values show mean ± SD. e-g, Experiments were repeated at least 3 times independently, with similar results.

CLRs involved in fungal recognition are predominantly expressed by myeloid cells and are detectable in most tissues1. By RT-PCR, MelLec was widely expressed in mice, with the highest levels of transcript detected in the lung (Extended data Fig. 5a). To explore expression at a cellular level, we generated monoclonal antibodies (mAbs) by immunising rats with murine Fc-MelLec and then screening ELISA positive hybridoma supernatants by flow cytometry on NIH3T3 cells transfected to express full length HA-tagged murine MelLec. In these transfected cells, we found MelLec to be expressed as a glycosylated monomer at the cell surface, demonstrating that this CLR did not require an adaptor for surface expression1,14 (Extended data Fig. 5b,c). Although able to sense melanin (Fig. 2 and Extended data Fig. 1f), expression of MelLec did not confer the ability to capture A. fumigatus conidia to the cell surface of the transfected NIH3T3 cells (Extended data Fig. 5d).
Extended data Figure 5

MelLec is expressed at the cell surface.

a, RT-PCR detection of MelLec expression in various tissues, as indicated. The expression of glycerol-3-phosphate dehydrogenase (G3PDH) in these samples, also used for the characterization of MCL36, is shown as a control. Experiment was performed once (for gel source data, see Supplementary Figure 1). b, Flow cytometric analysis of surface expression of HA-tagged murine and human MelLec on the surface of NIH3T3 fibroblasts (black open histograms). NIH3T3 cells transfected with vector only served as controls (grey filled histograms). c, Western blot analysis of lysates of HA-tagged mMelLec expressing NIH3T3 cells under reducing and non-reducing conditions and with and without N-glycosidase. HA-tagged mCLEC12A31 expressing NIH3T3 cells served as controls (for blot source data, see Supplementary Figure 1). d, Relative binding of FITC-labelled ΔrodA A. fumigatus conidia to NIH3T3 cells transduced with vector only, Dectin-1 or MelLec, as determined by flow cytometry. Values shown are mean ± SD, analysed by one-way ANOVA. e, Screening of hybridoma supernatants on mMelLec-expressing (red) and parental (black) NIH3T3 cells. b-e, Experiments were repeated at least 3 times independently, with similar results. *, p≤0.05; Ns, not significant.

Two mAbs (18E4 and 14C8) specific for MelLec were chosen for further characterisation of receptor expression on murine cells and tissues (Extended data Fig. 5e). Surprisingly, MelLec was not expressed by any murine myeloid cell population examined (either ex-vivo or in vitro bone marrow-derived), even following microbial stimulation, nor was this receptor expressed by cells in peripheral blood, bone marrow, lymphoid tissues or on platelets15 (Extended data Fig. 6a-c). Given the abundance of transcript, we next examined disaggregated lung tissue by flow cytometry which revealed a distinct population of cells that expressed MelLec (Fig. 3a). Histological visualisation of MelLec expression by immunofluorescence microscopy revealed broad punctate expression of this receptor throughout the lung tissue (Fig. 3b and Extended data Fig. 7m). A similar punctate staining pattern was also observed in the MelLec-expressing transfected NIH3T3 fibroblasts (Extended data Fig. 7a). By flow cytometry, we could show that MelLec expression was restricted to non-hematopoietic (CD45-) cells (Fig. 3c and Extended data Fig. 7b). Further characterisation of these cells revealed that MelLec was expressed by CD31+ EpCAM- endothelial cells (Fig. 3d). Expression of MelLec was also detected on CD31+ endothelial cells in all other tissues tested, including the liver, heart, kidney and small intestine (Extended data Fig. 7c-f). However, we also detected a unique population of CD31+ cells which co-expressed EpCAM+, but only in the lung and liver, and these cells also expressed MelLec (Fig. 3d and Extended data Fig. 7c). MelLec was not expressed on EpCAM+ cells in other tissues, including the epidermis (Extended data Fig. 7g-j).
Extended data Figure 6

Murine MelLec is not expressed by myeloid cells.

Flow cytometric analysis of MelLec expression on various ex vivo and in vitro derived myeloid cells (a) and peripheral blood, bone marrow, lymph nodes and spleen (b), as indicated. a-b, Experiments were repeated at least twice independently, with similar results. c, Flow cytometric analysis of MelLec expression on CD61+ platelets. Experiment was repeated at least 3 times independently, with similar results. BM, bone marrow; DC, dendritic cell; mø, macrophage; LPS, lipopolysaccharide.

Figure 3

MelLec is expressed on non-myeloid cells in mouse.

a, Analysis of disaggregated lung tissue by flow cytometry with αMelLec. b, Immunofluorescence microscopy of lung tissue stained with αMelLec (green). Nuclei are stained with DAPI (blue). Flow cytometric analysis of MelLec expression on live CD45+ and CD45- cells (c), and CD45- CD31+ EpCAM- and EpCAM+ cells (d) in the lung. a-d, Experiments were repeated at least 3 times independently, with similar results.

Extended data Figure 7

MelLec expression in tissues and generation of MelLec-/- mice.

a, Immunofluorescence microscopy of MelLec-expressing versus control NIH3T3 cells labelled with αMelLec (green). Nuclei are stained with DAPI (blue). Experiments were repeated at least 3 times independently, with similar results. b, Exemplar flow cytometric gating strategy for identification of live cells from tissue. c, Flow cytometric analysis of MelLec expression on live CD45- CD31+ EpCAM- and EpCAM+ populations in the liver, as indicated. Flow cytometric analysis of MelLec expression on live CD45- CD31+ cells in the heart (d), kidney (e) and small intestine (f). Flow cytometric analysis of MelLec expression on live CD45-EpCAM+ cells in the heart (g), kidney (h), small intestine (i) and epidermis (j). b-j Experiments were repeated at least twice independently, with similar results. Black lines, isotype controls. k, Schematic representation of the wild-type CLEC1A locus, gene targeting vector, PCR primer sites, and correctly targeted recombinant gene-targeted allele. l, PCR analysis of gene-targeted mice (for gel source data, see Supplementary Figure 1). +/+, wild-type, +/- heterozygous and -/- homozygous for the targeted allele. m, Immunofluorescence microscopy of naïve lung tissue from MelLec-/- mice (labelling of wild-type lung is shown in Fig. 3b). n, Analysis of MelLec expression in disaggregated lung tissue from wild-type (wt) or MelLec-/- mice by flow cytometry. l-n, Experiments were repeated at least 3 times independently, with similar results.

To gain insight into the physiological functions of MelLec, we generated mice deficient in this receptor using a conventional gene-targeting vector (Extended data Fig. 7k,l). Exons 1–5 of the gene encoding MelLec (CLEC1A) were deleted, which correspond to the cytoplasmic tail, transmembrane, stalk and part of the CRD region. Flow cytometry of disaggregated lung tissue, and immunofluorescence microscopy of whole lung, confirmed the lack of MelLec expression in cells from knockout mice (Fig. 3b and Extended data Fig. 7m,n). The MelLec-knockout mice were viable, had no gross abnormalities and had normal peripheral leucocyte counts (Supplementary Table 2). Intratracheal (i.t.) challenge of immunocompetent MelLec-knockout mice with wild type A. fumigatus conidia revealed no alterations in survival or other physiological parameters, including weight (Extended data Fig. 8a). However, a significantly reduced influx of neutrophils into the lungs of MelLec-knockout mice could be detected shortly (4 h) after i.t. challenge (Extended data Fig. 8b-d), before the conidia had germinated16. This alteration in cellular recruitment in the MelLec-knockout mice was associated with alterations in selected neutrophil-related cytokines, including KC and GM-CSF (Extended data Fig. 8e). Similar alteration in neutrophil recruitment was also observed in the MelLec-knockout mice following i.t. challenge with melanin ghosts of A. fumigatus (Extended data Fig. 8f). There were no alterations in other pulmonary myeloid populations following conidial challenge and by 24 h post challenge the difference in neutrophil influx was no longer apparent (Extended data Fig. 8g-h). There were also no changes in expression of MelLec during infection with A. fumigatus (Extended data Fig. 8i). Notably, the early neutrophil recruitment defect in the MelLec-knockout mice was lost upon i.t. challenge with ΔpksP conidia, which lack melanin (Extended data Fig. 8j,k).
Extended data Figure 8

MelLec-/- mice show early inflammatory defects upon challenge with A. fumigatus.

a, Survival (left) and weight measurements (right) of immunocompetent mice following intratracheal (i.t.) infection with 107 A. fumigatus conidia (n=4 animals per group). Values shown are mean ± SD. b, Exemplar flow cytometric gating strategy for identification of CD45+ cells from BAL. c, Representative FACS profiles of pulmonary CD11b+ Ly6Ghigh neutrophils in wild-type and MelLec-/- mice 4 h after challenge with 107 A. fumigatus conidia (wt n=29 animals; MelLec-/- n=26 animals). Pulmonary CD11b+ Ly6Ghigh neutrophils (wt n=29 animals, MelLec-/- n=26 animals) (d) and cytokines (n=25 animals per group) (e) in mice 4 h after challenge with 107 A. fumigatus conidia, as indicated. f, Pulmonary CD11b+ Ly6Ghigh neutrophils in mice 4 h after challenge with melanin ghosts (160 µg) of A. fumigatus (wt n=15 animals; MelLec-/- n=10 animals). Samples with blood contamination were excluded. g, Pulmonary CD11b+ Ly6Ghigh neutrophils in mice 24 h after challenge with 107 A. fumigatus conidia (wt n=33 animals, MelLec-/- n=30 animals). h, Cellular inflammatory profiles of mice after 24 h challenge with 107 A. fumigatus conidia, as indicated (wt n=33 animals, MelLec-/- n=30 animals). Alveolar macrophages were defined as CD11c+ Siglec-F+, inflammatory macrophages as CD11b+ F4/80+ and eosinophils as CD11b+ Siglec-F+. d-h, Values shown are mean ± SEM of pooled data from at least two independent experiments, analysed by two-sided Mann-Whitney U test. i, Expression of MelLec on pulmonary CD45- CD31+ cells isolated from uninfected mice (black) and mice 24 h after infection with A. fumigatus conidia (red). Grey line, isotype control (n=3 animals per group). j, Pulmonary CD11b+ Ly6Ghigh neutrophils in mice 4 h after challenge with 107 ΔpksP A. fumigatus conidia (wt n=7 animals, MelLec-/- n=8 animals). Values shown are mean ± SEM of pooled data from two independent experiments, analysed by two-sided Mann-Whitney U test. k, Representative FACS profiles of pulmonary CD11b+ Ly6Ghigh neutrophils in wild-type and MelLec-/- mice 4 h after challenge with 107 ΔpksP A. fumigatus conidia (wt n=7 animals, MelLec-/- n=8 animals). *, p≤0.05; ns, not significant.

We next examined the role of MelLec during infections in corticosteroid-treated mice, to model the effects of immunosuppression17. Under these conditions, loss of MelLec did not significantly alter susceptibility to infection (Extended data Fig. 9a). However, when we intravenously (i.v.) infected immunocompetent MelLec-knockout mice with A. fumigatus conidia17, we observed substantially increased susceptibility in these mice compared to wild-type animals (Fig. 4a). This increased susceptibility was associated with increased fungal burdens in several tissues, including the brain (Fig. 4b and Extended data Fig. 9b-d), as well as alterations in inflammatory responses (Fig. 4c). IL-17 responses were unaffected18. Consistent with a role in melanin recognition, there was no difference in susceptibility or fungal burdens between wild-type and MelLec-knockout mice following systemic infection with ΔpksP conidia (Fig. 4d and Extended data Fig. 9e).
Extended data Figure 9

MelLec-/- mice show alterations in anti-fungal immunity during systemic infection.

a, Survival of corticosteroid treated mice following intratracheal (i.t.) infection with 105 A. fumigatus conidia (n=15 animals per group). Pooled data from two independent experiments, analysed by log-rank test. b, Fungal burdens in various mouse tissues, as indicated, 4 days after i.v. infection with 106 A. fumigatus conidia (n=12 animals per group). Values shown are mean ± SEM of pooled data from two independent experiments, analysed by two-sided Mann-Whitney U test. c, Tissue section of kidney from day 4 infected MelLec-/- mouse stained with Grocott's methenamine silver stain and haematoxylin (n=3 animals per group). d, Immunofluorescence microscopy of brain from day 2 infected MelLec-/- mouse (n=3 animals per group). Fungi are stained with calcofluor white (blue), leukocytes with Gr1 (green), and DNA with propidium iodide (red). e, Fungal burdens in various mouse tissues, as indicated, 4 days after i.v. infection with 106 ΔpksP A. fumigatus conidia (n=4 animals per group). Values shown are mean ± SD, analysed by two-sided Mann-Whitney U test. *, p≤0.05; ns, not significant.

Figure 4

MelLec is required to prevent disseminated infection in mice and humans.

a, Survival of mice following intravenous (i.v.) infection with 106 A. fumigatus conidia (n=16 animals per group). Pooled data from two independent experiments, analysed by log-rank test. Tissue fungal burdens (b) and brain cytokine levels (c) of mice 4 days after i.v. infection with 106 A. fumigatus conidia (n=12 animals per group). b-c, Values shown are mean ± SEM of pooled data from two independent experiments, analysed by two-sided Mann-Whitney U test. d, Survival of mice following i.v. infection with 106 ΔpksP A. fumigatus conidia (n=15 animals per group). Pooled data from two independent experiments, analysed by log-rank test. e, Cumulative incidence analysis of invasive aspergillosis after transplantation according to donor (wildtype, n=238 individuals; SNP allele, n=72 individuals) or recipient (wildtype, n=228 individuals; SNP allele, n=80 individuals) CLEC1A rs2306894 genotypes, analysed by two-sided Gray’s test. f, Cytokine production in monocyte-derived macrophages, following stimulation with A. fumigatus conidia (wildtype, n=14 individuals; SNP allele, n=5 individuals). Values shown are mean ± SD, analysed by two-sided Mann-Whitney U test. *, p≤0.05; ns, not significant; HR, hazard ratio.

Our murine data suggested that MelLec plays a key role in immunity to disseminated infections with Aspergillus. Therefore, we next explored the role of this receptor in humans. In humans, MelLec has previously been detected on endothelial cells19,20 but also myeloid cells5,18–20, and we could demonstrate that a human MelLec Fc fusion protein (Fc-hMelLec) recognises DHN-melanised conidia (Extended data Fig. 10a). A common missense single nucleotide polymorphism (SNP) within the coding region of CLEC1A (rs2306894, global MAF=0.3295) results in an amino acid change (Gly26Ala) in the cytoplasmic tail of hMelLec. Strikingly, we found a highly significant association between this SNP and the risk of aspergillosis in stem-cell transplant recipients (Fig. 4e). This increased risk occurred when the variant was carried by the donor, but not when carried by the recipient. This suggests that in humans, the protective functions of MelLec are primarily mediated by myeloid cells. In our mouse model, there was no difference in resistance to infection upon adoptive transfer of MelLec-deficient bone-marrow into irradiated wild-type recipients (Extended data Fig. 10b).
Extended data Figure 10

A SNP in human MelLec influences anti-Aspergillus inflammatory responses.

a, Representative histograms showing the presence or absence of human MelLec ligands on ΔrodA or ΔrodAΔpksP A. fumigatus conidia, as determined by flow cytometry. Fc-CLEC12b was used as a control (Fc-control). Experiment was repeated at least 3 times independently, with similar results. b, Survival of irradiated wild-type mice reconstituted with wild-type or MelLec-/- bone-marrow (BM), as indicated, following i.v. infection with 106 A. fumigatus conidia (n=16 animals per group). Pooled data from two independent experiments, analysed by log-rank test. c, Inflammatory cytokine production in monocyte-derived macrophages isolated from genotyped individuals, following stimulation with LPS (wild-type n=14 individuals, SNP allele n=5 individuals). Values shown are mean ± SD, analysed by two-sided Mann-Whitney U test. d, Inflammatory cytokine production in PBMCs isolated from genotyped Dutch individuals, following stimulation with heat-killed A. fumigatus conidia (wild-type n=72 individuals, SNP allele n=17 individuals). Boxes represent the median values and interquartile ranges; whiskers represent minimum and maximum values, analysed by two-sided Mann-Whitney U test. e, Inflammatory cytokine production in transduced RAW264.7 macrophages expressing wild-type or SNP allele following stimulation with ΔrodA or ΔrodAΔpksP A. fumigatus conidia, as indicated. Values shown are mean ± SD, analysed by one-way ANOVA and repeated at least 3 times independently, with similar results. *, p≤0.05; ns, not significant.

To demonstrate a functional effect of the SNP in MelLec on myeloid cell function, we analysed the responses of monocyte-derived macrophages isolated from healthy genotyped donors. We found that macrophages from the individuals carrying this SNP produced significantly less IL-1β and IL-8 following in vitro stimulation with A. fumigatus conidia compared to controls (Fig. 4f), whereas there was no difference in response upon stimulation with LPS (Extended data Fig. 10c). We verified the inflammatory defect caused by this SNP in PBMCs isolated from an independent cohort (Extended data Fig. 10d). Moreover, using transduced RAW264.7 macrophages, we could directly demonstrate that this SNP results in an inflammatory defect upon stimulation with melanin-containing conidia (Extended data Fig. 10e). In summary, melanin is considered a fungal virulence factor, providing protection against reactive oxygen species and inhibiting host cell phagocytosis, cytokine production and apoptosis3,10,21. Here we show that fungal DHN-melanin is also sensed by the host, through a Melanin sensing C-type Lectin receptor (MelLec) that plays a crucial role in controlling systemic A. fumigatus infection in both mice and humans. However, the data presented here, as well as early studies in rats18,22, show that the cellular expression of this receptor differs between species. Critically, we define a polymorphism of this receptor that, when present in donor cells, increases the susceptibility of stem-cell transplant recipients to disseminated aspergillosis. Our data therefore suggest that identifying donors carrying this SNP could significantly help reduce the incidence of this disease in transplant recipients. It is likely that MelLec will have an important role in immunity to other melanised fungi and black yeasts23, especially those that cause phaeohyphomycosis, mycetoma, and chromoblastomycosis.

Methods

Mice and fungal strains

C57BL/6 and MelLec-/- mice (8-12 weeks old) were obtained from the specific pathogen-free facility at the University of Aberdeen. Animal experiments were performed using age-matched female mice and conformed to the animal care and welfare protocols approved by UK Home Office (project license 70/8073) in compliance with all relevant local ethical regulations. MelLec-/- mice were generated commercially (TaconicArtemis) by conventional gene targeting in C57BL/6 embryonic stem cells as detailed in Extended data Fig. 7. Mice were randomly assigned to experimental or control groups, co-housed, and experiments were not blinded. A. fumigatus isolate 13073 (American Type Culture Collection) and a clinical isolate CBS 144-8924 were used as wild-type strains. Melanin mutant strains (Δalb1(pksP1), Δayg1, Δabr1, Δabr2, Δarp1 and Δarp2 in the B5233 wild-type background) were generated previously25. ΔrodA and ΔpksPΔrodA deletion mutants were generated as described9,10,24. Wild-type CBS110.4626 and CBS386.7526 strains with white conidia were also used, as indicated. All strains were maintained on 2% (w/v) malt-agar slants or potato dextrose agar in culture flasks; conidia were harvested and washed before use. Swollen/germinating morphotypes were obtained upon incubating conidia in Sabouraud liquid culture medium at 37°C for different time intervals, as indicated.

Fc-MelLec production and immunolabelling

Soluble chimeric proteins containing the stalk and CTLD of murine and human MelLec fused to the mutated Fc portion of human IgG1 were generated essentially as described previously27. Briefly, the relevant portions of the MelLec encoding genes were amplified by PCR (mouse primers, GAATTCCTCGAGCTGGAGCTCTCCAGGTAC and AAGCTTTCTACCAGCTGTCTAAT; human primers; GGGATCCACTACTACCAGCTCTCC and TGGATATCTGTCACCTTCGCCTAATGTTTC), and cloned into the pSecTag2 expression vector (Invitrogen Life Technologies) containing the mutated form of human IgG128. Sequenced constructs were transfected into HEK293T cells using Fugene 6 (Promega), as per manufacturer’s instructions. Fusion proteins were purified from conditioned supernatants by chromatography on protein A Sepharose and dialysed against PBS. Fc-Dectin-127 and Fc-CLEC12b29 were generated similarly and used as controls. For flow cytometry, fungi were incubated in 1-3% (w/v) BSA in PBS and Fc-proteins were added to a final concentration of 5 µg/mL. Following incubation at 4°C, fungal particles were washed in FACS buffer (0.5% (w/v) BSA and 2 mM EDTA in PBS), and bound Fc-proteins detected with allophycocyanin (APC) or phycoerythrin (PE)-conjugated donkey anti-human antibody (Jackson ImmunoResearch), fixed in 1% (v/v) formaldehyde, and analysed. For microscopy, para-formaldehyde fixed conidia were taken for immunolabelling6. To obtain NaOH treated conidia, 1 M NaOH was added to conidia and heated in a boiling water bath for 1 h, followed by centrifugation to collect conidia and extensive washing. Melanin ghosts were isolated from conidia (B5233 as well as melanin mutant strains) by harsh chemical treatments that degrade other cellular components and result in hollow spherical-shaped melanin shells (“melanin ghosts”), as described before30. For immunostaining, fungal particles were incubated with 5 µg/mL Fc-MelLec in PBS containing 1% (w/v) BSA for 1 h. Following washing, bound Fc-MelLec was detected with fluorescein isothiocyanate (FITC)-labelled goat anti-human Fc-specific IgG (Sigma) in PBS containing 1% (w/v) BSA and washed with PBS-Tween. Conidia incubated with FITC-labelled anti-human Fc-specific IgG only were used as a negative control (data not shown). Labelled conidia were observed by fluorescence microscopy (Leica DMLB, USA). In some experiments, Fc-proteins were pre-treated with either ghosts of melanin mutant strains, as indicated, or heptaketide naphthopyrone (YWA1), which was isolated from AYG1 deletion mutant conidia as described previously13.

Monoclonal antibody production

The generation of monoclonal antibodies (mAb) to MelLec was performed essentially as described previously31. In brief, Sprague Dawley rats were immunised with Fc-MelLec in Freund’s complete adjuvant. After a final intraperitoneal boost, without adjuvant, rat splenocytes were harvested and fused with Y3 myeloma cells, as described32. Hybridoma supernatants were screened by ELISA and positives were then tested by immunohistochemistry and flow cytometry, as described below, against Fc-MelLec as well as MelLec transduced NIH3T3 fibroblasts. Two mAbs (14C8 and 18E4; both IgG1) were selected for further use. Where required, mAbs were biotinylated with Sulfo-NHS-LC Biotin (Pierce), as described by the manufacturer.

Cell culture and growth conditions

Cells were maintained at 37°C and 5% CO2 in DMEM or RPMI medium supplemented with 10% heat-inactivated foetal calf serum, 100 units/mL penicillin, 0.1 mg/mL streptomycin, and 2 mM L-glutamine. Phoenix ecotropic packaging cells (Plat-E) were maintained with the addition of 1 µg/mL puromycin and 10 µg/mL blasticidin (Life Technologies, Inc.). NIH3T3 fibroblasts stably expressing full length murine or human MelLec were generated essentially as described for Dectin-133. Briefly, hemagglutinin (HA)-tagged MelLec was generated through PCR amplification (mouse primers, GGATCCACCATGCAGGCCAAATACAGCA and CTCGAGCTACTGGAGCTCTCCAGGTAC; human primers, AAAGGATCCACCATGCAGGCCAAGTACAGCAGCAC and AGCGTAATCCGGAACATCGTATGGGTACTCGAG) and subcloning into pFb-neo (Stratagene). Constructs were transfected into Plat-E retroviral packaging cell lines using Fugene 6 and retrovirus containing supernatants were used to transduce NIH3T3 fibroblasts in the presence of polybrene (Sigma). Stably transfected cells were selected using 600 µg/mL G418 (ThermoFisher Inc.). The expression of the receptor was confirmed by flow cytometry and Western Blotting, using the anti-HA antibody (Covance). In some experiments, NIH3T3 cells expressing murine CLEC12A31 were used as controls.

ELISA assays

Alkali-insoluble and soluble fungal cell wall fractions were obtained as described previously34. For the ELISA, wells were coated overnight with 20-200 µg/mL of the cell wall fractions, melanin ghosts (in house generated), purified YWA1 (in house generated), 1,8-DHN, 1,2-DHN, 1,4-DHN, naphthalene, 1-naphthol (all from Sigma) in 50 mM carbonate buffer pH 9.6, and then blocked with 1% BSA in PBS. Fc-MelLec (5 µg/mL) was added to the wells and incubated for 1 h at room temperature. Following washing with PBS-Tween-20 (0.5% (v/v)), peroxidase-conjugated human Fc-specific IgG (Sigma) was added to the wells and incubated for 1 h at room temperature. Following further washing, quantification of Fc-MelLec binding was detected using ortho-phenylenediamine (OPD, Sigma) and H2O2 detection system (Merck). The reaction was stopped using 4% (v/v) H2SO4 and optical densities measured at 492 nm.

Expression analysis

Peripheral blood leucocytes, resident and thioglycolate-elicited inflammatory peritoneal cells, alveolar macrophages and bone marrow cells were isolated essentially as described previously35. For platelets, peripheral blood was collected in 3.8% (w/v) sodium citrate buffer and centrifuged at 200xg at 25°C. The supernatant, containing platelet rich plasma, was used for subsequent analysis. Bone marrow-derived macrophages or dendritic cells, generated using L929 conditioned medium or 20 ng/mL GM-CSF (R&D Systems), respectively, were prepared as described31. In some experiments, cells were stimulated with 100 ng/mL lipopolysaccharide from Escherichia coli (Sigma). Tissues isolated from mice were cut into small pieces and incubated for 30 min at 37°C with Liberase (Roche) and DNAse (Roche) in RPMI (Gibco), except for the small intestine which was incubated with Collagenase VIII (Sigma-Aldrich). Cells were disaggregated using the gentleMACS™ Dissociator (Miltenyi), strained through 70 µm nylon cell strainers (Fisher Scientific) and collected by centrifugation. Red blood cells were removed using Pharm Lyse (BD Biosciences). For flow cytometry, isolated cells were washed in FACS wash (PBS with 0.5% (w/v) BSA and 5-10 mM EDTA) containing anti-CD16/CD32 (Clone 2.4G2, prepared in house). The following antibodies (all from BD Biosciences, eBioscience or Abcam) were used for FACS analysis of cell surface antigen expression following standard methodology: anti-MelLec-Biotin (described above), Streptavidin-PE-CF594 or Streptavidin-APC, anti-CD45.2-FITC (Clone 104), biotinylated anti-CD61 (clone 2C9.G2), anti-CD326-APC (EpCAM; Clone G8.8), anti-CD31-PE-Cyanine7 (PECAM-1; Clone 390), anti-Ly6G-APC (clone 1A8), anti-CD11b-PE-Cy7 (clone M1/70), CD11c-PerCP-Cy5.5 (clone HL3), anti-Siglec-F-BV421 (clone E50-2440), anti-CD45-PE-Cy7 (clone 30-F11), anti-CD11b-PerCP-Cy5.5 (clone M1/70), anti-CD11c-BV421 (clone HL3), anti-Siglec-F-PE (clone E50-2440) and anti-F4/80-AF700 (clone CL:A3-1) and isotype control AFRC MAC 49 (ECACC 85060404; isotype for anti-MelLec). Cell viability was detected using the fixable viability dye eFluor-780 (eBioscience) in PBS, and the cells were fixed with 1% formaldehyde prior to acquisition on a LSRII, LSR Fortessa or FACS Calibur (Becton Dickinson). Data were analysed using FlowJo. All contour plots are made using 2% probability contouring with outliers. For immunofluorescence microscopy 6 μm alcohol fixed frozen lung sections were treated with Liberase (Roche) for 4 min at room temperature. Sections were blocked with 2% (v/v) normal goat serum, and incubated with anti-MelLec or isotype control for 1 h followed by Alexa Fluor 488 goat anti-rat (Invitrogen) for 30 min. Vectashield with DAPI or PI (Vector Laboratories Inc.) was used as a mountant for fluorescence, and slides were visualised using a Zeiss LSM 700 confocal microscope. Visualisation of transfected NIH3T3 cells was performed similarly, except the cells were fixed in 4% (v/v) paraformaldehyde prior to analysis. Detection of MelLec in complementary DNA (cDNA) (Multiple Tissue Panels, Clontech) was performed using the Titanium Taq PCR kit (Clontech) with the following primers CAGAGCCCAGGCACTCAGAGAATG and TGCGGGAGAGCCCTGTCCAAT. Expression of G3PDH was detected, as described previously36.

Murine infection models

For pulmonary infections, 105 (corticosteroid model) or 107 A. fumigatus ATCC 13073 conidia were administered to the caudal oropharynx of anesthetized mice. In some experiments, mice were administered with 0.6 mg of the corticosteroid, triamcinolone acetonide37 (Bristol-Myers Squibb), on days -1, 1 and 3, relative to infection on day 0. For systemic infections, 106 A. fumigatus ATCC 13073 conidia were administered to the lateral tail vein of mice. Mice were culled when they had lost 30% body weight or had become moribund. Pulmonary cellular inflammation was assessed by flow cytometry following total lung enzymatic digest, as described above, or in bronchoalveolar lavage (BAL) samples, isolated with PBS containing 5 mM EDTA (Gibco). Organs were homogenized in PBS and used for determination of fungal burdens and levels of inflammatory cytokines. Fungal burdens were determined by serial dilution onto potato dextrose agar plates and normalised to organ weights. Cytokines were measured by ELISA (R&D DuoSet), as described by the manufacturer, and normalized to protein concentration. Bone marrow chimeric mice were generated as described previously38.

Glycan microarray analyses

Microarray analyses were carried out using the neoglycolipid (NGL)-based microarray system 39. Details of the glycan probe library, the generation of the microarrays, imaging and data analysis are in the Supplementary Glycan Microarray Document (Supplementary Table 3) in accordance with the MIRAGE (Minimum Information Required for A Glycomics Experiment) guidelines for reporting glycan microarray-based data. The microarray contained 496 lipid-linked glycan probes (Supplementary Table 1). Microarray analysis of the soluble Fc-MelLec was performed essentially as described8. In brief, after blocking arrayed slides with 0.04% (v/v) Blocker Casein (Pierce), 1% (w/v) bovine serum albumin (Sigma A8577) in HEPES buffered saline (5 mM HEPES, pH 7.4, 150 mM NaCl, 5 mM CaCl2), murine Fc-MelLec was precomplexed with biotinylated anti-human IgG (Vector) at a 1:3 ratio (w/w) before application onto the slides at a final concentration of 10 μg/mL. FLAG-tagged human Langerin was included as a positive control. The protein and rat anti-FLAG antibody mAb L5 were kindly provided by Chae Gyu Park (Yonsei University College of Medicine, Seoul). For analysis, the FLAG-tagged Langerin, was precomplexed with the rat anti-FLAG at a 1:3 ratio (w/w) and applied onto the slides at a final concentration of 5 μg/mL, followed by biotinylated anti-rat IgG (Pierce) (5 μg/mL). To detect binding Alexa Fluor-647-labeled streptavidin from Molecular Probes was used at 1 μg/mL. Data analysis and presentation was performed with dedicated glycan microarray software40.

Human studies

A total of 310 hematologic patients undergoing allogeneic hematopoietic stem cell transplantation at the Hospital of Santa Maria, Lisbon and Instituto Português de Oncologia (IPO), Porto, between 2009 and 2014 were enrolled in the study. The cases of invasive aspergillosis were identified and classified as “probable” or “proven” according to the revised standard criteria from the European Organization for Research and Treatment of Cancer/Mycology Study Group (EORTC/MSG)41. Exclusion criteria included diagnosis of “possible” invasive aspergillosis, infection with invasive moulds other than Aspergillus spp. or history of pre-transplant mould infection. Study approval was obtained from the institutional review boards (SECVS-125/2014, HSM-632/14 and CES.26/015) and from the National Data Protection Commission (CNPD, 1950/2015) and was in compliance with all local relevant ethical regulations. Genomic DNA was isolated from whole blood of recipients and donors (before transplantation) using the QIAcube automated system (Qiagen) at the regional centres of the Instituto Português do Sangue e Transplantação (Portugal). Genotyping of the nonsynonymous rs2306894 SNP in the CLEC1A gene was performed using KASPar assays (LGC Genomics) according to manufacturer’s instructions in an Applied Biosystems 7500 Fast real–time PCR system (Thermo Fisher). Genotyping sets included randomly selected replicates of previously typed samples, and agreement between original and duplicate samples was ≥99%. Peripheral blood mononuclear cells from healthy genotyped donors were enriched from buffy coats using Histopaque®-1077 (Sigma-Aldrich) and contaminating erythrocytes removed using Red Blood Cell Lysis Buffer (Sigma-Aldrich). Participants gave written informed consent prior to blood collection. Monocytes were isolated by positive selection using magnetically labelled CD14+ MicroBeads (Miltenyi Biotec) on a MiniMACS separator and seeded at 106 cells/mL in 24-well plates for 7 days in RPMI-1640 medium supplemented with 10% (v/v) human serum and 20 ng/mL recombinant human granulocyte macrophage colony-stimulating factor (GM-CSF, Gibco). Acquisition of macrophage morphology was confirmed by phase contrast microscopy (Axiovert 135, Zeiss). For infection, macrophages were washed and then infected with live conidia of A. fumigatus strain A1163 at a ratio of 1:10 (cells/fungus) for 20 h at 37°C and 5% CO2. Cytokines in supernatants were detected using DuoSet ELISA systems (BioLegend), according to the manufacturer’s instructions. At least two technical replicates were performed for each donor. For the independent cohort, genomic DNA was isolated from EDTA venous blood of healthy Dutch volunteers using the Gentra Pure Gene Blood kit (Qiagen, Venlo, The Netherlands) and genotyped for CLEC1A polymorphisms using the Illumina Immunochip SNP array platform, described previously42. Participants gave written informed consent prior to blood collection. As the CLEC1A SNP of interest (exonic rs2306894) was not represented on the genotyping platform, two intronic polymorphisms (rs7972187 and rs3825300) were used as markers. Linkage analysis revealed complete linkage disequilibrium of these two polymorphisms with the SNP of interest43 (R2=1). 105 PBMCs isolated from genotyped donors were stimulated with 107 killed conidia/mL of the clinical isolate A. fumigatus V05-2744. After 24 h incubation in the presence of 10% human pooled serum at 37°C and 5% CO2 supernatants were collected and IL-1β and IL-8 were measured by ELISA (R&D Systems, UK, and PeliKine, Sanquin, The Netherlands, respectively).

Statistical analysis

The probability of invasive aspergillosis resulting from CLEC1A rs2306894 SNP was analysed using the cumulative incidence method and compared using Gray's test45. Cumulative incidences were computed with the cmprsk package for R version 2.10.146, with censoring of data at the date of last follow–up visit and defining relapse and death as competing events. A period of 24 months after transplant was chosen to include all cases of fungal infection. Murine survival data were analysed with the log rank test using GraphPad Prism. No data was excluded. In vitro and ex-vivo data were analysed using the GraphPad Prism software. Two-tailed student’s t-tests or Mann-Whitney U tests were used to determine statistical significance. All experiments were independently repeated at least once, unless otherwise indicated. Sample sizes of at least five per group were chosen as this would allow the detection of a 25% difference in the mean between experimental and control groups with a probability of greater than 95% (p < 0.05), assuming a standard deviation of around 15% and a minimum power value of 0.8.

MelLec recognises ligands on selected fungi and fungal morphotypes.

Cartoon representation of the structure of Fc-MelLec (a) and the full length receptor (b). Lollipop structures represent predicted glycosylation sites. c, Fc-MelLec or Fc-CLEC12b (Fc-control) staining of C. albicans hyphae, generated in RPMI with 10% foetal bovine serum for 90 min. Fungal particles were analysed by flow cytometry. Experiment was repeated independently twice, with similar results. d, Representative light microscope images and immunofluorescence micrographs using Fc-MelLec or anti-galactomannan (GM, control) as probes to detect ligands on A. fumigatus mycelium. e, Representative light microscope and immunofluorescence micrographs showing the surface distribution of MelLec ligands on Cladosporium cladosporioides using Fc-MelLec as a probe. Lower panels show fungal cells following treatment with 1M NaOH. d-e Experiments were repeated 3 times independently, with similar results. f, IL-2 production by MelLec-expressing BWZ reporter cells following stimulation by αMelLec antibody crosslinking or with ΔrodA (1:1, 5:1, 10:1) or ΔrodAΔpksP (5:1, 10:1) A. fumigatus conidia, as indicated. Values shown are mean ± SD. Experiment was repeated 3 times independently, with similar results.

Glycan microarray analyses of murine Fc-MelLec and human Langerin.

These 496 lipid-linked probes are arranged according to their backbone sequences as annotated in the coloured panels below the figure. Lac, lactose; LacNAc, N-acetyllactosamine; LNnT, lacto-N-neotetraose; LNT, lacto-N-tetraose; PolyLac, polylactosamine; GAGs, glycosaminoglycans; Misc., miscellaneous. The signals are means of fluorescence intensities of duplicate spots, printed at 5 fmol per spot level with error bars representing half of the difference between the two values. The signals shown together with the probe sequences are in Supplementary Table 1. ns, not significant.

MelLec recognises DHN-melanin.

a, Representative immunofluorescence micrographs using Fc-MelLec as a probe showing the surface distribution of MelLec-ligands on A. fumigatus wild-type and a variety of melanin deficient mutants, as indicated. Lower panels show conidia treated with 1M NaOH. b, Representative immunofluorescence and light micrograph images of ΔrodAΔpksP A. fumigatus conidia stained with Fc-MelLec or ConA-FITC, as indicated. c, Representative histograms showing the presence or absence of MelLec or Dectin-1 ligands on ΔrodA or ΔrodAΔpksP A. fumigatus conidia, as indicated. Fungal particles were stained with Fc-MelLec (red) or Fc-Dectin-1 (green) and analysed by flow cytometry. Grey histograms indicate secondary only control. d, Representative histogram showing the presence Dectin-1 ligands on ΔpksP A. fumigatus conidia. Fungal particles were stained with Fc-Dectin-1 (green) or Fc-CLEC12b (Fc-control; blue) and analysed by flow cytometry. e, Representative histogram showing the presence MelLec ligands on melanin ghosts of A. fumigatus conidia. Fungal particles were stained with Fc-MelLec (red) or Fc-CLEC12b (Fc-control; blue) and analysed by flow cytometry. a-e, Experiments were repeated 3 times independently, with similar results. f, Flow cytometric analysis of melanised (red) and non-melanised (grey) Cryptococcus neoformans yeast and melanin ghosts, and B16 melanoma cells47, stained with Fc-MelLec, as indicated. Experiment was repeated independently twice, with similar results.

MelLec recognises naphthalene-diol.

a, Detection of MelLec ligands in ghosts of melanin mutants of A. fumigatus by ELISA, as indicated. Values show mean ± SD. b, Representative immunofluorescence and light micrograph images of Fc-MelLec ligands on NaOH-treated A. fumigatus B5233 conidia following pre-treatment with ghosts of ΔpksP or Δayg1 conidia, as indicated. c, Representative immunofluorescence and light micrograph images of MelLec ligands on NaOH-treated wild-type A. fumigatus conidia following pre-treatment with or without heptaketide naphthopyrone (YWA1). a-c, Experiments were repeated at least 3 times independently, with similar results. d, Detection of Fc-MelLec or Fc-Dectin-1 ligands on ΔrodA conidia following pre-treatment with (blue) or without (red) heptaketide naphthopyrone (YWA1). Experiment was repeated independently twice, with similar results. Detection of 1,8-DHN (e) and 1,2-DHN and 1,4-DHN (f) by Fc-MelLec and Fc-control using ELISA, as indicated. Values show mean ± SD. g, Detection of 1,8-DHN, naphthalene and 1-naphthol by Fc-MelLec using ELISA, as indicated. Values show mean ± SD. e-g, Experiments were repeated at least 3 times independently, with similar results.

MelLec is expressed at the cell surface.

a, RT-PCR detection of MelLec expression in various tissues, as indicated. The expression of glycerol-3-phosphate dehydrogenase (G3PDH) in these samples, also used for the characterization of MCL36, is shown as a control. Experiment was performed once (for gel source data, see Supplementary Figure 1). b, Flow cytometric analysis of surface expression of HA-tagged murine and human MelLec on the surface of NIH3T3 fibroblasts (black open histograms). NIH3T3 cells transfected with vector only served as controls (grey filled histograms). c, Western blot analysis of lysates of HA-tagged mMelLec expressing NIH3T3 cells under reducing and non-reducing conditions and with and without N-glycosidase. HA-tagged mCLEC12A31 expressing NIH3T3 cells served as controls (for blot source data, see Supplementary Figure 1). d, Relative binding of FITC-labelled ΔrodA A. fumigatus conidia to NIH3T3 cells transduced with vector only, Dectin-1 or MelLec, as determined by flow cytometry. Values shown are mean ± SD, analysed by one-way ANOVA. e, Screening of hybridoma supernatants on mMelLec-expressing (red) and parental (black) NIH3T3 cells. b-e, Experiments were repeated at least 3 times independently, with similar results. *, p≤0.05; Ns, not significant.

Murine MelLec is not expressed by myeloid cells.

Flow cytometric analysis of MelLec expression on various ex vivo and in vitro derived myeloid cells (a) and peripheral blood, bone marrow, lymph nodes and spleen (b), as indicated. a-b, Experiments were repeated at least twice independently, with similar results. c, Flow cytometric analysis of MelLec expression on CD61+ platelets. Experiment was repeated at least 3 times independently, with similar results. BM, bone marrow; DC, dendritic cell; mø, macrophage; LPS, lipopolysaccharide.

MelLec expression in tissues and generation of MelLec-/- mice.

a, Immunofluorescence microscopy of MelLec-expressing versus control NIH3T3 cells labelled with αMelLec (green). Nuclei are stained with DAPI (blue). Experiments were repeated at least 3 times independently, with similar results. b, Exemplar flow cytometric gating strategy for identification of live cells from tissue. c, Flow cytometric analysis of MelLec expression on live CD45- CD31+ EpCAM- and EpCAM+ populations in the liver, as indicated. Flow cytometric analysis of MelLec expression on live CD45- CD31+ cells in the heart (d), kidney (e) and small intestine (f). Flow cytometric analysis of MelLec expression on live CD45-EpCAM+ cells in the heart (g), kidney (h), small intestine (i) and epidermis (j). b-j Experiments were repeated at least twice independently, with similar results. Black lines, isotype controls. k, Schematic representation of the wild-type CLEC1A locus, gene targeting vector, PCR primer sites, and correctly targeted recombinant gene-targeted allele. l, PCR analysis of gene-targeted mice (for gel source data, see Supplementary Figure 1). +/+, wild-type, +/- heterozygous and -/- homozygous for the targeted allele. m, Immunofluorescence microscopy of naïve lung tissue from MelLec-/- mice (labelling of wild-type lung is shown in Fig. 3b). n, Analysis of MelLec expression in disaggregated lung tissue from wild-type (wt) or MelLec-/- mice by flow cytometry. l-n, Experiments were repeated at least 3 times independently, with similar results.

MelLec-/- mice show early inflammatory defects upon challenge with A. fumigatus.

a, Survival (left) and weight measurements (right) of immunocompetent mice following intratracheal (i.t.) infection with 107 A. fumigatus conidia (n=4 animals per group). Values shown are mean ± SD. b, Exemplar flow cytometric gating strategy for identification of CD45+ cells from BAL. c, Representative FACS profiles of pulmonary CD11b+ Ly6Ghigh neutrophils in wild-type and MelLec-/- mice 4 h after challenge with 107 A. fumigatus conidia (wt n=29 animals; MelLec-/- n=26 animals). Pulmonary CD11b+ Ly6Ghigh neutrophils (wt n=29 animals, MelLec-/- n=26 animals) (d) and cytokines (n=25 animals per group) (e) in mice 4 h after challenge with 107 A. fumigatus conidia, as indicated. f, Pulmonary CD11b+ Ly6Ghigh neutrophils in mice 4 h after challenge with melanin ghosts (160 µg) of A. fumigatus (wt n=15 animals; MelLec-/- n=10 animals). Samples with blood contamination were excluded. g, Pulmonary CD11b+ Ly6Ghigh neutrophils in mice 24 h after challenge with 107 A. fumigatus conidia (wt n=33 animals, MelLec-/- n=30 animals). h, Cellular inflammatory profiles of mice after 24 h challenge with 107 A. fumigatus conidia, as indicated (wt n=33 animals, MelLec-/- n=30 animals). Alveolar macrophages were defined as CD11c+ Siglec-F+, inflammatory macrophages as CD11b+ F4/80+ and eosinophils as CD11b+ Siglec-F+. d-h, Values shown are mean ± SEM of pooled data from at least two independent experiments, analysed by two-sided Mann-Whitney U test. i, Expression of MelLec on pulmonary CD45- CD31+ cells isolated from uninfected mice (black) and mice 24 h after infection with A. fumigatus conidia (red). Grey line, isotype control (n=3 animals per group). j, Pulmonary CD11b+ Ly6Ghigh neutrophils in mice 4 h after challenge with 107 ΔpksP A. fumigatus conidia (wt n=7 animals, MelLec-/- n=8 animals). Values shown are mean ± SEM of pooled data from two independent experiments, analysed by two-sided Mann-Whitney U test. k, Representative FACS profiles of pulmonary CD11b+ Ly6Ghigh neutrophils in wild-type and MelLec-/- mice 4 h after challenge with 107 ΔpksP A. fumigatus conidia (wt n=7 animals, MelLec-/- n=8 animals). *, p≤0.05; ns, not significant.

MelLec-/- mice show alterations in anti-fungal immunity during systemic infection.

a, Survival of corticosteroid treated mice following intratracheal (i.t.) infection with 105 A. fumigatus conidia (n=15 animals per group). Pooled data from two independent experiments, analysed by log-rank test. b, Fungal burdens in various mouse tissues, as indicated, 4 days after i.v. infection with 106 A. fumigatus conidia (n=12 animals per group). Values shown are mean ± SEM of pooled data from two independent experiments, analysed by two-sided Mann-Whitney U test. c, Tissue section of kidney from day 4 infected MelLec-/- mouse stained with Grocott's methenamine silver stain and haematoxylin (n=3 animals per group). d, Immunofluorescence microscopy of brain from day 2 infected MelLec-/- mouse (n=3 animals per group). Fungi are stained with calcofluor white (blue), leukocytes with Gr1 (green), and DNA with propidium iodide (red). e, Fungal burdens in various mouse tissues, as indicated, 4 days after i.v. infection with 106 ΔpksP A. fumigatus conidia (n=4 animals per group). Values shown are mean ± SD, analysed by two-sided Mann-Whitney U test. *, p≤0.05; ns, not significant.

A SNP in human MelLec influences anti-Aspergillus inflammatory responses.

a, Representative histograms showing the presence or absence of human MelLec ligands on ΔrodA or ΔrodAΔpksP A. fumigatus conidia, as determined by flow cytometry. Fc-CLEC12b was used as a control (Fc-control). Experiment was repeated at least 3 times independently, with similar results. b, Survival of irradiated wild-type mice reconstituted with wild-type or MelLec-/- bone-marrow (BM), as indicated, following i.v. infection with 106 A. fumigatus conidia (n=16 animals per group). Pooled data from two independent experiments, analysed by log-rank test. c, Inflammatory cytokine production in monocyte-derived macrophages isolated from genotyped individuals, following stimulation with LPS (wild-type n=14 individuals, SNP allele n=5 individuals). Values shown are mean ± SD, analysed by two-sided Mann-Whitney U test. d, Inflammatory cytokine production in PBMCs isolated from genotyped Dutch individuals, following stimulation with heat-killed A. fumigatus conidia (wild-type n=72 individuals, SNP allele n=17 individuals). Boxes represent the median values and interquartile ranges; whiskers represent minimum and maximum values, analysed by two-sided Mann-Whitney U test. e, Inflammatory cytokine production in transduced RAW264.7 macrophages expressing wild-type or SNP allele following stimulation with ΔrodA or ΔrodAΔpksP A. fumigatus conidia, as indicated. Values shown are mean ± SD, analysed by one-way ANOVA and repeated at least 3 times independently, with similar results. *, p≤0.05; ns, not significant.

Supplementary Material

Supplementary Information is linked to the online version of the paper at www.nature.com/nature.
  45 in total

Review 1.  The contribution of melanin to microbial pathogenesis.

Authors:  Joshua D Nosanchuk; Arturo Casadevall
Journal:  Cell Microbiol       Date:  2003-04       Impact factor: 3.715

2.  Pentaketide melanin biosynthesis in Aspergillus fumigatus requires chain-length shortening of a heptaketide precursor.

Authors:  H F Tsai; I Fujii; A Watanabe; M H Wheeler; Y C Chang; Y Yasuoka; Y Ebizuka; K J Kwon-Chung
Journal:  J Biol Chem       Date:  2001-05-11       Impact factor: 5.157

3.  SNAP: a web-based tool for identification and annotation of proxy SNPs using HapMap.

Authors:  Andrew D Johnson; Robert E Handsaker; Sara L Pulit; Marcia M Nizzari; Christopher J O'Donnell; Paul I W de Bakker
Journal:  Bioinformatics       Date:  2008-10-30       Impact factor: 6.937

4.  Identification of Aspergillus fumigatus Surface Components That Mediate Interaction of Conidia and Hyphae With Human Platelets.

Authors:  Günter Rambach; Gerhard Blum; Jean-Paul Latgé; Thierry Fontaine; Thorsten Heinekamp; Magdalena Hagleitner; Hanna Jeckström; Günter Weigel; Philipp Würtinger; Kristian Pfaller; Sven Krappmann; Jürgen Löffler; Cornelia Lass-Flörl; Cornelia Speth
Journal:  J Infect Dis       Date:  2015-03-25       Impact factor: 5.226

5.  The C-type lectin-like receptor CLEC-1, expressed by myeloid cells and endothelial cells, is up-regulated by immunoregulatory mediators and moderates T cell activation.

Authors:  Pamela Thebault; Natacha Lhermite; Gaëlle Tilly; Laëtitia Le Texier; Thibaut Quillard; Michele Heslan; Ignacio Anegon; Jean-Paul Soulillou; Sophie Brouard; Beatrice Charreau; Maria-Cristina Cuturi; Elise Chiffoleau
Journal:  J Immunol       Date:  2009-08-10       Impact factor: 5.422

6.  Isolation and characterization of a pigmentless-conidium mutant of Aspergillus fumigatus with altered conidial surface and reduced virulence.

Authors:  B Jahn; A Koch; A Schmidt; G Wanner; H Gehringer; S Bhakdi; A A Brakhage
Journal:  Infect Immun       Date:  1997-12       Impact factor: 3.441

7.  Surface hydrophobin prevents immune recognition of airborne fungal spores.

Authors:  Vishukumar Aimanianda; Jagadeesh Bayry; Silvia Bozza; Olaf Kniemeyer; Katia Perruccio; Sri Ramulu Elluru; Cécile Clavaud; Sophie Paris; Axel A Brakhage; Srini V Kaveri; Luigina Romani; Jean-Paul Latgé
Journal:  Nature       Date:  2009-08-27       Impact factor: 49.962

8.  Revised definitions of invasive fungal disease from the European Organization for Research and Treatment of Cancer/Invasive Fungal Infections Cooperative Group and the National Institute of Allergy and Infectious Diseases Mycoses Study Group (EORTC/MSG) Consensus Group.

Authors:  Ben De Pauw; Thomas J Walsh; J Peter Donnelly; David A Stevens; John E Edwards; Thierry Calandra; Peter G Pappas; Johan Maertens; Olivier Lortholary; Carol A Kauffman; David W Denning; Thomas F Patterson; Georg Maschmeyer; Jacques Bille; William E Dismukes; Raoul Herbrecht; William W Hope; Christopher C Kibbler; Bart Jan Kullberg; Kieren A Marr; Patricia Muñoz; Frank C Odds; John R Perfect; Angela Restrepo; Markus Ruhnke; Brahm H Segal; Jack D Sobel; Tania C Sorrell; Claudio Viscoli; John R Wingard; Theoklis Zaoutis; John E Bennett
Journal:  Clin Infect Dis       Date:  2008-06-15       Impact factor: 9.079

9.  Ligands for the beta-glucan receptor, Dectin-1, assigned using "designer" microarrays of oligosaccharide probes (neoglycolipids) generated from glucan polysaccharides.

Authors:  Angelina S Palma; Ten Feizi; Yibing Zhang; Mark S Stoll; Alexander M Lawson; Esther Díaz-Rodríguez; María Asunción Campanero-Rhodes; Júlia Costa; Siamon Gordon; Gordon D Brown; Wengang Chai
Journal:  J Biol Chem       Date:  2005-12-21       Impact factor: 5.157

10.  Characterisation of murine MICL (CLEC12A) and evidence for an endogenous ligand.

Authors:  Elwira Pyz; Cristal Huysamen; Andrew S J Marshall; Siamon Gordon; Philip R Taylor; Gordon D Brown
Journal:  Eur J Immunol       Date:  2008-04       Impact factor: 5.532

View more
  57 in total

1.  Aspergillus fumigatus Cell Wall Promotes Apical Airway Epithelial Recruitment of Human Neutrophils.

Authors:  Michael B Feldman; Richard A Dutko; Michael A Wood; Rebecca A Ward; Hui Min Leung; Ryan F Snow; Denis J De La Flor; Lael M Yonker; Jennifer L Reedy; Guillermo J Tearney; Hongmei Mou; Bryan P Hurley; Jatin M Vyas
Journal:  Infect Immun       Date:  2020-01-22       Impact factor: 3.441

2.  Fungal immunology in clinical practice: Magical realism or practical reality?

Authors:  Christina C Chang; Stuart M Levitz
Journal:  Med Mycol       Date:  2019-06-01       Impact factor: 4.076

Review 3.  Host defense mechanisms against Aspergillus fumigatus lung colonization and invasion.

Authors:  Joseph J Mackel; Chad Steele
Journal:  Curr Opin Microbiol       Date:  2019-05-16       Impact factor: 7.934

Review 4.  Aspergillus fumigatus and aspergillosis: From basics to clinics.

Authors:  A Arastehfar; A Carvalho; J Houbraken; L Lombardi; R Garcia-Rubio; J D Jenks; O Rivero-Menendez; R Aljohani; I D Jacobsen; J Berman; N Osherov; M T Hedayati; M Ilkit; D James-Armstrong; T Gabaldón; J Meletiadis; M Kostrzewa; W Pan; C Lass-Flörl; D S Perlin; M Hoenigl
Journal:  Stud Mycol       Date:  2021-05-10       Impact factor: 16.097

Review 5.  The first line of defense: effector pathways of anti-fungal innate immunity.

Authors:  Rebecca A Ward; Jatin M Vyas
Journal:  Curr Opin Microbiol       Date:  2020-11-17       Impact factor: 7.934

6.  Differential Interactions of Serum and Bronchoalveolar Lavage Fluid Complement Proteins with Conidia of Airborne Fungal Pathogen Aspergillus fumigatus.

Authors:  Sarah Sze Wah Wong; Irene Daniel; Jean-Pierre Gangneux; Jeya Maheshwari Jayapal; Hélène Guegan; Sarah Dellière; Prajna Lalitha; Rajashri Shende; Taruna Madan; Jagadeesh Bayry; J Iñaki Guijarro; Dharmalingam Kuppamuthu; Vishukumar Aimanianda
Journal:  Infect Immun       Date:  2020-08-19       Impact factor: 3.441

Review 7.  Aspergillus fumigatus and Aspergillosis in 2019.

Authors:  Jean-Paul Latgé; Georgios Chamilos
Journal:  Clin Microbiol Rev       Date:  2019-11-13       Impact factor: 26.132

Review 8.  Menacing Mold: Recent Advances in Aspergillus Pathogenesis and Host Defense.

Authors:  Benjamin Y Tischler; Tobias M Hohl
Journal:  J Mol Biol       Date:  2019-04-04       Impact factor: 5.469

9.  Zombie Cells, Composite Cells of Fungal-Human Keratinocytes of Plantar Hyperkeratosis-Like Lesions.

Authors:  Charles Xiaoxiang Zhu; Xianghong Li; Xiaogang Tan; Guodong Wu
Journal:  Mycopathologia       Date:  2019-08-02       Impact factor: 2.574

10.  Genetic variation and fungal infection risk: State of the art.

Authors:  Michail S Lionakis
Journal:  Curr Fungal Infect Rep       Date:  2019-11-27
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.