Brevundimonas spp: Emerging global opportunistic pathogens.

Non-fermenting Gram-negative bacteria are problematic in clinical locations, being one of the most prevalent causes of nosocomial infections. Many of these non-fermenting Gram-negative bacteria are opportunistic pathogens that affect patients that are suffering with underlying medical conditions and diseases. Brevundimonas spp., in particular Brevundimonas diminuta and Brevundimonas vesicularis, are a genus of non-fermenting Gram-negative bacteria considered of minor clinical importance. Forty-nine separate instances of infection relating to Brevundimonas spp were found in the scientific literature along with two pseudo-infections. The majority of these instances were infection with Brevundimonas vesicularis (thirty-five cases - 71%). The major condition associated with Brevundimonas spp infection was bacteraemia with seventeen individual cases/outbreaks (35%). This review identified forty-nine examples of Brevundimonas spp. infections have been discussed in the literature. These findings indicate that infection review programs should consider investigation of possible Brevundimonas spp outbreaks if these bacteria are clinically isolated in more than one patient.

Introduction

Gram-negative, non-fermenting bacteria are an emerging concern in clinical locations, being a common cause of nosocomial infections. Opportunistic pathogens from this group include many different bacterial species, including: Acinetobacter baumannii, Burkholderia cepacia, Ralstonia pickettii, Pseudomonas aeruginosa, Sphingomonas pauciomobilis, and Stenotrophomonas maltophilia [1-8]. The group can survive in a wide variety of environments including different water sources (aircraft water, bottled water, hospital water, purified water) [9-12], and are usually resistant to a wide array of antimicrobials [13,14]. Examples include resistance to penicillins, aminoglycosides and monobactems in R. pickettii [13] and penicillins, aminoglycosides, carbapenems and monobactems in S. maltophilia [14]. Bacteria such as these have the ability to infect patients/individuals with underlying medical conditions and diseases. Examination of the scientific literature showed multiple types of infections resulting from Brevundimonas spp. This indicates that the genus may be a more widespread pathogen than was hitherto thought, with infections caused by Brevundimonas spp. being invasive and severe. The goal of this study was to give an overview of the range of Brevundimonas spp infections, any underlying conditions associated with Brevundimonas spp infections and the treatment options used in the treatment of any Brevundimonas spp infections in order to assist medical practitioners.

Genus Brevundimonas

The genus Brevundimonas was first proposed by Segers et al [15]; incorporating Pseudomonas diminuta and Pseudomonas vesicularis [16,17]. Several species of the genus Caulobacter were later transferred to Brevundimonas significantly emending the description of the genus [18]. Currently, there are 25 species with valid published names within the Brevundimonas genus (http://www.bacterio.net/brevundimonas.html). The type species is Brevundimonas diminuta; with the type strain being LMG 2089.

Brevundimonas species are aerobic Gram-negative, oxidase and catalase positive, non-fermenting rods 1 to 4 μm in length and 0.5 μm in width, belonging to the Alphaproteobacteria class and Caulobacteraceae family with a DNA G + C content of 65% to 68% [15]. Motility is provided by one short polar flagellum. Brevundimonas spp. have been isolated from multiple environments, including soils [9-21], deep subsea floor sediment [22] activated sludge,[23] black sand, [24], deep subsea floor sediment [25] numerous aquatic habitats [26], purified water [27] and also from the condensation water of a Russian space laboratory [28].

Brevundimonas spp.

Brevundimonas diminuta

Brevundimonas diminuta is the type species of the Brevundimonas genus. It has been isolated from clinical specimens, including blood and urine [15] as well as from the lung sputum of cystic fibrosis patients [29]. B. diminuta is not believed to be a significant pathogen and its virulence is generally low. B. diminuta is used as a test organism to validate reverse-osmosis (RO) filtration devices for drinking water purification and is also used to test the porosity of pharmaceutical-grade filters (0.2 μm) due to the small size of the bacterium when grown in minimal media [30,31]. The bacterium has however been shown to be capable of penetrating these filters [32]. The bacterium has been used as a potential bioremediator of marine oil pollution including diesels, n-alkanes and polycyclic aromatic hydrocarbons [33,34] and insecticides [35]. B. diminuta has also been used to mitigate the toxic effects of heavy metals on plant growth (rice) in contaminated soils [36]. B. diminuta also possesses the ability to survive sanitizers such as Hydrogen Peroxide + Peracetic Acid [37]. All available reported incidences of infection credited to B. diminuta are listed in Table 1-3.

Table 1.

Incidences of Brevundimonas spp. infection from 1978–2000 – Main characteristics of the case reports.

Author (Ref)/ Species	Year	Sex/Age	Country	Co-morbidity	Type of infection	Susceptible to	Resistance to	Antibiotic treatment	Outcome
Otto et al. [53], B. vesicularis	1978	Multiple cases (5 cases)	USA	N/A	Cervicitis	Ampicillin, Carbenicillin, Gentamicin, Kanamycin Nitrofurantoin, Streptomycin, Tetracycline	Colistin, Nalidixic acid, Sulfisoxazole	N/A	N/A
Vanholder et al. [54], B. vesicularis	1990	M/62	Belgium	Hemodialysis,	Bacteraemia/HA	N/A	N/A	Cefotaxime, Tobramycin	Complete recovery
Vanholder et al. [55], B. vesicularis	1992	F/62	Belgium	Hemodialysis,	Bacteraemia/HA	N/A	N/A	Cefotaxime, Tobramycin	Complete recovery
Planes et al. [56], B. vesicularis	1992	W/54	USA	Systemic lupus erythematosus and chronic active autoimmune hepatitis	Bacteraemia/HA	N/A	N/A	Ceftazidime, Tobramycin	Surgical resection of the infected tissue
Pasadakis et al. [57], B. diminuta	1993	N/A	Greece	End-stage renal failure	Peritonitis	N/A	N/A	Initial 500 mg/L ceftazidime in a I-L + 1.7 mg/kg of tobramycin. Maintenance doses 250 mg/2 L of ceftazidime + 16 mg/2 L of tobramycin	Complete recovery
Oberhelman et al. [58], B. vesicularis	1994	M/5	USA	Sickle cell anaemia	Pneumonia/CA	N/A	N/A	Ceftriaxone, Gentamicin	Complete recovery
Calegari et al. [59], B. vesicularis	1996	M/60	Uruguay	Trauma	Botryomycosis/CA	N/A	N/A	Cefuroxime	Complete recovery
Gilad et al. [60], B. vesicularis	2000	F/42	Israel	Mitral valve replacement	Bacteraemia/HA	Amoxicillin-Clavulanate, Amino-glycosides, Co-trimoxazole, Imipenem, Mezlocillin, Piperacillin, Piperacillin- Tazobactam	Ampicillin, Aztreonam, Cefuroxime, Ceftriaxone, Ceftazidime, Ciprofloxacin	Piperacillin- Tazobactam	Complete recovery

M- Male, F- Female, N/A – Not Available, CA – Community Acquired, HA- Hospital Acquired.

Table 3.

Incidences of Brevundimonas spp. infection from 2010 – 2017. Main characteristics of the case reports.

Author (Ref)	Year	Sex/Age	Country	Co-morbidity	Type of infection	Susceptible to	TResistance to	Antibiotic treatment	Outcome
Shang et al. [78], B. vesicularis	2011	M/83	Taiwan	Type 2 diabetes, Hypertension	Progressive leucocytosis/HA	Amikacin, Ampicillin/Sulbactam, Cefazolin, Ceftazidime, Ceftriaxone, Cefepime, Ertapenem, Gentamicin, Imipenem, Piperacillin/Tazobactam	Ampicillin, Ciprofloxacin	N/A	Complete recovery
Shang et al. [78], B. vesicularis	2011	M/25	Taiwan	Lymphoma	Febrile neutropenia/HA	Amikacin, Ampicillin/Sulbactam, Cefazolin, Ceftriaxone, Ertapenem, Gentamicin, Imipenem, Piperacillin/Tazobactam	Ampicillin, Ceftazidime, Cefepime, Ciprofloxacin	Ceftriaxone	Complete recovery
Bhatawadekar & Sharma [79] B. vesicularis	2011	F/Infant	India	Infant	Bacteraemia/CA	Amikacin, Amoxicillin, Cefotaxime, Ciprofloxacin, Gentamicin, First Generation Cephalosporins, Imipenem, Meropenem, Piperacillin, Ticarcillin	Ceftazidime, Cefoxitin, Co-trimaxazole,, Netilmicin	Cefotaxime	Complete recovery
Yoo et al. [80], B. vesicularis	2012	M/30	South Korea	N/A	Liver Abscess	Amikacin, Ampicillin-Sulbactam, Imipenem	Aztreonam, Ceftazidime, Cefepime, Ciprofloxacin	Ceftriaxone, Ampicillin-Sulbactam	Complete recovery
Almuzara et al. [47], B. diminuta	2012	F/56	Argentina	Lupus glomerulonephritis	Leg ulcer	Minocycline, Tigecycline	Ampicillin, Ampicillin/Sulbactam, Aztreonam, Cefalotin, Cefoxitin, Cefotaxime, Ceftazidime, Cefepime, Ciprofloxacin, Colistin, Gentamicin, Imipenem, Meropenem, Piperacillin/Tazobactam, Trimethoprim- sulfamethoxazole	Tigecycline plus imipenem.	Complete recovery
Karadag et al. [81], B. vesicularis	2012	M/Infant	Turkey	Neonate	Neonatal sepsis	Amikacin, Ceftriaxone, Gentamicin, Imipenem	Ampicillin, third-generation Cephalosporins, piperacillin-tazobactam	Empirical Ampicillin, Gentamicin. After susceptibility testing Meropenem followed by ciprofloxacin	Complete recovery
Khalifa  et al. [48], B. vesicularis	2012	F/Infant	Tunisia	Pompe disease	Bacteraemia	Amikacin, Aztreonam Cefotaxime, Ceftazidime, Ciprofloxacin, Gentamicin, Imipenem, Ofloxacin, Piperacillin/ tazobactam	Ppiperacillin, Ticarcillin	Ceftazidime 100 mg / kg daily for 10 days and Amikacin 15 mg / kg daily	Complete recovery
Pandit et al. [82], B. diminuta	2012	F/66	USA	N/A	Keratitis/CA	Amikacin, Gentamicin, Tobramycin	Ampicillin, Cefotaxime, Ceftazidime, Ciprofloxacin, Moxifloxacin	Besifloxacin and Tobramycin, Following identification Tobramycin was changed to Gentamicin	Complete recovery
Lu et al. [45], B. diminuta	2013	M/38	China	None	Pleuritis	Amikacin, Chloramphenicol, Gentamicin, Cefoperazone-Sulbactam, Meropenem, Piperacillin/tazobactam, Tetracycline	Aztreonam, Ceftazidime, Cefepime, Ciprofloxacin, Levofloxacin, Trimethoprim-sulfamethoxazole	Initially: Ciprofloxacin After Treatment failure: Piperacillin/tazobactam	Complete recovery
Nandy et al. [83], B. vesicularis	2013	F/Infant	India	Infant	Bacteraemia	Meropenem, Ceftazidime/ Clavulanic acid, Netilimycin, Cefepime, Ampicillin/Sulbactam, Piperacillin/Tazobactam, Levofloxacin, Ciprofloxacin, Ceftazidime, Tobramycin, Gentamicin	Cotrimaxazole, Nalidixic acid	Piperacillin/ Tazobactam, Amikacin, Gentamycin, Fluconazole, Ciprofloxacin, Meropenem	Complete recovery
Shobha et al. [84], B. diminuta	2013	Infant	India	None	Urinary Tract Infection	Amikacin, Amoxicillin-Clavulanic acid, Cefotaxime, Cefepime, Imipenem, Ticarcillin/clavunalic acid, Trimethoprim–sulfamethoxazole	Ampicillin, Ciprofloxacin	Ticarcillin/clavulanic acid	Complete recovery
Gupta et al. [49], B. vesicularis	2014	M/24	India	None	Urinary Tract Infection	Minocycline, Piperacillin/tazobactam Trimethoprim–sulfamethoxazole	Amikacin, Amoxicillin, Amoxicillin-Clavulanate, Aztreonam Ceftazidime, Cefoperazone, Cefoperazone-Sulbactam, Cefoxitin, Cefotaxime, Colistin, Ertapenem, Gentamicin, Imipenem, Levofloxacin, Meropenem, Netilmicin, Norofloxacin, Tobramycin	Amikacin, Piperacillin/tazobactam	Complete recovery
Shujat et al. [85], B. vesicularis	2014	F	Pakistan	Gall Bladder issues	Bacteraemia	N/A	N/A	Meropenem	Complete recovery
Kishore [86] B. vesicularis	2014	M/51	India	Diabetes Mellitus (Type 2), Coronary Artery Disease	Bacteraemia	N/A	Ampicillin-Sulbactam	Amikacin, Amoxyclav	Complete recovery
Mahapatra et al. [87], B. diminuta	2014	M/35	India	N/A	Post traumatic abscess	N/A	N/A	N/A	Complete recovery
Ra et al. [88], B. vesicularis	2015	F/71	South Korea	End stage renal disease, Hypertension and diabetes mellitus	peritoneal dialysis-associated peritonitis	Cefepime, Cefotaxime, Gentamicin, Imipenem, Piperacillin	N/A	1-g dose of Cefazolin and 1-g dose of Ceftazidime per day	Complete recovery following catheter removal
Cao et al. [89], B. diminuta	2015	M/62	China	Myelodysplastic syndrome, Diabetes Mellitus (Type 2)	Bacteraemia	Ampicillin, Amikacin, Ceftriaxone, Cefepime, Cefazolin, Ceftazidime, Ciprofloxacin, Gentamicin, Imipenem, Levofloxacin, Piperacillin/tazobactam Trimethoprim–sulfamethoxazole	Aztreonam, Tobramycin	N/A	Complete recovery
Singh and Bhatia [90] B. vesicularis	2015	8 month old	India	Infant	Septicaemia/ CA	Amikacin, Cefoperazone, Levofloxacin, Piperacillin/tazobactam	Amoxicillin-Clavulanate, Ceftazidime	Initially: Amikacin, Ceftriaxone, Vancomycin Following Sensitivity testing: Cefoperazone, Levofloxacin,	Complete recovery
Chandra et al. [91], B. vesicularis	2017	M/18	India	Nephrotic syndrome	Nephrotic syndrome	imipenem, meropenem, amikacin, gentamicin, fluoroquinolones, minocycline, tigecycline, cefoperazone-sulbactam, ceftazidime, cefepime, and cotrimoxazole	Colistin	cefoperazone-sulbactam 1.5 g iv BD for 2 weeks	Complete recovery
Swain and Rout [92] B. diminuta	2017	M/56	India	Type-2 diabetes mellitus, hypertension with epileptic disorder	Bacteraemia	Amikacin, Ceftazidime, Ceftazidime/clavulanic acid, Cefuroxime, Ceftriaxone, Ciprofloxacin, Levofloxacin, Netilimycin	Amoxicillin/clavulanic acid	Amikacin, Ceftazidime	Complete recovery

M- Male, F- Female, N/A – Not Available, CA – Community Acquired, HA- Hospital Acquired.

Brevundimonas vesicularis

Brevundimonas vesicularis has been isolated from eye, urine, wound cultures, the central nervous system, cervical specimens [38], and also been found in the lung sputum of cystic fibrosis patients [39]. The organism has been shown to support the growth of Legionella in nutrient limited water conditions [40]. The mechanism behind this phenomenon has not been elucidated but it is hypothesised to be due to cryptic growth, with B. vesicularis having the ability to grow in nutrient limited conditions and Legionella growing on this [40]. Further research is required to gain a fuller understanding of this phenomenon. B. vesicularis has been used as a potential bioremediator of polyaromatic hydrocarbons [41]. All reported incidences of infection credited to B. vesicularis are listed in Table 1–3.

Identification of Brevundimonas spp

Members of the Brevundimonas spp. are Gram negative with cells appearing as straight slim rods upon Gram staining. They are non-spore forming. They are aerobic with optimal growth temperatures of between 30–37°C. They are oxidase positive and give variable results for catalase (usually positive). B. diminuta colonies have a chalk white appearance on MacConkey agar, whereas B. vesicularis colonies have an orange colour given by an intracellular pigment. Both grow slowly on ordinary nutrient media [42]. Both B. vesicularis and B. diminuta can be identified via commercial biochemical identification kits or systems such as the API 20 NE system, the VITEK 2 system (bioMerieux) or the Phoenix-100 automated system (Becton Dickinson). MALDI-TOF identification is also being used for identification of Brevundimonas spp. in clinical situations [43,44]. Species specific Real Time PCR primers and Fluorescence in situ hybridization (FISH) probes have been designed for B. diminuta [45]. These can be seen in Table 4.

Table 4.

Molecular methods applied to identify Brevundimonas spp. [45].

Method	Target	Sequence	Species
Real Time PCR	gyrB	Forward Primer	Brevundimonas diminuta
		ATCGAGATCATGCTGCACTATGAGGG
		Reverse Primer
		TGTTGTTGGTGAAGCACAGCATGG
		Real-Time Probe
		ACGTCATCGTCATTCGCGGCCAGAA
Real Time PCR	rpoD	Forward Primer AGTTCCTCAAGGCCTATTTCGGCT	Brevundimonas diminuta
		Reverse Primer
		GGCTTCATTCTCGCTGAACTTGGT
		Real-Time Probe
		AGCGCATCAAGGAGATGGGCGT
FISH	gyrB	AAGAAGCACAGCGTCCGCTTCGAGC	Brevundimonas diminuta
FISH	rpoD	TCAAGGCCTATTTCGGCTCGGAGAT	Brevundimonas diminuta

Factors associated with Infection

Underlying causes

The majority of infections with Brevundimonas (Table 1–3) were found to have an underlying condition or disease that allowed patients to succumb to Brevundimonas infection. Seven patients, who were suffering with various types of cancer, contracted Brevundimonas -related bacteraemia, Urinary Tract Infection (UTI) and Empyema [46]; a 56-year-old female with Lupus glomerulonephritis acquired a Brevundimonas -related leg ulcer [47] and an infant suffering from Pompe disease was diagnosed with Brevundimonas -related bacteraemia [48]. Other examples of patients infected with Brevundimonas having underlying conditions are shown in Table 1–3. Such examples demonstrate the role of Brevundimonas as an opportunistic pathogen in immunocompromised individuals. Many of these instances of infection were hospital acquired although a large number were community acquired, which is interesting as opportunistic pathogens such as Brevundimonas spp or R. pickettii are usually contracted in hospital settings [7].

Co-Infection

Reports of cases of co-infection with Brevundimonas spp and other bacteria were rare with only two instances (one individual case and four cases as part of an outbreak) of co-infection being described in the literature. Han et al described seven cases of infection with B. diminuta within the same outbreak, four of these cases had other microorganism's co-isolated (coagulase-negative Staphylococcus – bacteraemia, Moraxella osloensis – catheter, Enterococcus sp. – UTI and Staphylococcus aureus – empyema) [46]. Gupta et al. found co-infection (in a UTI) of B. vesicularis along with Candida tropiclis and Acinetobacter spp. [49].

Pseudo-outbreaks

As can be seen in Table 5 to date only two pseudo-outbreaks have been reported with Brevundimonas spp. Pseudo-outbreaks can be problematic as they can result in superfluous treatments given to patients (e.g. unnecessary antibiotics or the removal of indwelling devices such as catheters) and can waste valuable time and resources in the clinical setting. The causes of pseudo-outbreaks may be due to a number of different factors such as contaminated water used in the bacterial testing procedures or contamination of materials used in laboratory testing. Kim et al [50] described how B. diminuta was the cause of a pseudo-outbreak in a general hospital ward in South Korea. Patients did not display symptoms associated with bacterial infection, even though the organism was detected. The source of the B. diminuta contamination was not discovered. Lee et al. [51]. described B. diminuta as the cause of pseudo-outbreak in a tertiary care centre in the USA. The contamination was traced to pre-prepared inoculant media (used in the testing procedures for bacterial detection).

Table 5.

Incidences of Brevundimonas spp. Pseudo-infection from 1978 – 2017. Main characteristics of the case reports.

Author (Ref)	Year	Sex/Age	Country	Co-morbidity	Type of infection	Susceptible to	Resistance to	Antibiotic treatment	Outcome
Kim et al. [50], B. diminuta	2011	Multiple (3 cases)	South Korea	Multiple	Pseudobacteraemia	N/A	Amikacin, Ciprofloxacin, Colistin, Ceftazidime, Cefepime, Cefotaxime Imipenem, Piperacillin / Tazobactam, Tobramycin	Ampicillin / sulbactam, Cefpiran, Metronidazole, Netilmicin	N/A
Lee et al. [51], B. diminuta	2017	Multiple (12 cases)	USA	Multiple	Pesudo-infection	Levofloxain, Meropenem, Piperacillin/tazobactam, Trimethoprim–sulfamethoxazole	Ceftazidime	N/A	N/A

M- Male, F- Female, N/A – Not Available

Treatment

The treatment of Brevundimonas spp. infections is frequently difficult, as these bacteria can be resistant to many different antibiotics including β-lactams and fluoroquinolones [46,47]. There have been no controlled trials of antimicrobial therapy for Brevundimonas spp. infections in humans therefore therapy should be informed by the results of in vitro susceptibility testing on isolates. In the majority of cases listed in Table 1–3 cephalosporins, penicillins or aminoglycoside antibiotics were given to treat patients and these were mostly successful.

Little is known about resistance mechanisms in Brevundimonas spp. Resistance to the fluoroquinolone family of antibiotics has been detected in outbreaks due to mutations in the quinolone resistance-determining region (QRDR) of the host gyrA, gyrB and parC genes [46]. BlaVIM-2 and BlaVIM-13, which mediate resistance to almost all β-lactams (except aztreonam), have been found in both environmental and clinical isolates of B. diminuta [47]. The presence of BlaVIM-2 is related to a Tn1721-class 1 integron which was discovered in all B. diminuta isolates, with the determinant located on a plasmid [47]. This integron also had an aac (6′)-Ib gene, which mediates resistance to aminoglycoside antibiotics. Tetracycline resistance genes have also been found in environmental isolates of B. diminuta [52].

Breakdown of cases of infection with Brevundimonas spp.

Literature searches presented in Table 1–3 illustrate 49 separate instances of infection relating to Brevundimonas spp. The majority of these instances were infection with B. vesicularis (thirty-five cases – 71%). One outbreak had both B. vesicularis and B. diminuta and one case of infection with B. vancanneytii was reported. The rest of the cases were made up B. diminuta infections (twelve cases- 24%). The major breakdown of condition were as follows: seventeen instances of bacteraemia (34%), five instances of septicaemia/sepsis (10%), three instances of pneumonia/ pleuritis (6%), two instances each endocarditis (4%), keratitis (4%), and urinary tract infection (4%). Serious infections with Brevundimonas spp include four instances of septicaemia (8%), two of endocarditis (4%), one of septic arthritis (2%) and one of meningitis (2%). Other conditions include instances of two cases of tonsillitis (2%), two of liver abscess (2%) and two of botryomycosis (2%). There have also been two reported instances (4%) of Brevundimonas spp infection that have caused two or more conditions: bacteraemia and reactive arthritis and bacteraemia, urinary tract infection and empyema. Four instances of death have been related to Brevundimonas spp infection, three of bacteraemia and one of septicaemia.

Conclusions

Brevundimonas spp. are not currently considered as major pathogens. However, this should be re-evaluated in light of our investigations where forty-nine examples of Brevundimonas spp. infections have been found in the literature. These species have characteristics, such as ability to pass through sterilising filters, which may allow them to cause potentially harmful infections and even death on occasion. Although it is of low virulence and not as big a risk as other non-fermenting Gram-negative bacteria such as Burkholderia etc., it should not be over looked as a possible cause of nosocomial infections and should be considered for inclusion in hospital screening and prevention programs. These programs should consider investigation of possible Brevundimonas spp outbreaks if these bacteria are clinically isolated in more than one patient.

Table 2.

Incidences of Brevundimonas spp. infection from 2001 – 2010. Main characteristics of the case reports.

Author (Ref)	Year	Sex/Age	Country	Co-morbidity	Type of infection	Susceptible to	Resistance to	Antibiotic treatment	Outcome
Lee et al. [61], Various	2000–2010	Multiple (30 cases)	Taiwan	Cancer patients	Bacteraemia	Ciprofloxacin, Colistin, Doripenem, Tigecycline	Amikacin, Piperacillin/tazobactam	Cefotaxime, Ceftazidime, Cefmetazole, Cefazolin, Cefuroxime, Ceftriaxone, Imipenem, Piperacillin/tazobactam, Ticaracillin-Clavulanate	Complete recovery
Seve et al. [62], B. diminuta	2004	F/35	France	Leukaemia	Bacteraemia/HA	Ciprofloxacin, Imipenem	Amikacin, Cefepime and Ceftazidime, Piperacillin	Initially Cefepime, Amikacin After susceptibility testing: Ciprofloxacin, Imipenem	Complete recovery
Chi et al. [63], B. vesicularis	2004	M/38	Taiwan	None	Tonsillitis/CA	Cefoperazone.	Ampicillin, Aztreonam, Cefazolin, Ceftazidime, Ciprofloxacin, Flomoxef, Gentamicin, Tobramycin	Amoxicillin/ Clavulanic acid	Complete recovery
Chi et al. [63], B. diminuta	2004	M/62	Taiwan	Liver cirrhosis, Encephalopathy, Spontaneous bacterial peritonitis	Bloodstream infection/CA	Amikacin, Aztreonam, Cefotaxime, Cefepime, Chloramphenicol, Ciprofloxacin Flomoxef, Gentamicin, Imipenem, Piperacillin-Tazobactam, Tetracycline, Tobramycin, Co-trimoxazole	Ampicillin, Cefazolin, Cefoperazone, Ceftazidime, Ceftriaxone	Cefotaxime	Complete recovery
Han et al., [46], B. diminuta	2005	Multiple (7 Cases)	USA	Cancer	Bacteraemia, Urinary Tract Infection, Empyema/HA	Amikacin, Imipenem and Ticarcillin/clavulanate	Ampicillin, Cefepime, Ciprofloxacin	Cefepime, Imipenem, Levofloxacin, Meropenem, Nafcillin, Tobramycin, Ticarcillin/ clavulanate, Vancomycin	Complete recovery
Karadag et al. [38], B. vesicularis	2005–2011	Multiple (8 cases)	Turkey	Neonates	Septicaemia/HA	Amikacin, Imipenem,	Aztreonam, Ceftazidime, Piperacillin/tazobactam	Ampicillin, Cefotaxime, Ciprofloxacin, Meropenem,	7 Complete recovery, 1 Died
Vahid [64] B. vesicularis	2005	W/36	USA	Acute myelogenous leukaemia	Bacteraemia	Ciprofloxacin, Ticaracillin-Clavulanate	Amikacin, Aztreonam, Cefepime, Ceftazidime, Ceftriaxone, Meropenem, Piperacillin/tazobactam	Initially: Amikacin, Ampohotericin B, Gancyclovir Vancomycin	Died
Papaefstathiou et al., [65], B. vesicularis	2005	F/92	Greece	Cardiac failure	Bacteraemia/CA	Amoxicillin-clavulanate, Aminoglycosides, Azlocillin, Aztreonam Second and Third-generation Cephalosporins, Imipenem, Piperacillin, Tetracycline, Trimethoprim-Sulfamethoxazole	Ampicillin, Cephalothin, Ciprofloxacin	Cefuroxime, Netilmicin	Died
Niedermeier et al. [66], B. vesicularis	2005	F/37	USA	Acute myeloid leukemia, Pregnancy, Pancytopenia	Sepsis/HA	N/A	N/A	Clindamycin, Piperacillin-tazobactam	Complete recovery from sepsis
Mondello et al. [67], B. vesicularis	2006	M/24	Italy	Pilocytic astrocytoma	Meningitis/HA	Ciprofloxacin, Co-trimoxazole, Tetracycline	N/A	Initially: Ceftriaxone, Ciprofloxacin, Co-trimoxazole After Treatment failure: Amikacin	Complete recovery
Choi et al. [68], B. vesicularis	2006	M/55	South Korea	Diabetes, Continuous ambulatory peritoneal dialysis	Peritonitis/CA	N/A	N/A	Aztreonam, Cefazolin, Ceftazidime, Ciprofloxacin, Vancomycin	Complete recovery
Yang et al. [69], B. vesicularis	2006	M/40	Taiwan	None	Endocarditis/ CA	Amikacin, Amoxicillin, Gentamicin, Piperacillin, Aztreonam, Cefepime, Meropenem, Netilmicin, Ampicillin, Ciprofloxacin, Cefazolin, Cefmetazole, Ceftazidime, Cefotaxime, Ceftriaxone, Ticarcillin	N/A	Cefazolin, Gentamicin	Complete recovery
Zhang et al. [70], B. vesicularis	2006–2009	Multiple Cases (22 patients)	Taiwan	Various (Cancer, heart failure, COPD, Kidney diease)	Bacteraemia/CA/HA	Amikacin, Cefpirome, Imipenem, Piperacillin/tazobactam,	N/A	Various (Penicillin's, Cephalosporins)	Complete recovery in 21 cases. 1 case of death
Pelletier et al. [71], B. vesicularis	2007	F/45	USA	None	Keratitis	Ceftazidime, Ciprofloxacin, Gentamicin, Levofloxacin	N/A	Ceftazidime	Complete recovery
Sofer et al., [72], B. vesicularis	2007	F/15 Month old	Israel	None	Septic Arthritis/CA	Aminoglycosides, Aminopenicillins, Cephalposporins, Piperacillin, Quinolones, Trimethoprim-sulfamethoxazole	N/A	Cefuroxime	Complete recovery
Menuet et al. [29], B. vesicularis	2008	F/17	France	Cystic Fibrosis	Pneumonia	Amikacin, Ceftriaxone, Gentamicin, Imipenem, Isepamicin, Rifampicin, Piperacillin/tazobactam, Ticarcillin, Ticarcillin- Clavulanate, Tobramycin	Amoxicillin, Amoxicillin-Clavulanate, Ceftazidime, Ciprofloxacin, Colistin, Trimethoprim-Sulfamethoxazole	Imipenem, Tobramycin	Complete recovery
Panasiti et al. [73], B. vesicularis	2008	M/71	Italy	None	Cutaneous Infection/CA	Amikacin, Cefoxitin, Ceftazidime, Cefuroxime, Cefalotin, Cepodoxime, Gentamycin, Tobramycin	Amoxicillin-Clavulanate, Cefeoime, Ofloxacin, Norfloxacin	Amoxicillin-Clavulanate	Complete recovery
Viswanathan et al. [74], B. vesicularis	2009	M/Infant	India	Newborn	Sepsis/HA	Amikacin, Cefotaxime, Ciprofloxacin, Gentamicin, Meropenem, Ofloxacin, Piperacillin tazobactam	N/A	Amikacin, Cefotaxime	Complete recovery
Chandra et al. [75], B. vesicularis	2010	M/31	USA	Biliary Pancreatitis	Bacteraemia	Amikacin, Cefuroxime, Cefepime, Ciprofloxacin, Gentamicin, Piperacillin/tazobactam, Polymyxin B,	Aztreonam.	Cefuroxime	Complete recovery
Restrepo et al. [76], B. vesicularis	2010	F/44	Columbia	None known	Reactive Arthritis + Bacteraemia	Amikacin, Imipenem, Meropenem, Piperacillin/tazobactam	Aztreonam, Ciprofloxacin	Initially: Amikacin, Ciprofloxacin Following Sensitivity testing: Piperacillin/tazobactam	Complete recovery
Estrela and Abraham [77] B. vancanneytii	2010	N/A	Germany	N/A	Endocarditis	N/A	N/A	N/A	N/A

M- Male, F- Female, N/A – Not Available, CA – Community Acquired, HA- Hospital Acquired.