Grain size, one of the important components determining grain yield in rice, is controlled by the multiple quantitative trait loci (QTLs). Intensive artificial selection for grain size during domestication is evidenced in modern cultivars compared to their wild relatives. Here, we report the molecular cloning and characterization of OsLG3b, a QTL for grain length in tropical japonica rice that encodes MADS-box transcription factor 1 (OsMADS1). Six SNPs in the OsLG3b region led to alternative splicing, which were associated with grain length in an association analysis of candidate region. Quantitative PCR analysis indicated that OsLG3b expression was higher during the panicle and seed development stages. Analysis of haplotypes and introgression regions revealed that the long-grain allele of OsLG3b might have arisen after domestication of tropical japonica and spread to subspecies indica or temperate japonica by natural crossing and artificial selection. OsLG3b is therefore a target of human selection for adaptation to tropical regions during domestication and/or improvement of rice. Phylogenetic analysis and pedigree records showed that OsLG3b had been employed by breeders, but the gene still has much breeding potential for increasing grain length in indica. These findings will not only aid efforts to elucidate the molecular basis of grain development and domestication, but also facilitate the genetic improvement of rice yield.
Grain size, one of the important components determining grain yield in rice, is controlled by the multiple quantitative trait loci (QTLs). Intensive artificial selection for grain size during domestication is evidenced in modern cultivars compared to their wild relatives. Here, we report the molecular cloning and characterization of OsLG3b, a QTL for grain length in tropical japonica rice that encodes MADS-box transcription factor 1 (OsMADS1). Six SNPs in the OsLG3b region led to alternative splicing, which were associated with grain length in an association analysis of candidate region. Quantitative PCR analysis indicated that OsLG3b expression was higher during the panicle and seed development stages. Analysis of haplotypes and introgression regions revealed that the long-grain allele of OsLG3b might have arisen after domestication of tropical japonica and spread to subspecies indica or temperate japonica by natural crossing and artificial selection. OsLG3b is therefore a target of human selection for adaptation to tropical regions during domestication and/or improvement of rice. Phylogenetic analysis and pedigree records showed that OsLG3b had been employed by breeders, but the gene still has much breeding potential for increasing grain length in indica. These findings will not only aid efforts to elucidate the molecular basis of grain development and domestication, but also facilitate the genetic improvement of rice yield.
Rice is one of staple food crops for over half of the world's population. Grain size, grain number and panicle number are the three component traits that determine rice yield. Among them, grain size is considered the main breeding target for its effect on both yield and quality, which is limited by grain length, width and thickness of the grain. Therefore, it is important to study grain size for improving yield and quality as well as understanding the domestication process that has occurred in rice (Shomura et al., 2008). Although a number of quantitative trait loci (QTLs) conferring grain length (Huang et al., 2012a) have been isolated, only a few genes have been well studied, such as GS3, GW8, GL3.1, OsLG3, TGW6, qSW5 and GW2 (Ishimaru et al., 2013; Mao et al., 2010; Shomura et al., 2008; Song et al., 2007; Wang et al., 2012; Yu et al., 2017; Zhang et al., 2012b). Therefore, the genetic dissection and molecular characterization of more genes conferring grain length need to be conducted (Mao et al., 2010).During the evolution of cultivated rice, grain size is usually affected by artificial selection. Thus, isolation of novel genes conferring grain size will provide more evidence for the origin and evolution of cultivated rice. Lately several QTLs controlling grain size that were selected during domestication have been cloned. Grain size 3 (GS3) is the first cloned QTL that negatively regulates grain length (Fan et al., 2006; Takano‐Kai et al., 2009). The C165A mutation in the exon 2 was a functional mutation widely spread in rice germplasm (Fan et al., 2009; Wang et al., 2011). This mutation arose from an ancient japonica and then flowed into the indica by introgression (Takano‐Kai et al., 2009). The QTL for grain width 5 (GW5/qSW5/GSE5) was a key gene involved in japonica rice domestication and natural variation in its promoter region contributed to diversity of grain size. Both the DEL1 (the 950‐bp deletion) and the DEL2 (the 1212‐bp deletion) were thought to be selected during the propagation of cultivation areas for indica and japonica, respectively (Duan et al., 2017; Liu et al., 2017; Shomura et al., 2008; Weng et al., 2008). Another gene, GRAIN NUMBER, GRAIN LENGTH AND AWN DEVELOPMENT 1 (GAD1), encodes a small secretary signal peptide that belongs to the EPIDERMAL PATTERNING FACTOR‐LIKE family (Jin et al., 2016). This locus was strongly selected in O. sativa during domestication. All of these genes might help to understand the origin and domestication of Asian cultivated rice at the molecular level.Slender grains with a large ratio of length‐to‐width are preferred by the majority of consumers (Fan et al., 2006), especially in South‐East Asia. The traditional tropical japonica, generally grown in tropical and subtropical regions, usually has a more slender and larger grain than those of temperate japonica (Figure S1 and S12 and Table S1). The genetic basis of these differences requires further investigation. In this research, we identified an important QTL, OsLG3b, controlling grain length and weight in tropical japonica rice by map‐based cloning. We used an association study to demonstrate that natural variation in OsLG3b was significantly associated with grain length, and this was confirmed by genetic transformation. We also identified the origin of the variations leading to increased grain length in tropical japonica and found evidence of selection across the OsLG3b region. The elite allele of OsLG3b could be used to breed new elite varieties.
Results
QTLs for grain size detected by linkage mapping
SLG‐1 (SLG), one of the varieties with the largest grain (1000 grain weight: 58.8 ± 1.07 g), is an improved temperate japonica developed from crosses involving tropical japonica. In contrast, Nipponbare (NIP), a typical temperate japonica, has small grain (1000 grain weight: 23.3 ± 0.2 g; Figure 1a). QTL analyses were carried out using BC4F2 and BC4F3 populations derived from a cross between SLG and NIP to analyse the molecular basis of large grain in SLG. Five QTLs for grain length, three for grain width, one for grain thickness and four for grain weight were detected (Table S2). Among them, qGW2‐1 (LOD score = 12.27), qGL3‐1 (LOD score = 26.68) and qTGW6‐1 (LOD score = 2.64) were mapped to the same regions as three reported genes, GW2, GS3 and TGW6, respectively (Figure 1b; Table S2). Sequencing data for these three genes confirmed allelic differences between SLG and NIP (Table S3). Importantly, we identified a grain length QTL, qGL3‐2, on the long arm of chromosome 3 (Figure 1b), explaining 18.0% (LOD score = 8.0) of the phenotypic variation in grain length and 17.2% (LOD score = 7.3) of the variation in grain thickness (Table S2). These results indicated that SLG pyramids at least three known large‐grain alleles (gw2, gs3 and TGW6) and qGL3‐2.
Figure 1
Map‐based cloning of Os. (a) Grain morphology of SLG and NIP. Scale bar, 5 mm. (b) QTL locations for grain length (GL, blue bars), grain width (GW, green bars), grain thickness (GT, red bars) and 1000 grain weight (TGW, pink bars). (c) NIL(NIP) and NIL(SLG) grains. Scale bar, 2.5 mm. (d) Grain length, (e) grain width, (f) grain thickness, (g) 1000 grain weight, (h) grain yield per plant. All phenotypic data in d–h were measured on paddy‐grown plants. Data represent mean ± S.E.M. (n = 10). Student's t‐tests were used to determine P values. *P < 0.05, **P < 0.01. (i, j) High‐resolution linkage analysis of phenotypes and marker genotypes. White bars represent chromosomal segments for Nipponbare homozygote, black for SLG homozygote, and grille for heterozygotes. Genotypes at the locus were confirmed by progeny tests. S, segregation; D, desegregation. (k) Predicted ORFs based on the Nipponbare genome sequence. , Os03g0215400;, Os03g0215200.
Map‐based cloning of Os. (a) Grain morphology of SLG and NIP. Scale bar, 5 mm. (b) QTL locations for grain length (GL, blue bars), grain width (GW, green bars), grain thickness (GT, red bars) and 1000 grain weight (TGW, pink bars). (c) NIL(NIP) and NIL(SLG) grains. Scale bar, 2.5 mm. (d) Grain length, (e) grain width, (f) grain thickness, (g) 1000 grain weight, (h) grain yield per plant. All phenotypic data in d–h were measured on paddy‐grown plants. Data represent mean ± S.E.M. (n = 10). Student's t‐tests were used to determine P values. *P < 0.05, **P < 0.01. (i, j) High‐resolution linkage analysis of phenotypes and marker genotypes. White bars represent chromosomal segments for Nipponbare homozygote, black for SLG homozygote, and grille for heterozygotes. Genotypes at the locus were confirmed by progeny tests. S, segregation; D, desegregation. (k) Predicted ORFs based on the Nipponbare genome sequence. , Os03g0215400;, Os03g0215200.
Fine mapping of qGL3‐2
To clone the gene for qGL3‐2, a near‐isogenic line was developed in the NIP background for the qGL3‐2 locus, NIL(SLG), through repeated backcrossing with NIP (Figure S2). Grains of NIL(SLG) were 7.5% longer, and 3.5% thicker than those of NIP, leading to a 7.1% increase in grain yield per plant (Figure 1c‐h and Figure S3e, f, h and i). No significant differences were detected in other agronomic traits, such as heading date, number of tillers per plant and grain number per panicle (Figure S3a‐d and g). The qGL3‐2 locus was preliminarily mapped to a 108‐kb region between RM14588 and C8 using 6000 BC5F2 plants derived from NIL (SLG) (Figure 1i). Another 4100 BC5F3 plants derived from BC5F2 recombinants were used to further narrow down the region to a 23‐kb interval flanked by the markers C2 and C3 (Figure 1j) that includes ORF1 (Os03g0215400) and the last three exons of ORF2 (Figure 1k). There was no polymorphism between the two parents in the coding sequence of ORF2, indicating that ORF1 was the most likely candidate gene for qGL3‐2. It was designated as Oryza sativa long grain 3b (hereafter OsLG3b). OsLG3b encodes MADS‐box transcription factor 1 (OsMADS1) controlling differentiation of specific cell types in the lemma and palea (Prasad et al., 2005).
Variation in OsLG3b is significantly associated with grain length
In order to investigate natural variation in the mapping region of QTL qGL3‐2, independently of the fine‐mapping analysis described above, a candidate region association analysis was conducted on the mapped 108‐kb region of qGL3‐2. This approach utilized a mini‐core collection (MCC) (Zhang et al., 2011) panel (Figure S4 and Tables S5 and S6) of 266, as part of “The 3000 rice genomes project” (the rice 3k genome), which had been deeply sequenced (see URLs). High‐density SNPs (one SNP per 40 bp on average) were obtained (Yu et al., 2017). We measured the grain length of each variety grown in five circumstances (Table S7) and observed substantial and highly significant variation in grain size, with high heritability values varying from 82% to 97% and an average of 89% (Figure S5 and Table S8). To reduce the incidence of false positives, a general linear model (GLM) that controls for population structure (Q matrix) was used to identify significant genotypic and phenotypic associations. The association analysis detected six SNPs within OsLG3b that were significantly associated with grain length (P < 1.0 × 10−8) (Figure 2a, c and Table S9). One of these SNPs was found in the last exon, and five SNPs were in the last intron of the Os03g0215400.
Figure 2
Identification of Os by association mapping. (a) Manhattan plot for candidate region association mapping of . The two red vertical lines indicate the boundaries of . (b) Gene structure of Os03g0215400. Empty boxes refer to 5′ and 3′‐UTRs, grey boxes are exons, and lines between boxes are introns. The variations (TCCTTGGTGAAGGTA → ATGT ‐ ‐ ATATATACT) in the Os03g0215400
are shown by dashed lines. (c) Structure of splicing site and mutation sites. Underlined nucleotides are the sequence of the first half of exons 8 in NIP; others are at the terminal of the intron 7. Snp1‐6, refer to six SNPs significantly associated with grain length (P < 1.0 × 10−8). In the schematic illustration of OsLG3b functional domains, SLG produced an alternatively spliced protein OsLG3b, in which the terminal 37 residues were truncated and additional 5 residues were added to the predicted C domain. (d) Genotyping analyses of cDNA fragment encoded by the SLG and NIP alleles in 18 rice cultivars. We designed a pair of primers (Table S11) to amplify a small cDNA sequence that contains the splicing mutation region and the PCR fragment of SLG had a 31 nucleotides deletion. Therefore, varieties with the SLG allele form 143‐bp PCR products and varieties with the NIP allele form 174‐bp PCR products. (e) Grains of 18 rice cultivars. (f, g) Functional validation of Os by genetic transformation. (f) Grain shape in transgenic plants compared to control grains. Scale bar, 5 mm. (g) Comparison of grain length between transgenic plants and control. Data represent mean ± S.E.M. (n = 30). Student's t‐tests were used to generate P values.
Identification of Os by association mapping. (a) Manhattan plot for candidate region association mapping of . The two red vertical lines indicate the boundaries of . (b) Gene structure of Os03g0215400. Empty boxes refer to 5′ and 3′‐UTRs, grey boxes are exons, and lines between boxes are introns. The variations (TCCTTGGTGAAGGTA → ATGT ‐ ‐ ATATATACT) in the Os03g0215400
are shown by dashed lines. (c) Structure of splicing site and mutation sites. Underlined nucleotides are the sequence of the first half of exons 8 in NIP; others are at the terminal of the intron 7. Snp1‐6, refer to six SNPs significantly associated with grain length (P < 1.0 × 10−8). In the schematic illustration of OsLG3b functional domains, SLG produced an alternatively spliced protein OsLG3b, in which the terminal 37 residues were truncated and additional 5 residues were added to the predicted C domain. (d) Genotyping analyses of cDNA fragment encoded by the SLG and NIP alleles in 18 rice cultivars. We designed a pair of primers (Table S11) to amplify a small cDNA sequence that contains the splicing mutation region and the PCR fragment of SLG had a 31 nucleotides deletion. Therefore, varieties with the SLG allele form 143‐bp PCR products and varieties with the NIP allele form 174‐bp PCR products. (e) Grains of 18 rice cultivars. (f, g) Functional validation of Os by genetic transformation. (f) Grain shape in transgenic plants compared to control grains. Scale bar, 5 mm. (g) Comparison of grain length between transgenic plants and control. Data represent mean ± S.E.M. (n = 30). Student's t‐tests were used to generate P values.To investigate functional variation, we sequenced OsLG3b and its upstream region in SLG (long grain) and NIP (short grain). Sequence comparison revealed no polymorphism in the promoter region, but there were 15 polymorphisms in the gene (both exons and introns), including four nucleotide substitutions in intron 1, three nucleotide substitutions at the start point of exon 8 and seven nucleotide substitutions and a 2‐bp deletion at the terminal of intron 7 (Figure 2b, c). These variations resulted in an alternative splicing event (AG/GT → AT/AC), and the splice site shifted to the 32nd nucleotide (AG/GC) of exon 8, introducing a premature stop codon and preventing transcription of a mature protein (Figure 2c and S8). The premature stop codon led to truncation of 32 amino acid residues, and the remaining portion of the protein consisted of a 225‐residue polypeptide (Figure S6). This result was validated by genotyping analyses of cDNA fragments encoded by the SLG and NIP alleles in 18 rice cultivars (Figure 2d, e). We also analysed the sequence of OsLG3b from IRAT109, a representative tropical japonica variety with long grain similar to SLG (Figure S7). Its sequence was identical to the SLG allele (Figures S6 and S8). These data indicated that the change in the coding region of OsLG3b was most likely responsible for the SLG grain phenotype.Given that the promoter sequences of OsLG3b in SLG and NIP were the same, to determine whether the OsLG3b gene underlies the QTL, we introduced SLG allele OsLG3b cDNA into NIP under the control of a CaMV35S promoter. The grain length was restored to the NIL‐SLG level in transgenic plants (T1 generation) (Figure 2f, g), indicating that the change in function of OsLG3b resulted in increased grain length.
Expression pattern of OsLG3b and its transcription activator activity
We searched the RiceExpression Profile Database (RiceXPro), the HANADB‐Os database and the eFP browser of rice microarray data (Arora et al., 2007; Hanada et al., 2007; Hruz et al., 2008) for OsLG3b expression data. Expression levels of OsLG3b in the inflorescence, lemma, palea, pistil and ovary were higher than in other tissues and organs at various developmental stages (Figure S9a, b). These results indicated that OsLG3b expression was higher during panicle and seed development than at other stages (Figure S9c, d). The gene was highly expressed in glume tissues and weakly expressed in other organs (Figure S9d). We also conducted an expression analysis of OsLG3b in Nipponbare. The results showed a higher transcriptional level of OsLG3b in developing panicles (Figure 3a). The results were consistent with previous conclusions that OsLG3b was involved in specifying the identities of lemma and palea (Khanday and Vijayraghavan, 2013; Prasad et al., 2001).
Figure 3
Expression pattern of Os and its transcription activator activity. (a) Quantitative RT‐PCR analysis of Os in different tissues of NIP. R, root; FL, flag leaf; LS, leaf sheath; S, stem; YP4, YP8, YP10, YP12 and YP18 represent young panicles with average lengths of 4, 8, 10, 12 and 18 cm, respectively. n = 3. Data are given as mean ± S.E.M. (b) Determination of the transcriptional activation domain in OsLG3b. The full‐length cDNA of OsLG3b and DNA fragments responsible for different truncated deletions from NIP and SLG were introduced into the pGBKT7 vector. BD represents GAL4 DNA binding domain. The empty pGBKT7 was the negative control. The numbers on the top of the panel indicate amino acid positions in the wild‐type Os gene. Brown, blue, yellow and red boxes depict the MADS, I, K, and C domains, respectively. (c) Transcription activity assay between OsLG3b
‐
and OsLG3b
‐
. Serial dilutions of 100–10−3 transformed yeast cells were grown on SD‐Trp/‐His/‐Ade medium.
Expression pattern of Os and its transcription activator activity. (a) Quantitative RT‐PCR analysis of Os in different tissues of NIP. R, root; FL, flag leaf; LS, leaf sheath; S, stem; YP4, YP8, YP10, YP12 and YP18 represent young panicles with average lengths of 4, 8, 10, 12 and 18 cm, respectively. n = 3. Data are given as mean ± S.E.M. (b) Determination of the transcriptional activation domain in OsLG3b. The full‐length cDNA of OsLG3b and DNA fragments responsible for different truncated deletions from NIP and SLG were introduced into the pGBKT7 vector. BD represents GAL4 DNA binding domain. The empty pGBKT7 was the negative control. The numbers on the top of the panel indicate amino acid positions in the wild‐type Os gene. Brown, blue, yellow and red boxes depict the MADS, I, K, and C domains, respectively. (c) Transcription activity assay between OsLG3b
‐
and OsLG3b
‐
. Serial dilutions of 100–10−3 transformed yeast cells were grown on SD‐Trp/‐His/‐Ade medium.OsLG3b/OsMADS1 is a MIKCC‐type MADS‐box transcription factor containing four domains (MADS‐box, I region, K‐box and C‐box) (Arora et al., 2007; Jeon et al., 2000). The activity of a series of truncations of OsLG3b was examined, and the results showed that the C‐box region of OsLG3b was sufficient to activate the reporter (Figure 3b). This indicated that the C‐terminal region of OsLG3b had transcriptional activation activity and that the N‐terminal region containing the MADS‐activabox had DNA binding activity, consistent with previous reports (Lim et al., 2000). However, the full‐length OsLG3b from both SLG and Nipponbare showed abolished transcriptional activation function in yeast cells, and mutants with deletions of the MADS domain from Nipponbare exhibited strong transcriptional tor functionality (Figure 3b, (1), (2) and (7)). That is, the transactivation domain of OsLG3b is presumably inhibited in its full‐length native form, implying a unique conformational regulation of the transcriptional activation domain (Qiao et al., 2016; Zhang et al., 2015). Although mutants with deletions of the C‐terminal end of the C domain (amino acids 225–257; Figure 3b, (5)) had no transcriptional activity, the C domain of SLG OsLG3b showed weaker transcriptional activity than that of Nipponbare OsLG3b (Figure 3b, (3) and (6) and Figure 3c). Thus, alternative splicing of OsLG3b influences the transcriptional activation capacity of the OsLG3b protein.
Targeted gene mutation of OsLG3b using a CRISPR‐Cas9 system
To further investigate the function of OsLG3b, we conducted targeted gene mutation of OsLG3b in rice using a CRISPR‐Cas9 system. Positive transgenic plants (T1 generation) were named RM23, RM25 and RM29 (Figure S10a‐c, h). The target sequence (5′‐AGATCAGGGTGACCATTCCC‐3′) was at sites +7569–+7570 within the seventh exon that encoded the C‐terminal of OsLG3b (amino acid residues 220–227). Sequencing analyses identified 2‐bp deletions (TC7568‐P7569, CA7569‐7570 and CA7569‐7570) in knockout lines. These deletions caused the frameshift mutation that resulted in differences in the C‐terminal of OsLG3b and consequent incomplete polypeptide that lacked OsLG3b function. Transgenic plants at the vegetative stage showed no visible differences from Nipponbare (Figure S10i). However, panicles of transgenic plants exhibited phenotypic differences, including spikelets consisting of elongated leafy paleae and lemmas with open hulls, and sharply decrease fertility (Figure S10d‐g). These results demonstrated that OsLG3b played an important role in floral organ development in rice, particularly in floral glume development (Prasad et al., 2005).
Hap‐SLG of OsLG3b/OsMADS1 appeared during tropical japonica improvement
On the basis of the four most significant SNPs (P < 1.0 × 10−12) identified by association mapping (Figure 2a), we divided the sequences from the cultivated varieties in the MCC (Table S5) into two haplotypes (Figure 4a) and determined whether accessions in the indica group and japonica groups with the haplotype Hap‐SLG showed longer grains than those with Hap‐NIP (Figure 4a, b).
Figure 4
The haplotypes and origin of Os. (a) Haplotype analysis of Os. Gene structure and natural variation between alleles from SLG and NIP (top). Natural variation in Os among 256 rice accessions on a mini‐core collection compared with the NILs (bottom). (b) Grain shape of accessions representing the two classes in MCC1. GL,grain length; GW, grain width; GT, grain thickness. Raw data are provided in Table S1; n, is the number of accessions. P‐values were generated by two‐tailed t‐tests. Error bars, S.E.M. (c) Geographic origin of accessions containing the Os
allele. Hap‐NIP and Hap‐SLG are represented by red and blue circles, respectively. Indica and japonica cultivars are denoted by dashed and solid circles, respectively. (d) Nucleotide diversity analysis in the Os region. Representative samples included 35 indica accessions, 30 temperate japonica accessions, 21 tropical japonica accessions and 10 wild rice accessions (Table S5). Tej, temperate japonica; trj, tropical japonica. Y‐axis, average π value; x‐axis, Nipponbare TIGR v7.0 genome coordinate of chromosome 3. (e) Average nucleotide diversity of the 20 kb surrounding Os. (f) A minimum‐spanning tree for the Os region including 504 diverse rice sequences and 10 diverse wild rice sequences. Each haplotype group is represented by a circle, and circle size represents the number of lines within the haplotype, as in Figure 4c. Orange, brown, yellow, red, blue and pink represent O. rufipogon from China, O. rufipogon from South‐East Asia, indica, tropical japonica, temperate japonica and temperate japonica with glutinous varieties from the Yunnan–Guizhou Plateau or mixtures with recently improved indica or tropical japonica. Red star corresponds to Os
.
The haplotypes and origin of Os. (a) Haplotype analysis of Os. Gene structure and natural variation between alleles from SLG and NIP (top). Natural variation in Os among 256 rice accessions on a mini‐core collection compared with the NILs (bottom). (b) Grain shape of accessions representing the two classes in MCC1. GL,grain length; GW, grain width; GT, grain thickness. Raw data are provided in Table S1; n, is the number of accessions. P‐values were generated by two‐tailed t‐tests. Error bars, S.E.M. (c) Geographic origin of accessions containing the Os
allele. Hap‐NIP and Hap‐SLG are represented by red and blue circles, respectively. Indica and japonica cultivars are denoted by dashed and solid circles, respectively. (d) Nucleotide diversity analysis in the Os region. Representative samples included 35 indica accessions, 30 temperate japonica accessions, 21 tropical japonica accessions and 10 wild rice accessions (Table S5). Tej, temperate japonica; trj, tropical japonica. Y‐axis, average π value; x‐axis, Nipponbare TIGR v7.0 genome coordinate of chromosome 3. (e) Average nucleotide diversity of the 20 kb surrounding Os. (f) A minimum‐spanning tree for the Os region including 504 diverse rice sequences and 10 diverse wild rice sequences. Each haplotype group is represented by a circle, and circle size represents the number of lines within the haplotype, as in Figure 4c. Orange, brown, yellow, red, blue and pink represent O. rufipogon from China, O. rufipogon from South‐East Asia, indica, tropical japonica, temperate japonica and temperate japonica with glutinous varieties from the Yunnan–Guizhou Plateau or mixtures with recently improved indica or tropical japonica. Red star corresponds to Os
.To understand the origins of the alleles, we sequenced the OsLG3b gene in 58 wild rice accessions, including 7 O. nivara and 51 O. rufipogon (Table S5). All wild accessions carried Hap‐NIP at the OsLG3b locus. From wild rice to O. sativa, almost all indica accessions and temperate japonica accessions had Hap‐NIP. Geographically, japonica accessions are mainly distributed in northern regions, whereas indica accessions are planted mainly in southern areas. Fourteen tropical japonica cultivars and two indica accessions with Hap‐SLG were distributed in tropical areas, such as Australia, Brazil, Ivory Coast, Nigeria and Indonesia. Another nine japonica samples which also had Hap‐SLG type were distributed on the Yunnan–Guizhou Plateau at higher elevations of the south‐east zone of Asia (Figure 4c). Within tropical japonica, four of five landrace accessions and four improved varieties were also Hap1 type, whereas up to 14 improved varieties contained Hap‐SLG type (Figure S11). Interestingly, a few recently improved indica and temperate japonica accessions also contained Hap‐SLG type. We produced a phylogenetic tree of the MCC population by cluster analysis using the STRUCTURE algorithm and found genomic segments of tropical japonica in those varieties (Table S5). These results suggest that Hap‐SLG type arises after domestication of tropical japonica and then spread to other group in breeding practice.We performed an analysis of nucleotide diversity for the OsLG3b region from 96 accessions (Table S5). A comparative analysis of the nucleotide diversity among wild rice, O. sativa (indica and temperate japonica), Hap‐NIP(Trj) and Hap‐SLG(Trj) accessions indicated that on average, Hap‐SLG(Trj) accessions exhibited much lower diversity (π = 0.00026) than Hap‐NIP(Trj) (π = 0.0040), O. sativa (π = 0.0028) and wild rice species (π = 0.0023) (Figure 4d). Significantly decreased diversity in Hap‐SLG(TRJ) cultivars could be a result of artificial selection (Nielsen et al., 2007; Oleksyk et al., 2010). In addition, we calculated the nucleotide diversity of the OsLG3b flanking regions. As expected, we found that the average nucleotide diversity in 20‐kb flanking regions in Hap‐SLG(Trj) cultivars (π = 0.0004) was much lower than those of all other groups (π = 0.0057 for Hap‐NIP(Trj); π = 0.0020 for O. sativa; π = 0.0039 for wild rice) (Figure 4e). These observations indicate that the OsLG3b allele conferring long grains is selected during improvement of tropical japonica rice.To further investigate the evolution of OsLG3b, we increased the size of population for next analysis. Nineteen haplotypes from 504 cultivated rice (14 indica and 5 japonica haplotypes) and seven haplotypes from 15 wild rice accessions were identified. Two distinct groups, namely a cultivar haplotype cluster and a wild rice haplotype cluster were shown in a minimum‐spanning tree of these OsLG3b haplotypes (Figure 4f). Wild rice demonstrated haplotypes with small grain. Several Chinese Oryza rufipogonrice showed similar haplotypes to Hap‐NIP and these might be inherited to ancient japonica (Huang et al., 2012b). Almost all indica and temperate japonica haplotypes had the small grain allele of OsLG3b, indicating that the large‐grain haplotypes in tropical japonica might have occurred after domestication and increased in frequency during adaptation of japonica to tropical regions.
Effect of four‐gene combinations on grain length in natural rice varieties
We further examined haplotypes of OsLG3b, GS3, GW8 and TGW6 in 480 accessions to understand the genetic interaction between OsLG3b and other genes controlling grain length. We classified all varieties by the functional SNP (FNP) of OsLG3b, GS3, GW8 and TGW6. As shown in Figure 5a‐b, in the presence of the OsLG3b
allele, no significant difference was observed in the grain length between the groups containing the GS3/GW8 and gs3/gw8 alleles, respectively. This implied that the OsLG3b
allele had an epistatic effect on grain length for GS3 and GW8. Nevertheless, there was no evidence of interaction between OsLG3b and TGW6 (Figure 5c). These results showed that some of these genes might synergistically determine grain length (Table S5). As shown in Figure 5d, landraces and breeding varieties in indica were clearly distinguished due to improved grain length, however, that mixed together well in japonica (Figure 5d). This implied that grain length was widely meliorated in indica, whereas there was considerable scope for improving grain length in temperate japonica. However, in the indica and temperate japonica group, a few improved varieties had significantly longer grain that might be attributable to introgression of the beneficial OsLG3b allele (Figure 5d, e), suggesting that OsLG3b might be potential resource for improving grain length in rice breeding.
Figure 5
Genetic interactions between Os and other grain length‐related genes based on diverse germplasm and breeding improvement of Os. Box plot and kernel density plots were generated as violin plots for different groups. (a–c) Relationship between Os and other grain size–related genes, including (a), (b), and (c). Os
and Oslg3b
refer to the SLG allele and NIP allele of Os, respectively. The violin map was constructed in R. Different letters above columns indicate statistically significant differences between groups (Tukey's honestly significant difference (HSD) test, P < 0.05). Landraces, genotypes and phenotypes are listed in Table S5. (d) Phylogenetic analysis of four grain length‐related genes in 480 accessions. The phylogenetic tree of 480 varieties was constructed based on different functional SNPs or indels (listed in Table S5) by MEGA 6.0. All varieties were categorized by allelic variations in the FNP of Os and . The small pentagram, circle, triangle and prism refer to the beneficial alleles of gs3, Os, and , respectively. Gainsboro lines refer to landrace varieties and green lines to improved varieties. Different colours reflect the different subgroups, with abbreviations as in Figure 4. (e) Improvement of haplotypes combinations of four grain length‐related genes, as in Figure 5d. Top numbers indicate average grain length; bottom numbers correspond to accession number with a haplotype combination in that subgroup.
Genetic interactions between Os and other grain length‐related genes based on diverse germplasm and breeding improvement of Os. Box plot and kernel density plots were generated as violin plots for different groups. (a–c) Relationship between Os and other grain size–related genes, including (a), (b), and (c). Os
and Oslg3b
refer to the SLG allele and NIP allele of Os, respectively. The violin map was constructed in R. Different letters above columns indicate statistically significant differences between groups (Tukey's honestly significant difference (HSD) test, P < 0.05). Landraces, genotypes and phenotypes are listed in Table S5. (d) Phylogenetic analysis of four grain length‐related genes in 480 accessions. The phylogenetic tree of 480 varieties was constructed based on different functional SNPs or indels (listed in Table S5) by MEGA 6.0. All varieties were categorized by allelic variations in the FNP of Os and . The small pentagram, circle, triangle and prism refer to the beneficial alleles of gs3, Os, and , respectively. Gainsboro lines refer to landrace varieties and green lines to improved varieties. Different colours reflect the different subgroups, with abbreviations as in Figure 4. (e) Improvement of haplotypes combinations of four grain length‐related genes, as in Figure 5d. Top numbers indicate average grain length; bottom numbers correspond to accession number with a haplotype combination in that subgroup.
Introgression of the tropical japonica allele of OsLG3b into indica and temperate japonica
We found that a few indica and temperate japonica varieties had the same large‐grain haplotype of OsLG3b as tropical japonica (Table S5). To determine if these accessions were the result of introgression across varietal groups, we conducted an analysis of introgressed regions. We chose Nipponbare (the reference temperate japonica), 9311 (the reference indica) and AZUCENA (a typical tropical japonica landrace) as reference sequences for subsequent genotyping analyses. Three indica and thirteen temperate japonica lines with the OsLG3b
allele were then subjected to genotyping based on fourteen markers in the 5.0‐ to 7.0‐Mb region of chromosome 3. We found that all of them had a small chromosomal segment identical to that in the genomes of the tropical japonica. This implied that genomic regions (minimum length of ~300 kb) containing the OsLG3b
gene from tropical japonica had been introgressed into the genome of indica and temperate japonica varieties (Figure 6a). Therefore, the OsLG3b
allele might have been transferred from tropical japonica to indica or temperate japonica by introgression. To further clarify these events, 39 SNPs in the proximal region of the OsLG3b gene were examined. Although the accessions belonged to the indica and temperate japonica groups, the SNP pattern around OsLG3b was similar to the tropical japonica type (Tables S5 and S10). We also manually examined the patterns of 39 SNPs in representative wild rice accessions (Xu et al., 2012), and we found that eight of them were more similar to the indica, whereas others were more similar to the temperate japonica (Table S10). All were less similar to the tropical japonica than to indica and temperate japonica rice (Figure S13). These results showed that the OsLG3b
allele originated in a tropical japonica line and spread to indica and temperate japonica by natural crossing and artificial selection.
Figure 6
Analysis of introgressed regions and application of Os in breeding. (a) Introgression of the tropical japonica allele of Os into indica and temperate japonica. Fourteen sequential markers in the 5.0‐ to 7.0‐Mb region of chromosome 3 were constructed at approximately 0.2‐Mb intervals. Three indica and thirteen temperate japonica lines with the SLG‐type Os were sequenced at these markers with AZUCENA (representative tropical japonica), ‘Nipponbare’ (temperate japonica) and 93‐11 (indica) as reference sequences. Yellow, blue and red bars indicate tropical japonica, temperate japonica and indica type genotypes, respectively. Trj/Tej/I‐SLG, tropical/temperate japonica/indica accessions with the SLG‐type Os; Tej/I‐Nip, temperate japonica/indica accessions with the Nipponbare‐type Os. The marker at 6.05 Mb was the closest to Os. (b‐d) The pedigree of selected rice varieties. (b) Yunguang 8, (c) Tianyou 3301 and (d) Handao 502. The red star, yellow dot, blue triangle and purple prism refer the beneficial allele of gs3, Os, and respectively.
Analysis of introgressed regions and application of Os in breeding. (a) Introgression of the tropical japonica allele of Os into indica and temperate japonica. Fourteen sequential markers in the 5.0‐ to 7.0‐Mb region of chromosome 3 were constructed at approximately 0.2‐Mb intervals. Three indica and thirteen temperate japonica lines with the SLG‐type Os were sequenced at these markers with AZUCENA (representative tropical japonica), ‘Nipponbare’ (temperate japonica) and 93‐11 (indica) as reference sequences. Yellow, blue and red bars indicate tropical japonica, temperate japonica and indica type genotypes, respectively. Trj/Tej/I‐SLG, tropical/temperate japonica/indica accessions with the SLG‐type Os; Tej/I‐Nip, temperate japonica/indica accessions with the Nipponbare‐type Os. The marker at 6.05 Mb was the closest to Os. (b‐d) The pedigree of selected rice varieties. (b) Yunguang 8, (c) Tianyou 3301 and (d) Handao 502. The red star, yellow dot, blue triangle and purple prism refer the beneficial allele of gs3, Os, and respectively.
Discussion
Alternative splicing of OsLG3b/OsMADS1 arose during improvement of tropical japonica
We show that an alternative splicing of OsLG3b endows tropical japonica rice with large grain and that a mutation in the coding region of OsLG3b was fixed in tropical japonica cultivars. O. rufipogon, a type of wild rice, is recognized as the direct progenitor of cultivated rice based on a comprehensive data set obtained from genomic sequences of 446 geographically diverse wild rice accessions and 1,083 cultivated indica and japonica varieties (Huang et al., 2012b). However, our evolutionary analyses based on abundant SNPs from cultivated and wild rice further demonstrated that the alternative splicing allele might have arisen after domestication. Further introgression analysis showed that the alternative splicing allele originated in the tropical japonica and was subject to strong human selection during improvement of tropical japonica (Tajima D = −1.80, P < 0.05; MLHKA = 0.007), similar to the events relating to the GS3 gene for tropical japonica improvement (Takano‐Kai et al., 2009).
OsLG3b encodes a MIKCC‐type MADS‐box transcription factor involved in regulation of grain length and weight
MIKCC‐type MADS‐box genes play a very important role in plant growth and development, such as control of flowering time, regulation of root, leaf, ovule and fruit development, and especially determination of floral meristem and floral organ traits (Ferrario et al., 2006; Komiya et al., 2009; Lee et al., 2008; Mara and Irish, 2008; Moyle et al., 2005; Prasad et al., 2001, 2005; Zhang et al., 2008). There are 38 MIKCC‐type genes in rice, of which OsMADS1, OsMADS5, OsMADS7, OsMADS8 and OsMADS34 belong to the E class. Prasad et al. (2005) showed that OsMADS1 was an early‐stage regulatory factor of inner floral organs, and controlled differentiation of specific cell types in the lemma and palea. In a loss‐of‐function mutant of OsMADS1, the glume, stamens and carpels were transformed into hull or glume structures, and the determinacy of the floral meristem was lost (Agrawal et al., 2005; Jeon et al., 2000; Khanday and Vijayraghavan, 2013; Liu et al., 2016; Prasad et al., 2005; Wang et al., 2010). In this study, OsLG3b was cloned by a forward genetics method, and functional natural variation was identified using broad germplasm resources. OsLG3b was annotated as a MIKCC‐type MADS‐box transcription factor 1. Sequence analysis revealed that nucleotide substitutions in exon 8 resulted in alternative splicing and a truncated protein at the C terminus, which was retained in domestication of tropical japonica. These natural variations do not occur in the MADS‐box and K‐box conserved domains where mutation would likely lead to severe defective phenotypes. The natural variations resulted in increased grain length and grain thickness with potential value in breeding for improved yield.
Molecular improvement of grain length and weight in rice
Grain size has played an important part in the evolution and improvement of rice (Kovach et al., 2007). Breeders have made great progress in rice improvement and created abundant accessions with different grain lengths. It might be meaningful to lift the veil of molecular imprinting that traces to preference from artificial selection. Distinct genes have been selected in two subpopulations for improving grain length and weight (Figure 5d). For this, we had note that some of the influences that worked on the selection might have come from the geographical distribution pattern, time of occurrence of mutation, preference of local people and effect of the gene itself. For example, the mutant allele of GS3 had been proved to be origin from tropical japonica (Wang et al., 2011) and arose during improvement of indica varieties. This allele presumably resulted from introgression from either tropical japonica or indica by natural and artificial crossing (Figure 5d and Table S5). The mutant allele of GS3 had been widely applied in low latitude region because of its visual effect on grain length; however, it was rare in the northern temperate japonica subgroup, perhaps a result of the combined influence of the above‐mentioned four influences (Figure S14a, b and Table S5).It is interesting that GW8 and TGW6 seemingly could not alter grain length in our germplasm resources on account of a strong correlation between the distribution of their two alleles and population structure (Figure S14c‐f). This distribution pattern might be the reason that breeders did not recognize and utilize these genes. Whether in the temperate japonica or indica subgroups, from landraces to improved varieties, the GW8 allele was unchanged (Figure 5d). In our MCC panel, the beneficial allele of TGW6 only existed in a very small number of indica landraces, many of them with inferior yield characteristics, and the phenotypic effect on grain length was so small that it was not selected and used by breeders. Our findings suggest that there is still much potential for optimizing grain shape by marker‐assisted selection.
Application of OsLG3b in breeding
It is very difficult for rice breeders to improve yield and quality at the same time, because frequently grain yield is negatively correlated to grain quality. For example, although GW2, GS2, GW5 and GW8 increase rice production, they lead to bad quality. NIL(SLG) offers superior grain weight and grain yield. Here, we evaluated whether the SLG OsLG3b allele caused poor grain quality. Our results revealed that there was no significant difference between NIP and NIL(SLG) in percentage and degree of chalkiness. Both the NIP and NIL(SLG) endosperms comprised largely sharp‐edged and compactly arranged polygonal starch granules, which are quite often associated with a low level of grain chalkiness (Figure S15a‐j). The findings showed that OsLG3b effectively increased yield in rice, but did not affect quality.The beneficial allele of OsLG3b likely spread into some indica and temperate japonica varieties by repeated introgressions, probably through natural crosses and artificial selection (Figure 6a and Figure S14g, h). Yunguang 8 is an elite variety widely grown in Yunnan province. According to the pedigree records, its parents are the Yunhui11 and Nongken58S (Figure 6b). A resequencing study showed that Yunguang 8 carried the OsLG3b
and the gw8
allele (Figure 6b). Thus, combination of the OsLG3b
and gw8
alleles provides a good example that can be followed by breeders to simultaneously improve yield and grain quality over current levels. Moreover, Tianyou 3301, a well‐known super rice, represents another practical example of combining the OsLG3b
and gs3 alleles and alleles for other unidentified yield‐related genes. There are also many other breeding examples (e.g. Handao502, an elite upland rice) (Figure 6d). Our results strongly indicate that the route of varietal improvement will be revealed by molecular imprinting. In turn, knowledge of molecular imprinting of grain and yield‐related alleles might help in breeding rice varieties with high yield and superior quality.
Experimental procedures
Plant materials and growing conditions
SLG‐1 (ssp. japonica) was screened from more than 7000 accessions and used as a donor of desirable alleles. Nipponbare (ssp. japonica) was selected as a recurrent parent. SLG was crossed with NIP to produce F1 plants, and that were subsequently backcrossed with NIP to produce 30 BC3F1 plants and 73 BC4F1 plants. Peak values for grain weight in BC3F1 plants were 27 g and 31 g, whereas there were four peak values among BC4F1 plants, 28 g, 30 g, 33 g and 38 g. The four BC4F1 plants at peak value were selfed to produce four BC4F2 populations for primary QTL mapping. Three BC4F3 populations for further QTL mapping were derived from BC4F2 plants lacking other large‐effect QTLs. Plant BC4F3‐78‐11 was crossed with NIP and then selfed to produce a BC5F2 population for fine mapping. All plant materials were grown under natural field conditions as described previously (Yu et al., 2017).
QTL mapping and fine mapping
MapMaker3.0 and IciMapping3.1 were used for genetic map construction and QTL analysis, respectively (Li et al., 2007). Composite interval mapping was applied with the LOD threshold 2.5. Fine mapping of qGL3‐2 was based on 6000 BC5F2 plants and 4100 BC5F2 plants. The relevant primer sequences are listed in Table S4 and S11.
Candidate region association mapping
The mini‐core collection panel was collected from 35 countries and had abundant diversity. A generalized linear model (GLM) method, taking account of population structure (Q), was used to perform regional association mapping. The Q matrix was estimated by STRUCTURE 2.0. Statistical analyses for LD and association were carried out using TASSEL, version 4.0.
Vector construction and rice transformation
To generate the overexpression vector, the ORF of OsLG3b was amplified from the cDNA of SLG and cloned into the pMDC32 vector. sgRNA‐Cas9 plant expression vectors were constructed as described previously (Mao et al., 2013). The primers used in vector construction are listed in Table S12. Two constructs were transformed to generate transgenic plants by Agrobacterium‐mediated transformation (Yu et al., 2017).
Transactivation activity assay
The cDNA of OsLG3b and DNA fragments responsible for different truncated deletions from NIP and SLG was introduced into the pGBKT7 vector. The vectors were then transformed into yeast strain AH109 and screened as described elsewhere (Yu et al., 2017). Relevant primer sequences are listed in Table S12.
Evolution analysis of OsLG3b
To investigate the domestication and improvement of OsLG3b, we conducted some population genetic analyses. A Perl script was employed to calculate the sequence diversity. Construction of a minimum‐spanning tree followed a described procedure (Liu et al., 2015). The neighbour‐joining tree was drawn by MEGA 6.0, and the number of bootstrap replicates was 1000 times. Presentation of the phylogenetic tree was guided by EvolView (Zhang et al., 2012a). Relevant landraces, phenotypes and polymorphism data are given in Table S5.
URLs
Gene annotation referred to RGAP (http://rice.plantbiology.msu.edu/). All SNP data were acquired from the Rice Functional Genomics and Breeding database (RFGB, http://www.rmbreeding.cn/Index/).
Competing interests
The authors declare that they have no competing interests.Figure S1 (a) Grains from 10 typical tropical japonica varieties (CH1027, CH1029, CH1067, CH1091, CH1083, CH1085, CH1086, CH1058, IRAT109 and Haogelao), and 10 typical temperate japonica varieties (CH1001, CH1002, CH1004, CH1008, CH1009, CH1010, CH1020, CH1026, CH1071, and Nipponbare) (Table S5).Figure S2 Graphic genotype of BC4F3‐78‐11.Figure S3 Field trial of NIP and NIL(SLG) plants.Figure S4 Geographic origins of 266 indica and japonica rice accessions.Figure S5 Frequency distribution of grain length in the mini core collection (MCC population) (Yu et al., 2017).Figure S6 Amino acid sequence alignment of OsLG3b from Nipponbare (Nip), SLG and IRAT109.Figure S7 Grains from SLG, Nipponbare, and IRAT109. Scale bar, 5 mm.Figure S8 cDNA sequence alignment of OsLG3b from Nipponbare (Nip), SLG and IRAT109.Figure S9 The temporal‐spatial expression pattern of OsLG3b.Figure S10 Phenotypic analysis of CRISPR‐OsLG3b transgenic plants.Figure S11 Genotypes of OsLG3b in tropical japonica and indica or temperate japonica admixed with tropical japonica between landraces and improved varieties.Figure S12 Histograms showing distribution of grain length, grain width, length: width ratio and grain weight in temperate japonica (Tej) and tropical japonica (Trj) accessions.Figure S13 Phylogenetic tree of the representative wild rice accessions and sixteen indica or temperate japonica lines with the OsLG3b
allele.Figure S14 Comparison of grain lengths in large‐grain and small‐grain haplotypes for GS3 (a), GW8 (c), TGW6 (e) and OsLG3b (g) when Q structure (sub1, indica; sub2, japonica) exists.Figure S15 OsLG3b does not affect grain quality.Table S1 Means differences for the selected grain traits identified with t tests between temperate japonica and tropical japonica.Table S2 Identification of QTLs related to grain length, grain width, grain thickness and grain weight.Table S3 Analysis of polymorphisms at function variations’ sites between Nipponbare and SLG.Table S4 Primers used for the genotyping of a near‐isogenic line for the qGL3‐2 locus.Table S5 Information of Orayza sativa L. varieties and wild rice on variety name, geographic source, stratification referred by STRUCTURE, the integrated stratification, grain lengths and allelic variations of grain‐length‐related genes.Table S6 Summary of the taxa and source of 506 varieties.Table S7 Environments used to evaluate association and linkage populations.Table S8 The heritability of grain traits in MCC Panel.Table S9 OsLG3b polymorphisms associated with grain length in the MCC panel.Table S10 Thirty‐nine SNPs in OsLG3b used in the introgression analysis.Table S11 Primers used for fine mapping and sequencing.Table S12 Primers used for DNA constructs and transcripts analysis.Click here for additional data file.Click here for additional data file.Click here for additional data file.Click here for additional data file.Click here for additional data file.Click here for additional data file.