| Literature DB >> 29449917 |
E Papadopoulou1, N Gale2, S A Goodchild3, D W Cleary3, S A Weller3, T Brown4, P N Bartlett1.
Abstract
Strain discrimination within genetically highly similar bacteria is critical for epidemiological studies and forensic applications. An electrochemically driven melting curve analysis monitored by SERS has been utilised to reliably discriminate strains of the bacterial pathogen Yersinia pestis, the causative agent of plague. DNA amplicons containing Variable Number Tandem Repeats (VNTRs) were generated from three strains of Y. pestis: CO92, Harbin 35 and Kim. These amplicons contained a 10 base pair VNTR repeated 6, 5, and 4 times in CO92, Harbin 35 and Kim respectively. The assay also included a blocker oligonucleotide comprising 3 repeats of the 10-mer VNTR sequence. The use of the blocker reduced the effective length of the target sequence available to bind to the surface bound probe and significantly improved the sensitivity of the discrimination. The results were consistent during three replicates that were carried out on different days, using different batches of PCR product and different SERS sphere segment void (SSV) substrate. This methodology which combines low cost, speed and sensitivity is a promising alternative to the time consuming current electrophoretic methods.Entities:
Year: 2015 PMID: 29449917 PMCID: PMC5701729 DOI: 10.1039/c4sc03084b
Source DB: PubMed Journal: Chem Sci ISSN: 2041-6520 Impact factor: 9.825
Fig. 1Schematic flow diagram of the SERS detection assay illustrating each operational step involved. First, the DNA is extracted from bacterial cultures and the amplified DNA product is used as a template to generate single stranded labelled DNA during asymmetric PCR. The step (ii) could be omitted for future assays as it is possible to perform asymmetric PCR on genomic DNA directly.31 The labelled target is then hybridized to surface bound probes in the presence of a blocker oligonucleotide. Following electrochemical analysis monitored by SERS the pathogenic strains can be discriminated on the basis of the differences in their melting potential.
Melting potentials (vs. Ag/AgCl) and dE values for CO92 (6 repeat units), Harbin 35 (5 repeat units), Kim (4 repeat units) hybridised to probe-2 in the presence of a blocker oligonucleotide, determined from the global fitting of the three data set collected for each amplicon to eqn (1)
| CO92 | Harbin 35 | Kim | |
|
| –0.974 ± 0.002 | –0.944 ± 0.003 | –0.919 ± 0.003 |
| d | 0.039 ± 0.003 | 0.040 ± 0.002 | 0.033 ± 0.002 |
Oligonucleotide sequences (5′–3′) showing the PCR fragments for the three bacterial strains, probe 1 and 2 and blocker oligonucleotide combined with probe 2. Forward primer sequences are shown on the amplicons in bold and reverse primers were the reverse complements of the sequences in bold and underlined, for both assays. The positions where the repeat units differ in terms of additional nucleotide polymorphisms are underlined. H = hexaethylene glycol, X = dithiol
| Assay combined with probe-1 | |
| CO92 | CCTATACCGCTACGATCAGCCTCTATCGCCAAT |
| Harbin35 | CCGTTACCGCTACGATCAGCCTCTATCGCCAAT |
| Kim | CTCGTTACCGCTACGATCAGCCTCTATCGCCAAT |
| Probe-1 | GGTGATAGTC-GGTGATAGTC-GGTGATAGTC-GGTGATAGTT-GGTGATAGTT-GGTGATAGTC-HXXX |
| Assay combined with probe-2 | |
| CO92 | TGATATTTGG |
| Harbin35 | T |
| Kim | TCTGATATTTGG |
| Probe-2 | GACTATCACC-GACTATCACC-GACTATCACC-AACTAC-HXXX |
| Blocker | TATCGCCAATCACTATCATCAACCATC-AACGACTATCACC-AACTATCACC-AACTATCACC |
Fig. 2(a) Schematic representation of the PCR amplicons hybridised to the immobilised on the SSV substrate probe-1. The darker lines illustrate the position of the one base difference (a G-C bp is replaced by an A-T bp) in the two 10 bp repeat units compared to the rest of the units. (b) SERS of Texas Red for the PCR fragment from CO92 bacterial strain hybridised to probe-1. The spectra have been reported at different applied potentials vs. Ag/AgCl as shown in the figure. Spectra were acquired with 633 nm excitation laser and have been background subtracted and normalised with respect to the laser power and accumulation time. (c) E-melting curves from CO92 (6 repeat units), Harbin 35 (5 repeat units), and Kim (4 repeat units) hybridized to probe-1. Each set of data was fitted to eqn (1). The potential was swept at a scan rate of 0.7 mV s–1 in 10 mM Tris buffer (pH 7.2) containing 1 M NaCl.
Fig. 3(a) Schematic representation illustrating the hybridization order for CO92 (6 repeat units), to probe-2 in the presence of a blocker oligonucleotide. The 3′ end of the blocker oligonucleotide (red) is composed of three repeat units, two of them have one base difference compared to the third (illustrated by the use of darker lines), followed by a 30 bases anchor at the 5′ end. The 3′ end of the probe (green) is modified with three dithiol and a hexaethylene glycol linker, and is composed of a 6 bases anchor followed by three repeat units. The blocker oligonucleotide (red) is hybridized to the DNA target prior to the surface immobilised probe-2. (b) Binding of the CO92, Harbin 35 and Kim amplicons to probe-2. (c) Solid lines represent the E-melting curves and dotted lines the 95% confidence limits, from CO92 (6 repeat units), Harbin 35 (5 repeat units), Kim (4 repeat units) hybridized to probe-2. The potential was swept at a scan rate of 0.7 mV s–1 in 10 mM Tris buffer (pH 7.2) containing 1 M NaCl.