| Literature DB >> 29449804 |
Juan P Grosso1,2, Jesica A Barneto3,4, Rodrigo A Velarde1,2, Eduardo A Pagano3,4, Jorge A Zavala3,4, Walter M Farina1,2.
Abstract
The effect of early experiences on the brain during a sensitive period exerts a long-lasting influence on the mature individual. Despite behavioral and neural plasticity caused by early experiences having been reported in the honeybee Apis mellifera, the presence of a sensitive period in which associative experiences lead to pronounced modifications in the adult nervous system is still unclear. Laboratory-reared bees were fed with scented food within specific temporal windows and were assessed for memory retention, in the regulation of gene expression related to the synaptic formation and in the olfactory perception of their antennae at 17 days of age. Bees were able to retain a food-odor association acquired 5-8 days after emergence, but not before, and showed better retention than those exposed to an odor at 9-12 days. In the brain, the odor-rewarded experiences that occurred at 5-8 days of age boosted the expression levels of the cell adhesion proteins neurexin 1 (Nrx1) and neuroligin 2 (Nlg2) involved in synaptic strength. At the antennae, the experiences increased the electrical response to a novel odor but not to the one experienced. Therefore, a sensitive period that induces long-lasting behavioral, functional and structural changes is found in adult honeybees.Entities:
Keywords: behavior; neurobiology; plasticity; sensitive period; social insect
Year: 2018 PMID: 29449804 PMCID: PMC5799231 DOI: 10.3389/fnbeh.2018.00011
Source DB: PubMed Journal: Front Behav Neurosci ISSN: 1662-5153 Impact factor: 3.558
Figure 1(A) Schematic schedule of the experimental series along the adult lifespan of the honeybee. Caged bees reared throughout their adult lifespan in incubators were fed 1-HEXANOL (1-HEX) scented sugar solution during four consecutive days (gray boxes), while the rest of the experimental period were fed unscented sugar solution. At 17 days of age (black arrow) behavioral and neurobiological variables were tested. This determines the following treatments: control group, bees were fed unscented solution during the whole experimental period of 17 days; D1–4 group, bees were fed 1-HEX sucrose solution only between the first and fourth days; D5–8 group, bees were fed 1-HEX sucrose solution only between the fifth and eighth days; D9–12 group, bees were fed 1-HEX sucrose solution only between the ninth and twelfth days. (B) Proboscis extension response (PER) to the early experienced odor (1-HEX) and to a novel odor (NONA) in bees of 17-days of age that underwent a controlled odor-rewarded experience at specific adult age periods. Significant differences in PER values compared to control with odor (1-HEX) are labeled with **Pr(>|z|) < 0.01 and ***Pr(>|z|) < 0.005 and within the same treatment is labeled with *Pr(>|z|) < 0.05 (Generalized Linear Mixed Model, GLMM test). The number of observations (bees from that treatment) is shown between brackets.
Primers models, amplified size product and annealing temperature for the constitutive gene (Rpl8) as well as for neurexin 1 (Nrx1) and neuroligins 2–5 (Nlg 2, Nlg 3, Nlg 4 and Nlg 5).
| Primer | Sequence (5′to 3′) | Product size (MW) | Annealing (°C) |
|---|---|---|---|
| F: CACACGGTGGTGGTAATCAT | 114 pb | 56 | |
| R: CTCGGATTCTTCCTGTACGA | |||
| F: GGTGTTCCTCCTCGTGCTCAA | 68 pb | 59 | |
| R: ACGAGTTCCTGTCCCTCTGGTA | |||
| F: CATAGAGCTCAAGTCGAAACTGAA | 124 pb | 56 | |
| R: GAGAAGATGATGCGATCTAGGAA | |||
| F: CTTCCTGATTCTCGTCTGTCTGA | 71 pb | 56 | |
| R: GTGGATTCAGCTTGCTCTTGA | |||
| F: GGTTGTATTCTGTTGGTGCTCAATA | 67 pb | 55 | |
| R: TGTCTCGATCCCTCTGATAGTAAA | |||
| F: TCGAGTTCAAGACCGAGCA | 81 pb | 57 | |
| R: GCTTCGCCTCGAAGAAGTC |
These models were made up using the Primer 3 software. Their thermodynamics properties were evaluated with the Invitrogen Vector NTI Advance™ 10 software.
Figure 2Expression of Nlgs and Nrx1 in adult brains of bees of 17 days of age that underwent an early odor-rewarded experience during specific adult age periods. Expression of Nlg2–5 and Nrx1 in adult brain tissues between honeybees reared in cages fed 1-HEX-scented sucrose solution at 1–4, 5–8 or 9–12 days of age. The control group was fed unscented sucrose solution throughout the experimental period. Honeybee Nlg2–5 and Nrx1 expression were assessed by quantitative reverse transcription (RT) PCR amplification. The data are presented as fold change normalized to the endogenous reference gene Rpl8: mean values (± standard error). Nlg2, neuroligin 2; Nlg3, neuroligin 3; Nlg4, neuroligin 4; Nlg5, neuroligin 5; Nrx 1, neurexin 1. The number of brain pools is shown in brackets. Asterisks for D5–8 show significant differences between treatments (MANOVA p = 0.002, Pillai). Symbols on bars show differences from individual ANOVAs for Nrx1 (p = 0.0003), Nlg2 (p = 0.0018) and Nlg4 (p = 0.055): ***P < 0.001, **P < 0.005, #P < 0.10.
Figure 3Electrical recordings of antennae from bees of 17 days of age that underwent a controlled odor-rewarded experience at different adult age periods. Mean values (± standard error) of electrical recordings of antennae of bees with (orange, light blue and green bars) and without (red bars) odor-rewarded experiences. Treated bees were fed 1-HEX-scented food at 1–4, 5–8 or 9–12 days of age and control bees fed unscented food. Three different concentrations of 1-HEX and NONA were tested. Letters indicate statistical differences in a Tukey of a linear mixed model (different letters indicate at least P < 0.05). The number of recordings per treatment is shown between brackets.