| Literature DB >> 29443061 |
Melanie K B Wills1, Andrea M Kirby1, Vett K Lloyd2.
Abstract
Lyme disease is a serious vector-borne infection that is caused by the Borrelia burgdorferi sensu lato family of spirochetes, which are transmitted to humans through the bite of infected Ixodes ticks. The primary etiological agent in North America is Borrelia burgdorferi sensu stricto. As geographic risk regions expand, it is prudent to support robust surveillance programs that can measure tick infection rates, and communicate findings to clinicians, veterinarians, and the general public. The molecular technique of nested polymerase chain reaction (nPCR) has long been used for this purpose, and it remains a central, inexpensive, and robust approach in the detection of Borrelia in both ticks and wildlife. This article demonstrates the application of nPCR to tick DNA extracts to identify infected specimens. Two independent B. burgdorferi targets, genes encoding Flagellin B (FlaB) and Outer surface protein A (OspA), have been used extensively with this technique. The protocol involves tick collection, DNA extraction, and then an initial round of PCR to detect each of the two Borrelia-specific loci. Subsequent polymerase chain reaction (PCR) uses the product of the first reaction as a new template to generate smaller, internal amplification fragments. The nested approach improves upon both the specificity and sensitivity of conventional PCR. A tick is considered positive for the pathogen when inner amplicons from both Borrelia genes can be detected by agarose gel electrophoresis.Entities:
Mesh:
Year: 2018 PMID: 29443061 PMCID: PMC5912355 DOI: 10.3791/56471
Source DB: PubMed Journal: J Vis Exp ISSN: 1940-087X Impact factor: 1.355


|
|
|
|
|
|
| FlaB Out Fw | FlaB | gcatcactttcagggtctca | 503 bp | 55°C |
| FlaB Out Rv | FlaB | tggggaacttgattagcctg | ||
| FlaB In Fw | FlaB | ctttaagagttcatgttggag | 447 bp | 58°C |
| FlaB In Rv | FlaB | tcattgccattgcagattgt | ||
| OspA Out Fw | OspA | cttgaagttttcaaagaagat | 487 bp | 55°C |
| OspA Out Rv | OspA | caactgctgacccctctaat | ||
| OspA In Fw | OspA | acaagagcagacggaaccag | 350 bp | 58°C |
| OspA In Rv | OspA | ttggtgccatttgagtcgta |
| Taq Polymerase Master Mix 2X | 12.5 µL | 12.5 µL |
| Nuclease-free Water | 8.5 µL | 8.5 µL |
| 10 µM Forward and Reverse primers | 1.0 µL Outer Primers | 1.0 µL Inner Primers |
| DNA Template | 2.0 µL, from sample extraction (1.2.7) | 2.0 µL, from round 1 of PCR (2.2.2) |