| Literature DB >> 29443016 |
Maria Cuenca Cambronero1, Luisa Orsini2.
Abstract
Long-term studies enable the identification of eco-evolutionary processes that occur over extended time periods. In addition, they provide key empirical data that may be used in predictive modelling to forecast evolutionary responses of natural ecosystems to future environmental changes. However, excluding a few exceptional cases, long-term studies are scarce because of logistic difficulties associated with accessing temporal samples. Temporal dynamics are frequently studied in the laboratory or in controlled mesocosm experiments with exceptional studies that reconstruct the evolution of natural populations in the wild. Here, a standard operating procedure (SOP) is provided to revive or resurrect dormant Daphnia magna, a widespread zooplankton keystone species in aquatic ecosystems, to dramatically advance the state-of-the-art longitudinal data collection in natural systems. The field of Resurrection Ecology was defined in 1999 by Kerfoot and co-workers, even though the first attempts at hatching diapausing zooplankton eggs date back to the late 1980s. Since Kerfoot's seminal paper, the methodology of resurrecting zooplankton species has been increasingly frequently applied, though propagated among laboratories only via direct knowledge transfer. Here, an SOP is described that provides a step-by-step protocol on the practice of resurrecting dormant Daphnia magna eggs. Two key studies are provided in which the fitness response of resurrected Daphnia magna populations to warming is measured, capitalizing on the ability to study historical and modern populations in the same settings. Finally, the application of next generation sequencing technologies to revived or still dormant stages is discussed. These technologies provide unprecedented power in dissecting the processes and mechanisms of evolution if applied to populations that have experienced changes in selection pressure over time.Entities:
Mesh:
Year: 2018 PMID: 29443016 PMCID: PMC5908671 DOI: 10.3791/56637
Source DB: PubMed Journal: J Vis Exp ISSN: 1940-087X Impact factor: 1.355









|
|
|
|
|
|
|
|
| B008 | HQ234154 | 150–170 | F: TGGGATCACAACGTTACACAA | VIC | (TC)9 | 56 |
| R: GCTGCTCGAGTCCTGAAATC | ||||||
| B030 | HQ234160 | 154–172 | F: CCAGCACACAAAGACGAA | PET | (GA)11 | 56 |
| R: ACCATTTCTCTCCCCCAACT | ||||||
| B045 | HQ234168 | 118–126 | F: GCTCATCATCCCTCTGCTTC | NED | (TG)8 | 56 |
| R: ATAGTTTCAGCAACGCGTCA | ||||||
| B050 | HQ234170 | 234–248 | F: TTTCAAAAATCGCTCCCATC | 6FAM | (GAA)6 | 56 |
| R: TATGGCGTGGAATGTTTCAG | ||||||
| B064 | HQ234172 | 135–151 | F: CTCCTTAGCAACCGAATCCA | 6FAM | (TC)8 | 56 |
| R: CAAACGCGTTCGATTAAAGA | ||||||
| B074 | HQ234174 | 196–204 | F: TCTTTCAGCGCACAATGAAT | NED | (GT)9 | 56 |
| R: TGTGTTCCTTGTCAACTGTCG | ||||||
| B096 | HQ234181 | 234–240 | F: GGATCTGGCAGGAAGTGGTA | VIC | (AC)15 | 56 |
| R: TTGAACCACGTCGAGGATTT | ||||||
| B107 | HQ234184 | 250–274 | F: GGGGTGAAGCATCAAAGAAA | PET | (CT)8 | 56 |
| R: TGTGACCAGGATAAGAGAAGAGG |
|
| Df | F | P |
| Evolution (Pop) | 2 | 30.309 |
|
| Plasticity (Temp) | 1 | 531.546 |
|
| Evol. Plasticity (Pop x Temp) | 2 | 65.137 |
|
|
| Df | F | P |
| Evolution (Pop) | 2 | 2.234 | 0.1162 |
| Plasticity (Temp) | 1 | 2.679 | 0.1071 |
| Evol. Plasticity (Pop x Temp) | 2 | 1.8657 | 0.164 |
|
| Df | F | P |
| Evolution (Pop) | 2 | 1.8852 | 0.1633 |
| Plasticity (Temp) | 1 | 6.8934 |
|
| Evol. Plasticity (Pop x Temp) | 2 | 1.6511 | 0.203 |
|
| Df | F | P |
| Evolution (Pop) | 2 | 0.211 | 0.8106 |
| Plasticity (Temp) | 1 | 11.1361 |
|
| Evol. Plasticity (Pop x Temp) | 2 | 0.6586 | 0.5225 |
|
| Df | F | P |
| Evolution (Pop) | 2 | 0.7811 | 0.4637 |
| Plasticity (Temp) | 1 | 8.0764 |
|
| Evol. Plasticity (Pop x Temp) | 2 | 0.088 | 0.9159 |