Intestinal and hepatic glucuronidation by the UDP-glucuronosyltransferases (UGTs) greatly affect the bioavailability of phenolic compounds. UGT1A10 catalyzes glucuronidation reactions in the intestine, but not in the liver. Here, our aim was to develop selective, fluorescent substrates to easily elucidate UGT1A10 function. To this end, homology models were constructed and used to design new substrates, and subsequently, six novel C3-substituted (4-fluorophenyl, 4-hydroxyphenyl, 4-methoxyphenyl, 4-(dimethylamino)phenyl, 4-methylphenyl, or triazole) 7-hydroxycoumarin derivatives were synthesized from inexpensive starting materials. All tested compounds could be glucuronidated to nonfluorescent glucuronides by UGT1A10, four of them highly selectively by this enzyme. A new UGT1A10 mutant, 1A10-H210M, was prepared on the basis of the newly constructed model. Glucuronidation kinetics of the new compounds, in both wild-type and mutant UGT1A10 enzymes, revealed variable effects of the mutation. All six new C3-substituted 7-hydroxycoumarins were glucuronidated faster by human intestine than by liver microsomes, supporting the results obtained with recombinant UGTs. The most selective 4-(dimethylamino)phenyl and triazole C3-substituted 7-hydroxycoumarins could be very useful substrates in studying the function and expression of the human UGT1A10.
Intestinal and hepatic glucuronidation by the UDP-glucuronosyltransferases (UGTs) greatly affect the bioavailability of phenolic compounds. UGT1A10 catalyzes glucuronidation reactions in the intestine, but not in the liver. Here, our aim was to develop selective, fluorescent substrates to easily elucidate UGT1A10 function. To this end, homology models were constructed and used to design new substrates, and subsequently, six novel C3-substituted (4-fluorophenyl, 4-hydroxyphenyl, 4-methoxyphenyl, 4-(dimethylamino)phenyl, 4-methylphenyl, or triazole) 7-hydroxycoumarin derivatives were synthesized from inexpensive starting materials. All tested compounds could be glucuronidated to nonfluorescent glucuronides by UGT1A10, four of them highly selectively by this enzyme. A new UGT1A10 mutant, 1A10-H210M, was prepared on the basis of the newly constructed model. Glucuronidation kinetics of the new compounds, in both wild-type and mutant UGT1A10 enzymes, revealed variable effects of the mutation. All six new C3-substituted 7-hydroxycoumarins were glucuronidated faster by human intestine than by liver microsomes, supporting the results obtained with recombinant UGTs. The most selective 4-(dimethylamino)phenyl and triazole C3-substituted 7-hydroxycoumarins could be very useful substrates in studying the function and expression of the humanUGT1A10.
Entities:
Keywords:
7-hydroxycoumarin derivative; UDP-glucuronosyltransferase; drug metabolism; fluorescence; in silico
The extents of absorption
and first-pass metabolism in the intestine
and liver strongly affect the bioavailability of drugs and other orally
ingested xenobiotic compounds.[1,2] Although hepatic metabolism
is the major determinant of first-pass metabolism for most drugs,
intestinal metabolism is critical for the bioavailability of certain
compounds, particularly those that could be directly conjugated, like
phenols and flavonoids.[3−5] Such xenobiotics typically contain a nucleophilic
functional group, usually a hydroxyl group, that can accept an endogenous
conjugating moiety, particularly glucuronic acid or sulfone. More
rarely, the conjugating group is methyl, acetyl, or amino acid.[6]The UDP-glucuronosyltransferase enzymes
(UGTs, EC 2.4.1.17) catalyze
about 35% of the drug conjugation reactions and are abundantly expressed
among the intestinal conjugating enzymes.[4,5,7] They catalyze transfer of the glucuronic
acid moiety from UDP-glucuronic acid cofactor onto hydroxyl, amine,
carboxylic acid, thiol, or thioacid groups of the aglycone substrates,
reactions that are commonly called glucuronidation.[8] There is a significant difference in the expression profile
of individual UGTs between the intestine and liver.[9−11] While about
10 different UGTs are abundantly expressed in the liver, only UGT1A1,
UGT1A10, UGT2B7, and UGT2B17 are expressed in the small intestine
to significant amounts at the protein level.[10,12−14] Unfortunately, the high activity and importance of
the intestinal UGT1A10 was (and still is) often underestimated due
to common use of poorly active commercial UGT1A10.[13]UGT1A10 glucuronidates many drugs and xenobiotics.[13,15−17] Glucuronidation of estriol at the 3-OH and of estrone
could be used as a selective reaction for UGT1A10, but the measurements
require chromatographic separation of the resulting glucuronide from
the substrate.[16,18] Likewise, dopamine is a UGT1A10-selective
substrate, but its low affinity[19] has limited
its use to qualitative measurements only.[14] Accordingly, availability of more convenient marker substrates for
UGT1A10 would foster evaluation of glucuronidation reactions, particularly
if the assays were easy and fast to perform.The interactions
between substrates and xenobiotic metabolizing
enzymes are increasingly being studied by in silico modeling.[20−23] Currently, the lack of crystal structures of the N-terminal domain
of any mammalianUGT impedes the structure–activity relationship
and mechanistic studies. UDP-glucuronic acid binds at the C-terminal
domain, which is highly homologous among different UGTs and evolutionary
conserved. The structure of the latter domain has been solved by X-ray
crystallography.[24] However, that available
crystal structure does not provide sufficient data to predict binding
of acceptor substrates, e.g., a drug molecule, as substrates bind
to the N-terminal domain, which is more variable than the C-terminal
domain among UGT enzymes. In silico models for this domain were constructed
previously,[20,21] but we need better ones in order
to analyze substrate–enzyme interactions in UGTs at the atomic
level.The hydroxyl group at C7 on the coumarin scaffold renders
the compound
fluorescent and glucuronidation of this hydroxyl abolishes the fluorescence
(Figure ).[25] Substituents at positions such as C3 or C4 of
the coumarin do not quench the 7-hydroxycoumarin derivatives’
fluorescence but modify its intensity, depending on the substituent’s
chemical nature. The 7-hydroxyl group on coumarin is also a good functional
group for glucuronidation by many UGTs. Therefore, fluorescent 7-hydroxycoumarin
derivatives provide an opportunity to design novel fluorescent substrates
for UGTs using molecular modeling as the starting point.
Figure 1
Glucuronidation
of 7-hydroxycoumarin derivatives. Fluorescent 3-substituted
7-hydroxycoumarins are glucuronidated to nonfluorescent glucuronide
conjugates by UGT enzymes. The decrease in fluorescence can be measured
conveniently in different kinds of experimental setups.
Glucuronidation
of 7-hydroxycoumarin derivatives. Fluorescent 3-substituted
7-hydroxycoumarins are glucuronidated to nonfluorescent glucuronide
conjugates by UGT enzymes. The decrease in fluorescence can be measured
conveniently in different kinds of experimental setups.In this study, we first constructed homology models
for all the
humanUGT enzymes of subfamily 1A and used them to design fluorescent
7-hydroxycoumarin derivatives in silico. We then synthesized six compounds
and developed a convenient multiwell plate assay protocol, based on
fluorescence decrease, to test their glucuronidation rate. The results
led to the identification of several 3-substituted 7-hydroxycoumarins
as selective substrates for the humanUGT1A10. A UGT1A10 mutant was
prepared based on the model and as a test for it. Subsequently, glucuronidation
kinetic analyses of the 3-substituted 7-hydroxycoumarins, by wild-type
and mutant UGT1A10, were carried out using the same multiwell plate
assay protocol.
Experimental Section
Materials
Alamethicin,
trichloroacetic acid, UDPGAsodium salt, 7-hydroxycoumarin (99%), 7-hydroxy-(4-trifluoromethyl)coumarin
(99%), and bovine serum albumin were from Sigma-Aldrich (Mannheim,
Germany). Formic acid (99%) and MgCl2 were from Riedel-de
Haen (Vantaa, Finland). Acetonitrile (Ultra gradient HPLC grade),
methanol (HPLC gradient grade), and glycine were from J.T. Baker (Deventer,
The Netherlands). Ethanol (≥99.5%, Etax Aa) was from Altia
(Helsinki, Finland). Water was deionized by Milli-Q gradient A10.
Modeling
To enable structure-based design of UGT1A10
selective substrates, all nine UGT1A-enzymes were modeled. Sequences
of humanUGT1A enzymes were gathered from the UniProt Knowledgebase
at www.uniprot.org (UniProt
Consortium, 2015). The accession codes for the retrieved UGT1As were:
Q9HAW8 (1A10), O60656 (1A9), Q9HAW9 (1A8), Q9HAW7 (1A7), P19224 (1A6),
P35504 (1A5), P22310 (1A4), P35503 (1A3), and P22039 (1A1). To identify
template protein structures for homology modeling purposes, the retrieved
UGT sequences were used in blast searches against the protein data
bank (PDB) structures. Based on the results of these searches, structures
2O6L,[24] 3HBF,[26] 3WC4,[27] and 2C1Z[28] were selected as templates for homology modeling. The sequence alignment
for the modeling was produced in two steps. First a protein structure-based
sequence alignment was derived for the selected four protein structures
by using Vertaa in BODIL[29] and the 2C1Z-structure
as a template, since it gave the best match for UGT1A10 and contained
both the N- and C-termini. In the second step the above listed nine
UGT1A sequences were aligned, using BODIL, against the structural
alignment, using STRMAT110 matrix[30] with
40 as the gap penalty. The alignment was adjusted for occasional variations
in sequence length and used to create models for each UGT1A as well
as in model construction that was performed using Modeler version
9.15.[31]
Molecular Docking
The ligands that were selected for
docking studies were prepared by using LigPrep (version 3.3, Schrödinger,
LLC, New York, 2015). The shapes and electrostatic properties of the
substrate binding sites of modeling-produced UGT1A enzymes were analyzed
with Panther,[32] and molecular docking was
performed with PLANTS.[33]
Synthesis
All the synthesis reactions were carried
out using commercial materials and reagents without further purification,
unless otherwise noted. Reaction mixtures were heated using the CEM
Discovery microwave apparatus. All reactions were monitored by thin-layer
chromatography (TLC) on silica gel plates. 1H NMR and 13C NMR data were recorded on a Bruker Avance 400 MHz spectrometer
or Bruker Avance III 300 MHz spectrometer. Chemical shifts are expressed
in parts per million values (ppm) and are designated as s (singlet),
br s (broad singlet), d (doublet), dd (double douplet), t (triplet).
Coupling constants (J) are expressed as values in
hertz (Hz). The mass spectra were recorded using Micromass LCT ESI-TOF
equipment. Elemental analyses were done with Elementar Vario EL III
elemental analyzer. All compounds tested present more than 95% purity.
General Procedure for the Synthesis of Coumarin Derivatives
The coumarin derivatives 1–6 were
synthesized using the Perkin-Oglialor condensation reaction (Scheme ). The method was
developed from the previously published procedures and transferred
to a microwave reactor.[34]
Scheme 1
General
Procedure for the Synthesis of Coumarin Derivatives
Typical procedure: A mixture of salicylaldehyde
derivative (2 mmol)
and phenyl acetic acid derivative (2.1 mmol), acetic acid anhydride
(0.6 mL), and triethylamine (0.36 mL) was placed in a microwave reactor
tube and heated at 100–170 °C in the microwave apparatus
for 10–20 min. After cooling, 2 mL of 10% NaHCO3 solution was added, and the precipitate was filtered, dried, and
recrystallized from EtOH/H2O or acetone/H2O
mixture. The acetyl group(s) were removed by treating the compound
with MeOH/NaOH(aq) solution for 30–60 min at rt. The solution
was acidified with HCl (aq), and the precipitate was filtered and
recrystallized if needed. Experimental data for 7-acetoxy-3-(4-fluorophenyl)-2H-chromen-2one, 7-hydroxy-3-(4-fluorophenyl)-2H-chromen-2-one (1), 7-acetoxy-3-(4-acetoxyphenyl)-2H-chromen-2one, 7-hydroxy-3-(4-hydroxyphenyl)-2H-chromen-2one (2), and 7-acetoxy-3-(4-methoxyphenyl)coumarin,
7-hydroxy-3-(4-methoxyphenyl)coumarin (3) were already
published elsewhere.[34]
Recombinant humanUGTs 1A1, 1A3,
1A6, 1A7, 1A8, 1A9, 1A10, 2A1, 2A2, 2A3, 2B4, 2B10, 2B7, and 2B17
were produced, as His-tagged proteins, in baculovirus-infected insect
cells as previously described.[37−39] The relative expression level
of each of these recombinant UGTs was evaluated by immunodetection,
using monoclonal antibody against the His-tag, as described elsewhere.[40] A numeric value of 1.0 was given to the expression
level of UGT1A8 and the relative expression level of each of the other
UGTs was related to this value. Normalized activities were obtained
by dividing the glucuronidation rate values by the relative expression
level of the tested UGT. In addition, UGTs 1A4, 2B10, and 2B15 were
purchased from Corning Life Sciences (New York) and are marked, in Figure , with a “C”
to indicate that they are commercial enzymes. The expression levels
of the UGTs in the commercial samples could not be determined, so
their protein concentration was used to calculate the reaction rate.
Figure 5
Glucuronidation
of C3-substituted 7-hydroxycoumarins by human UGTs.
Glucuronidation was determined at 10 μM aglycone concentration.
A commercial HLM pool (cat no:452210, BD Gentest, Bedford, MA)
and human intestine microsomes (HIM) pool (lot. no 1110189, XenoTech,
Kansas City, KS) were purchased. Pig liver samples were prepared from
untreated female pigs that were used for practicing surgical procedures
at the University of Kuopio (currently: University of Eastern Finland,
Kuopio campus). Other animal liver microsomes were prepared as described
previously.[41] The Ethics Committee for
Animal Experiments, University of Kuopio, approved these experiments.
Mutagenesis of UGT1A10
The UGT1A10 mutant 1n class="Gene">A10-H210
M was prepared according to the QuikChange methodology, using the
cloned UGT1A10 in pFastBac[42] as a template
and the following two oligonucleotides:
1. 5′-ACTTTCAAGGAGAGAGTATGGAACATGATCGTGCACTTGGAGGACCATTT-3′2. 5′- AAATGGTCCTCCAAGTGCACGATCATGTTCCATACTCTCTCCTTGAAAGT-3′The entire coding sequence of UGT1A10 in the mutant clone was sequenced,
and subsequently, recombinant baculovirus was prepared and used to
express the mutant enzyme inbaculovirus-infectedSF9 insect cells.
Absorbance and Fluorescence Spectra of C3-Substituted 7-Coumarins
The absorbance spectra of 10 μM coumarin derivatives at 100
mM Tris–HCl pH 7.4 containing 10% dimethyl sulfoxide were measured
using a Hitachi U-2000 Spectrophotometer (Tokyo, Japan). Excitation
and emission fluorescence spectra of 0.1 μM coumarin derivatives
in 100 mM Tris-HCl pH 7.4 were measured using a Shimadzu RF-5000 spectrophotofluorometer
(Tokyo, Japan). The excitation spectra was from 200 to 420 at 460
nm emission and the emission spectra was from 400 to 600 at 390 nm
excitation (data in Supplementary Table S1 and Figures S1 and S2). The effect of pH on fluorescence intensity
was determined at 405 nm excitation and 460 nm emission, in the presence
of 1.5% trichloroacetic acid, 100 mM phosphate buffers at pH 5, 6,
7, 8, and 9, or 1.6 M glycine–NaOH pH 10.4.
Glucuronidation
Reactions
The incubation mixtures for
glucuronidation assays contained 100 mM Tris-HCl buffer pH 7.4, 2.5
mM MgCl2, 0.5 mM UDPGA, recombinant UGT, or microsomes
as the enzyme source and 0–15 μM of the test aglycone
substrate. When the incubation mixtures contained microsomes, alamethicin
was used at a final concentration of 12.5 μg/mL, but it was
not included in the recombinant enzyme assays.[43] In the first experiments three negative control samples
were tested, namely (i) without the substrate 7-hydroxycoumarin derivative,
(ii) without the cofactor UDPGA, or (iii) without the enzyme source.
In subsequent experiments, the control samples lacked the enzyme source
since it gave the highest fluorescence background. Preliminary experiments
were done under different conditions than most of the later assays,
namely in 2.5 mL of 100 mM phosphate buffer pH 7.4, containing 500
μg pig liver microsomes, 1.0 μM compound 6 and 0.5 mM UDPGA, at room temperature. Fluorescence spectra (excitation
200–420 nm; emission 400–600 nm) or fluorescence decrease
at 390 nm excitation and 460 nm emission, were measured in these preliminary
experiments, using a Shimadzu RF-5000 spectrophotofluorometer.Most of the glucuronidation assays were carried out in 96 multiwell
plate format, and incubations were carried out in 100 μL and
at 37 °C, in the presence of Tris–HCl buffer pH 7.4, UDPGA,
and the tested 7-hydroxycoumarin derivative, at the indicated concentrations.
Fluorescence decline in the multiwell plate experiments was monitored
every other minute, for 40 min, using an excitation filter at 405
nm and detection at 460 nm, in a Victor2 1420 Multilabel counter (PerkinElmer,
Life Sciences, Turku, Finland). The fluorescence values were transformed
into molarity using the aglycone substrates for making the respective
standard curves. Slopes of the substrate concentration decrease per
minute were calculated using linear regression analysis, in which
the linear part of the kinetic assay indicated the glucuronidation
rate. Enzyme catalyzed glucuronidation rate was calculated by subtracting
the blank value from the full reaction value. The intra-assay variability
of the kinetic assays was 6% when compound 6 was used
as the aglycone substrate. Kinetic analyses were also performed in
the same 96 multiwell plates format, with excitation filter at 405
nm and detection at 460 nm, using 6–8 different substrate concentrations
per substrate and two different protein concentrations for both the
wild-type and mutant UGT1A10. The higher concentrations, 13.5 mg/L
for UGT1A10 and 12.0 mg/L for the UGT1A10 mutant, were used when the
substrates were HFC, compounds 4 and 6,
whereas the lower protein concentrations, 6.75 and 6.0 mg/L for UGT1A10
and the mutant, respectively, were used when the substrates were compounds 1, 2, 3, and 5.In end-point determinations, the glucuronidation reactions were
stopped by the addition of 150 μL 1.6 M glycine-NaOH buffer,
pH 10.4, followed by fluorescence measurements at 405 nm excitation
and 460 nm emission. There was a good correlation between kinetic
and end-point assays (data not shown).
HPLC–MS Analysis
of 7-Hydroxy-3-triazolecoumarin Glucuronide
For further analysis
of 7-hydroxy-3-triazolecoumarin glucuronide,
10 μM of compound 6 were incubated in 100 μL
of 100 mM Tris–HCl pH 7.4 buffer containing 5 mM MgCl2, 1 mM UDPGA, and either 30–40 μg recombinant UGT, 30
μg HLM, or 20 μg HIM for 1 h at 37 C. The reactions were
stopped by the addition of 300 μL of methanol and centrifugation,
and then the supernatant was divided into two. One part, 100 μL
supernatant, was mixed with 150 μL of 1.6 M glycine–NaOH
pH 10.4 and subjected to fluorescence measurements as described above
for the 96-well plate. The other part, 250 μL supernatant, was
stored at −20 C until analysis by HPLC–MS.An
Agilent 1200 Series Rapid Resolution LC System (Agilent Technologies,
Waldbronn, Germany) was used for the chromatographic separation, equipped
with a reversed-phase C8 column (Brownlee Supra, 3 μm, 50 ×
2.1 mm, PerkinElmer). The mobile phases were (A) 0.1% aqueous formic
acid and (B) acetonitrile. A linear gradient from 10% to 90% B in
five min was applied, followed by one min isocratic elution with 90%
B and column re-equilibration, yielding a total analysis time of nine
min. The flow rate was 0.3 mL/min, injection volume 3 μL and
column oven temperature 30 °C. For the MS detection,
a Finnigan LTQ ion trap mass spectrometer (Thermo, San Jose, CA) was
used in the positive electrospray (ESI) mode. A divert valve was used
to direct eluent flow to the waste for 1 min at the beginning and
at the end of the gradient run. The MS analysis was carried out using
the following parameters: spray voltage 4 kV, sheath gas 30 (instrument
units), aux gas 15, sweep gas 3, capillary temperature 250 °C, capillary voltage 43 V, tube lens 100 V. The collision energy
used for MS/MS was 30 V. The acquired full scan MS range was m/z 60–600. Ions used for the detection
of the aglycone and glucuronide conjugate were m/z 230 [M + H]+ and m/z 406 [M + H + 176]+, respectively. Data was
acquired and processed using Xcalibur software package.
Results
Modeling
UGT1A Enzymes
Template structures for homology
modeling of the UGT enzymes of subfamily 1A were selected based on
sequence similarity using the blast option in Uniprot. Structures
that contained both the sugar–nucleotide cofactor and a small
aglycone molecule were beneficial for the model, and therefore, structures
(pdb-codes) 2C1Z/X, 2O6L, 3HBF, and 3WC4 were selected. The conserved
lipophilic region that spans the endoplasmic reticulum membrane and
ends in the “cytoplasmic tail” were excluded from the
model because the focus of the model construction was on the catalytic
site and its surrounding area. In addition, other structures outside
the catalytic site of the model, including loops and amino acid side
chain conformations, were not optimized. Optimizing effords were considered
detrimental for the quality of the models as the sequence similarity
between the templates and the UGT sequences was very low. In other
words, the models were not considered to be good enough for molecular
dynamics simulations in order to evaluate binding energy or other
kinetic parameters. On the other hand, an essential part of the model
building was to predict binding of the 7-hydroxycoumarin derivatives
so that glucuronidation will occur at the 7-hydroxyl group, and for
this purpose the models were adequate.The homology models were
used to design novel and UGT-selective fluorescent 7-hydroxycoumarin
substrate molecules, whose fluorescence will decrease upon glucuronidation
(Figure ). Docking
of the 7-hydroxycoumarin scaffolds (Figure A-C) into different UGT1A models yielded
several possible conformations. One of them oriented the 7-hydroxy
group toward the bound UDP-glucuronic acid (UDPGA) cofactor at the
catalytic site, and simultaneously, the coumarin core was optimally
placed into a nearby cavity in the catalytic site (Figure D). In our models, the coumarin
scaffold could be stabilized through its C2-carbonyl oxygen, accepting
a hydrogen bond from Q101 in UGT1A8 (Figure C), UGT1A9, and UGT1A10 (Figure A). Even stronger stabilizing
interactions could be formed between the coumarin carbonyl at C2 and
R102 of UGT1A6 (Figure C). On the other hand, D103 in UGT1A1 (Figure B), E104 in UGT1A3 and UGT1A4, or P101 in
UGT1A7, are not capable of forming similar stabilizing hydrogen bond
interactions at this site, suggesting that the coumarin core would
not be an optimal substrate for these UGTs. Furthermore, R103 of UGT1A7,
UGT1A8, and UGT1A9, counteracted the stabilizing interactions and
partially blocked the binding of the coumarin scaffold to these UGTs
due to its size (Figure C). Unlike significantly bulkier R103 of UGT1A8 (Figure C), the Q103 of UGT1A10 at
this site could donate a hydrogen bond to the oxygen at position 1
of the coumarin scaffold (Figure A).
Figure 2
Docking of 7-hydroxycoumarin and its derivatives into
the UGT1A10
model. (A) Molecular docking placed the 7-hydroxycoumarin with the
7-hydroxy facing the catalytic site formed by H37 and UDPGA, enabling
the glucuronidation reaction and the subsequent decrease in fluorescence.
(B) In UGT1A1, D103, and L106 are not capable of forming similar beneficial
interactions with the coumarin core as the UGT1A10 model. Although
N102 might be able to form beneficial interactions with certain compounds,
the cavity might not be large enough for more sizable substitutions
due to N102 and M213. (C) UGT1A8 has otherwise the same amino acid
residues aligning the cavity as UGT1A10, except for R103. Due to its
size, R103 might impair the binding of the coumarin core. (D) 6 fills the binding cavity (orange solvent accessible surface)
of the UGT1A10 model (green solvent accessible surface). Docking suggests
that the 7-hydroxycoumarin and 6 have a similar binding
mode at their identical core. In addition, the C3 substituent of 6 fits tightly to the additional space at the outward facing
end of the binding cavity.
Docking of 7-hydroxycoumarin and its derivatives into
the UGT1A10
model. (A) Molecular docking placed the 7-hydroxycoumarin with the
7-hydroxy facing the catalytic site formed by H37 and UDPGA, enabling
the glucuronidation reaction and the subsequent decrease in fluorescence.
(B) In UGT1A1, D103, and L106 are not capable of forming similar beneficial
interactions with the coumarin core as the UGT1A10 model. Although
N102 might be able to form beneficial interactions with certain compounds,
the cavity might not be large enough for more sizable substitutions
due to N102 and M213. (C) UGT1A8 has otherwise the same amino acid
residues aligning the cavity as UGT1A10, except for R103. Due to its
size, R103 might impair the binding of the coumarin core. (D) 6 fills the binding cavity (orange solvent accessible surface)
of the UGT1A10 model (green solvent accessible surface). Docking suggests
that the 7-hydroxycoumarin and 6 have a similar binding
mode at their identical core. In addition, the C3 substituent of 6 fits tightly to the additional space at the outward facing
end of the binding cavity.Based on these homology models, there was an additional,
but variable
in size, free space available in the active site of each UGT1A enzyme,
next to position 3 of the coumarin core. When combined with the 7-hydroxycoumarin
docking site analyses (see above), this additional space was large
enough in UGT1A1 and UGT1A10 to accommodate five- or six-membered
ring substituents (Figure D). In contrast, a bulkier phenylalanine (F212) is present
in the UGT1A6 model at this position, clearly hindering binding of
any 3-substituted 7-hydroxycoumarins. The properties of this binding
site were quite different also between UGT1A1 and UGT1A10. While UGT1A1
has a hydrophobic methionine (M213) facing this site (Figure B), UGT1A10 has a histidine
at the corresponding site (H210; Figure A). On the opposite side of this additional
space, UGT1A10 has an alanine (A100), while UGT1A1 has an asparagine
(N102) aligned to the same position. This may mean that in UGT1A10
there is enough space for rather large 3-substituted 7-hydroxycoumarins,
whereas UGT1A1 would have problems accommodating larger subsitutions
at this position of the 7-hydroxycoumarin scaffold. At the other end
of the UGT1As “spectrum”, UGT1A6 has a glutamic acid
(E101) aligned at the same site, which would limit the cavity even
further.Based on docking of a virtual library into the UGT1A10
model, the
most promising molecules were 7-hydroxycoumarin derivatives with the
following substituents at the C3 position: 4-fluorophenyl (1), 4-hydroxyphenyl (2), 4-methoxyphenyl (3), 4-(dimethylamino)phenyl (4), 4-methylphenyl (5) or triazole (6). Among these, the triazole
(6) derivative could be stabilized by H210 in UGT1A10,
while the corresponding methionine in UGT1A1 (M213) would not be able
to form hydrogen bonds with it. In contrast, the addition of a phenyl
moiety to the C3-position would allow binding by both UGT1A1 and UGT1A10,
as the hydrophobic methionine in UGT1A1 is quite an ideal companion,
while the histidine in UGT1A10 could change its conformation according
to the donor functionality, as with triazole. Based on these observations
and considerations, the six new coumarin derivatives were designed
and synthesized (Figure : compounds 1-6). The selected compounds
were made from inexpensive starting materials, producing 3-substituted
coumarins with 5- or 6-membered rings.
Figure 3
Novel (1–6) and control 7-hydroxycoumarin
and 7-hydroxy-4-trifluoromethylcoumarin (HCF) substrates of UGT1A
enzymes in this study.
Novel (1–6) and control 7-hydroxycoumarin
and n class="Chemical">7-hydroxy-4-trifluoromethylcoumarin (HCF) substrates of UGT1A
enzymes in this study.
Glucuronidation of the 3-Substituted 7-Hydroxycoumarins
The absorbance and fluorescence spectra of compounds 1–6 were very similar showing, however, some differences in intensity
as well as excitation and emission peaks among them (Figure A, Supplementary Figures 1 and 2, and Supplementary Table 1). The fluoresecence was pH dependent, emitting strongly in
neutral and alkaline solutions.
Figure 4
Decrease of 7-hydroxycoumarin fluorescence
during glucuronidation.
Excitation and emission fluorescence spectra of 0.1 μM 7-hydroxy-3-triazolecoumarin
at 100 mM phosphate pH 7.4 buffer (panel A); decrease in 10 μM
7-hydroxy-3-triazolecoumarin fluorescence in the presence of 0.7 mg/mL
pig liver microsomal protein, 0.5 mM UDPGA, 5 mM MgCl2,
and 100 mM Tris-HCL pH 7.4 (panel B); effect of the amount of microsomal
protein on the decrease in fluorescence (panel C); effect of solvents
and alamethicin on the decrease in fluorescence (panel D). Corresponding
results were obtained with other C7-substituted 7-hydroxycoumarin
derivatives.
Decrease of 7-hydroxycoumarin fluorescence
during glucuronidation.
Excitation and emission fluorescence spectra of 0.1 μM 7-hydroxy-3-triazolecoumarin
at 100 mM phosphate pH 7.4 buffer (panel A); decrease in 10 μM
7-hydroxy-3-triazolecoumarin fluorescence in the presence of 0.7 mg/mL
pig liver microsomal protein, 0.5 mM UDPGA, 5 mM MgCl2,
and 100 mM Tris-HCL pH 7.4 (panel B); effect of the amount of microsomal
protein on the decrease in fluorescence (panel C); effect of solvents
and alamethicin on the decrease in fluorescence (panel D). Corresponding
results were obtained with other C7-substituted 7-hydroxycoumarin
derivatives.In the first glucuronidation
experiments, the fluorescence intensity
of all of the C3-substituted7-hydroxycoumarin derivatives, compounds 1–6, decreased when they were incubated
in the presence of pig liver microsomes and UDPGA in a buffer containing
100 mM Tris-HCl pH 7.4 and 5 mM MgCl2 (Figure B). No significant fluorescence
decrease was observed in the negative controls, namely in the absence
of either microsomes, a coumarin derivative such as 6, or UDPGA. The fluorescence changes were linearly dependent on the
amount of microsomes (Figure C), indicating that the biosynthesis of C3 substituted 7-hydroxycoumarin
derivatives to nonfluorescent glucuronide conjugates was catalyzed
by one or more UDP-glucuronosyltransferase enzymes in the microsomes.
The presence of alamethicin increased glucuronidation rates in this
microsomal sample, whereas the addition of more than 5% (v/v) dimethyl
sulfoxide, acetonitrile, or ethanol decreased it (Figure D). An example for glucuronide
formation under such incubation condition, using 6 as
the substrate, is presented in Figure S3.The above results with 6 and pig liver microsomes
suggested that the glucuronidation rates of the new 7-hydroxycoumarin
derivatives could be accurately determined under our standardized
assay conditions, using different enzyme sources. Subsequently, the
glucuronidation rates of all the new C3 substituted 7-hydroxycoumarin
derivatives by nearly all the humanUGTs, including enzymes that are
not commercially available, were determined (Figure ). For comparison and additional controls, the glucuronidation
of 7-hydroxycoumarin and 4-(trifluoromethyl)-7-hydroxycoumarin (HFC),
that carry no C3 substitution, by the recombinant enzymes were also
measured (Figure ).Glucuronidation
of C3-substituted 7-hydroxycoumarins by humanUGTs.
Glucuronidation was determined at 10 μM aglycone concentration.The humanUGTs screen revealed
that all six newly synthesized C3
substituted 7-hydroxycoumarins were glucuronidated by UGT1A10 more
rapidly than by other UGT forms. Furthermore, 2, 4, 5, and 6 were selective for UGT1A10,
as other UGTs catalyzed their glucuronidation at very low rates. The
remaining two new substrates, 1 and 3, were
glucuronidated, in addition to UGT1A10, also by UGT1A1, at rates of
about 40% and 20%, respectively, of the corresponding UGT1A10 rate
(Figure ). The glucuronidation
profiles of the new derivatives differed significantly from the control
substrates, 7-hydroxycoumarin and HFC, which were glucuronidated primarily
by UGT1A6 (7-hydroxycoumarin), or UGT1A6 and UGT1A10 (HFC), as well
as by few other UGTs at lower rates (Figure ).In addition to recombinant UGTs,
the glucuronidation rates of all
the new C3 7-hydroxycoumarin derivatives, along with 7-hydroxycoumarin
and HFC, were measured in human liver microsomes (HLM) and human intestinal
microsomes (HIM). The results showed that all the new compounds were
glucuronidated by HIM at higher rates than by HLM (Figure ). Furthermore, 2, 4, and 6 were not glucuronidated by HLM
at all, or only at very low rates, whereas 3 and 5 were conjugated by HLM to about 20–25% of the rate
exhibited by HIM. Compound 1 was glucuronidated by HLM
at about 40% of the corresponding rate in HIM (Figure ). Kinetics of compound 6 glucuronidation
confirmed that glucuronidation is more specific in intestinal than
hepatic microsomes, as its Km value was
82 (49–115) μM and Vmax 4.0
(2.6–5.4) μmol/(min* g prot) in human hepatic microsomes
and its Km value was 12 (8.8–15)
μM and Vmax 3.5 (2.9–4.0)
μmol/(min * g prot) in human intestinal microsomes. Adding albumin
to the incubation mixture increased both Km and Vmax values in instestinal microsomes.
In sharp contrast to glucuronidation of the new 7-hydroxycoumarin
derivatives, the “parent compound” 7-hydroxycoumarin,
as well as HFC, were glucuronidated to much higher rates by HLM than
by HIM (Figure ).
Figure 6
Glucuronidation
of C3-substituted 7-hydroxycoumarins by human intestinal
and hepatic microsomes. Glucuronidation was determined at 10 μM
aglycone concentration.
Glucuronidation
of C3-substituted 7-hydroxycoumarins by human intestinal
and hepatic microsomes. Glucuronidation was determined at 10 μM
aglycone concentration.
Effect of H210 to M210 Mutation on UGT1A10 Activity
The
developed model, by being explicit about the role of certain
key UGT1A10 residues in the binding of the designed 7-hydroxycoumarin
derivatives, also allowed testing it by mutagenesis. Hence, we prepared
mutant 1A10-H210M, a mutant of UGT1A10 in which H210 was changed to
methionine, the corresponding residue in UGT1A1. The mutant was expressed
in insect cells, similarly to all the other recombinant UGTs that
were used in this study, and its activity toward the new 7-hydroxycoumarin
derivatives was tested. This was combined with kinetic analyses of
the glucuronidation of these compounds by both UGT1A10 and UGT1A10-H201M,
side by side (Figure and Table ). The
results demonstrated clear effects of the mutation on the glucuronidation
kinetics of most compounds. A decrease of Vmax occurred in all but 2 and 6, in which
the Km values were considerably increased
(Table ). Changes
in the Km values of the other compounds
were variable; however, an increase in the case of HFC, no change
for 5, and a decrease in 1, 3, and 4 (Table ).
Figure 7
Michaelis–Menten kinetics of UGT1A10 (open circle) and UGT1A10
mutant (closed circle) catalyzed 7-hydroxyl glucuronidation for the
3-substituted 7-hydroxycoumarins (1–7 and HFC). The data are from one experiment, and the analyzed data
are shown in Table .
Table 1
Michaelis–Menten
(MM) Kinetic
Constants of UGT1A10- and UGT1A10mutant-Catalyzed 7-Hydroxyl Glucuronidation
for the 3-Substituted 7-Hydroxycoumarins
UGT1A10
UGT1A10mutant
compd
Km (95% confidence interval) (μM)
Vmax (95% confidence interval) (μmol/min/g prot)
Vmax/Km (L/min/g prot)
nonlinear MM model R2
Km (95% confidence interval) (μM)
Vmax (95% confidence interval) (μmol/min/g prot)
Vmax/Km (L/min/g prot)
nonlinear MM model R2
1
10.7 (1.7–19.6)
31 (17–46)
2.9
0.9813
3.5 (0–9.3)
8.7 (3.4–14)
2.5
0.8726
2
2.2 (1–3.4)
5.9 (4.9–6.9)
2.7
0.9788
7.8 (5.5–10.2)
6.3 (5.4–7.3)
0.81
0.9965
3
8.3 (0–31.4)
22.3 (0–53.4)
2.7
0.8028
3.8 (0.97–6.7)
9.5 (6.8–12.3)
2.5
0.9695
4
2.8 (0–6.5)
15.3 (7.3–24)
5.5
0.9215
4.7 (1.5–7.9)
6.5 (4.4–8.6)
1.4
0.9846
5
2.8 (0.7–4.9)
16.2 (12–20)
5.8
0.9571
4.6 (1.5–7.8)
5.9 (4.1–7.6)
1.3
0.9750
6
7.0 (3.1–11)
5.3 (3.7–8)
0.76
0.9879
26.8 (0–80)
6.3 (0–15.9)
0.24
0.9733
HFC
14 (10.7–17.3)
15.1 (12.7–17.5)
1.1
0.9991
32.9 (0–102)
11.7 (0–31.7)
0.36
0.9781
Michaelis–Menten kinetics of UGT1A10 (open circle) and UGT1A10
mutant (closed circle) catalyzed 7-hydroxyl glucuronidation for the
3-substituted 7-hydroxycoumarins (1–7 and HFC). The data are from one experiment, and the analyzed data
are shown in Table .
Discussion
In this study, we constructed predictive homology models for the
humanUGT1A enzymes in order to design selective substrates for them.
The models indicated several key characteristics that differ among
the active sites of individual UGT1A enzymes. These differences were
exploited for the design and synthesis of six new 3-substituted 7-hydroxcoumarin
derivatives. All the new compounds were good substrates for UGT1A10
and four of them, namely 2, 4, 5, and 6, were selective substrates for this UGT (Figure ). Among the clear
advantages of these new 7-hydroxcoumarin derivatives as UGT1A10 substrates
are their extensive fluorescence and simple synthesis from low-cost
starting materials that make them suitable for quick and convenient
activity measurements in a high-throughput format.Currently,
no high-resolution, or even low-resolution, structure
of a full-length UGT is available from X-ray crystallography or cryo-electron
microscopy. Although their 3D-model construction is challenging, homology
models of UGT1A1, 1A3, 1A4, 1A5, 1A6, 1A7, 1A8, 1A9, and 1A10 were
constructed in this study. These models suggested that the active
site of UGT1A10 is sufficiently different from the other UGTs to enable
design and synthesis of selective substrates for it.We had
two goals in designing these substrates: they should be
selective for UGT1A10, and determination of their glucuronidation
should be based on easily measurable fluorescence change during the
assay. As a starting point, the 7-hydroxycoumarin scaffold was selected,
since it is a common UGT substrate and its derivatives have intense
fluorescence.[44] In addition, 7-hydroxycoumarin
and 7-hydroxy-4-(trifluoromethyl)coumarin have both been shown to
be glucuronidated by several different UGTs.[25] The hydroxyl group of 7-hydroxycoumarin was oriented toward the
UDPGA in the active site of the UGT1A10 model, indicating that there
is space in the active site for an additional six or five ring substituent
at position C3 of the 7-hydroxycoumarin scaffold (Figure ). Thus, we synthesized six
new UGT1A10 substrates, all of which were 7-hydroxycoumarin derivatives
with various substituents at position C3 of the coumarin scaffold.All of the new 7-hydroxycoumarin derivatives are highly fluorescent,
and their fluorescence decreases upon enzymatic glucuronidation (see Figure for an example with
compound 6). A concern in these assays was nonlinearity
of the fluorescence at substrate concentrations above 20 μM.
However, fluorescence changes of these substrates were selective,
sensitive and quantitative enough for measurements below this concentration
limit, as the amount of UGT1A10 enzyme could be adjusted to yield
linear glucuronidation rates.The selectivities of the 7-hydroxycoumarin
derivatives for UGT1A10
differed substantially. While some of them, such as 2, 4, and 6, were highly selective, others,
like 1 and 3, were also glucuronidated by
UGT1A1 at considerable rates (Figure ). Previous studies have shown that fluorescent derivatives
of N-butyl-4-phenyl-1,8-naphthalimide are UGT1A1
selective substrates.[45]Since UGT1A10
is an extrahepatic enzyme expressed at high levels
in the intestine,[11] the results obtained
with recombinant UGTs could be tested with HLM and HIM. Although these
microsomal preparations contain several different UGTs each, HLM lacks
a functional UGT1A10 while HIM contains it.[11] Indeed, the glucuronidation rates in HLM of 4 and 6, as well as 2, were very low or below the detection
limit. Glucuronidation of 1, 3 and 5 took place in HLM at rates up to 40% of the rates in HIM
(Figure ). These results
also suggest which of the new compounds would be most useful for studies
on UGT1A10 activity in samples from human tissues that express or
may express this enzyme. The current results point at 2, 4 and 6 as good candidates, 2 due to the lack of detectable activity in HLM, 4 based
on the combination of high rate with high selectivity, and 6 due to its high selective fluorescence intensity (Figure and Supplementary Figures S1 and S2). It may be added here that we recently reported
that the commonly used commercial UGT1A10 has low activity.[13] In this study we have used the UGT1A10-H preparation,
not the commercial UGT1A10. Researches should not expect to get similar
results to those reported here for UGT1A10 when working with the commonly
used commercial UGT1A10. On the other hand, experiments with commercial
HIM and HLM are expected to reproduce the current results.It
is interesting to understand why 6 has a remarkably
lower (less than 30%) intrinsic glucuronidation clearance (Vmax/Km) by UGT1A10 than the other
new 7-hydroxycoumarin derivatives, 1–5 (Table ). Examination
of the substituents at C3 suggests that 6 with a triazole
derivative at C3 was glucuronidated less efficiently than derivatives
containing hydrophobic or other types of hydrophilic substituents.
The reason for this could be that the triazole causes stronger interactions
than the other substituents in the active site of UGT1A10, resulting
in slower release of the formed glucuronide.The present modeling
work indicates specific residues that are
expected to lead to substrate selectivity of UGT1A10. We have tested
one of the predicted residues, H210, by changing it to M210, the corresponding
residue in UGT1A1, expressed the mutant UGT1A10-M210 and studied the
glucuronidation kinetics of all the new compounds by both the wildtype
(i.e., UGT1A10-H210) and mutant enzymes. The results revealed changes
in the Km and/or Vmax values
of the glucuronidation kinetics of all the compounds, but with clear
differences among them (Figure and Table ). Another unexpected observation was the effect of the mutation
on HFC glucuronidation rate, which may suggest that the effect of
the mutation is larger than expected by the model, or that substrate(s)
binding by UGT1A10 (also) involves an induced fit mechanism.In conclusion, in this study, 3D molecular models of the UGT1As
were constructed and used for the design and synthesis of six new
fluorescent UGT substrates. A new multiwell-based method that takes
advantage of the fluorescence of the compounds and their fluorescence
decrease upon glucuronidation was established to measure glucuronidation
rates. Of the new compounds, 4-(dimethylamino)phenyl (4) and triazole (6) C3-substituted 7-hydroxycoumarins
appeared to be the most selective substrates for UGT1A10, an important
and often underestimated extrahepatic humanUGT. It is concluded that
the selectivity of the new coumarin derivatives for UGT1A10 depends
on the chemical character of their substituent at C3. These new compounds
should enable better, faster, and easier determination of UGT1A10
activity in tissues than was earlier possible. In addition, their
further chemical modification could stimulate the development of new
tools to explore the active site of different UGT enzymes.
Authors: Johannes Kirchmair; Andreas H Göller; Dieter Lang; Jens Kunze; Bernard Testa; Ian D Wilson; Robert C Glen; Gisbert Schneider Journal: Nat Rev Drug Discov Date: 2015-04-24 Impact factor: 84.694
Authors: Katriina Itäaho; Michael H Court; Päivi Uutela; Risto Kostiainen; Anna Radominska-Pandya; Moshe Finel Journal: Drug Metab Dispos Date: 2008-12-30 Impact factor: 3.922
Authors: Katriina Itäaho; Peter I Mackenzie; Shin-ichi Ikushiro; John O Miners; Moshe Finel Journal: Drug Metab Dispos Date: 2008-08-21 Impact factor: 3.922
Authors: Risto O Juvonen; Olli Pentikäinen; Juhani Huuskonen; Juri Timonen; Olli Kärkkäinen; Aki Heikkinen; Muluneh Fashe; Hannu Raunio Journal: Xenobiotica Date: 2020-01-08 Impact factor: 1.908
Authors: Sanna Rauhamäki; Pekka A Postila; Sakari Lätti; Sanna Niinivehmas; Elina Multamäki; Klaus R Liedl; Olli T Pentikäinen Journal: ACS Omega Date: 2018-06-11
Authors: Mira Ahinko; Sami T Kurkinen; Sanna P Niinivehmas; Olli T Pentikäinen; Pekka A Postila Journal: Int J Mol Sci Date: 2019-06-06 Impact factor: 5.923