| Literature DB >> 29391749 |
Hayam Hussein1, Prosper Boyaka2, Jennifer Dulin1, Duncan Russell2, Lauren Smanik1, Mohamed Azab1, Alicia L Bertone1,2.
Abstract
Selective inhibition of Cathepsin K (CatK) has a promising therapeutic potential for diseases associated with bone loss and osseous inflammation, such as osteoarthritis, periodontitis, and osteoporosis. In horses, stress-related bone injuries are common and accompanied by bone pain and inflammation resulting in excessive bone resorption and periostitis. VEL-0230 is a highly selective inhibitor of CatK that significantly decreased bone resorption and increased bone formation biomarkers. The goal of this study was to demonstrate the presence of CatK in equine bone and a simultaneous influence on the bone marrow cellular components including function and differentiation. Our objectives were: 1) to investigate the tissue localization of CatK protein in equine bone using immunohistochemistry, and 2) to determine the effect of CatK inhibition on osteoclastogenic, chondrogenic and osteogenic differentiation potential of equine stem and progenitor cells in vitro using histochemical staining and differentiation-related gene expression analyses. Bone biopsies, harvested from the tuber coxae and proximal phalanx of six healthy horses, were processed for immunostaining against CatK. Sternal bone marrow aspirates were cultured in 0, 1, 10, or 100 μM of VEL-0230 and subsequent staining scoring and gene expression analyses performed. All cells morphologically characterized as osteoclasts and moderate number of active bone lining osteoblasts stained positive for CatK. Histochemical staining and gene expression analyses revealed a significant increase in the osteoclastogenic, chondrogenic and osteogenic differentiation potential of equine bone marrow cells, which was VEL-0230-concentration dependent for the latter two. These results suggested that CatK inhibition may have anabolic effects on bone and cartilage regeneration that may be explained as a feedback response to CatK depletion. In conclusion, the use of CatK inhibition to reduce inflammation and associated bone resorption in equine osseous disorders may offer advantages to other therapeutics that would require further study.Entities:
Keywords: Bone resorption; Chondrocyte; Osteoblast; Osteoclast; Osteoporosis
Year: 2017 PMID: 29391749 PMCID: PMC5786646
Source DB: PubMed Journal: J Stem Cells Regen Med ISSN: 0973-7154
The forward and reverse nucleotides sequences for primers used in the q RT-PCR.
| Gene | Primer sequences | |
| Osteoclastogenic differentiation-related genes | CatK | Fwd: 5'CAGAGATTGCCATTCCGTTT3' |
| RANKL | Fwd: 5'CGACATCCCATCAGGTTCCC3' | |
| TRAP | Fwd: 5'CTGGTCTTGAACAGGGACTTG3' | |
| Chondrogenic differentiation-related genes | Aggrecan | Fwd: 5'TGCACAGACCCCGCCAGCTA3' |
| Collagen 2A | Fwd: 5' GCTTCCACTTCAGCTATGGA3' | |
| SOX9 | Fwd: 5'CGCCGAAGCTCAGCAAGA3' | |
| Osteogenic differentiation-related genes | Alkaline phosphatase | Fwd: 5'TGGGGCTAAGCTCTGGAGTC3' |
| Osteopontin | Fwd: 5'CGCAGATCTGAAGACCAGTA3' | |
| RUNX2 | Fwd: 5'CTCCAACCCACGAATGCACTA3' | |
| Internal control gene | GAPDH | Fwd: 5'CAACGAATTTGGCTACAGCA3' |
Figure 1.
Figure 2.
Figure 3.
Figure 4.