Literature DB >> 29364115

Heg1 and Ccm1/2 proteins control endocardial mechanosensitivity during zebrafish valvulogenesis.

Stefan Donat1,2, Marta Lourenço1, Alessio Paolini1, Cécile Otten1, Marc Renz1, Salim Abdelilah-Seyfried1,2.   

Abstract

Endothelial cells respond to different levels of fluid shear stress through adaptations of their mechanosensitivity. Currently, we lack a good understanding of how this contributes to sculpting of the cardiovascular system. Cerebral cavernous malformation (CCM) is an inherited vascular disease that occurs when a second somatic mutation causes a loss of CCM1/KRIT1, CCM2, or CCM3 proteins. Here, we demonstrate that zebrafish Krit1 regulates the formation of cardiac valves. Expression of heg1, which encodes a binding partner of Krit1, is positively regulated by blood-flow. In turn, Heg1 stabilizes levels of Krit1 protein, and both Heg1 and Krit1 dampen expression levels of klf2a, a major mechanosensitive gene. Conversely, loss of Krit1 results in increased expression of klf2a and notch1b throughout the endocardium and prevents cardiac valve leaflet formation. Hence, the correct balance of blood-flow-dependent induction and Krit1 protein-mediated repression of klf2a and notch1b ultimately shapes cardiac valve leaflet morphology.
© 2018, Donat et al.

Entities:  

Keywords:  CCM; KLF2; VE-cadherin; cardiac valves; developmental biology; endocardium; heart; stem cells; zebrafish

Mesh:

Substances:

Year:  2018        PMID: 29364115      PMCID: PMC5794256          DOI: 10.7554/eLife.28939

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.140


Introduction

Biophysical forces including shear stress caused by blood-flow trigger activation of mechanotransduction pathways within endothelial cells (ECs), a process which causes cellular changes that contribute to the sculpting of vascular networks and of the heart (Baeyens and Schwartz, 2016; Haack and Abdelilah-Seyfried, 2016). Currently, our knowledge is incomplete regarding the modes by which the sensitivity of different vascular beds is attuned to the constantly changing stimulus of blood-flow. One well-studied example of a blood-flow-sensitive developmental process involves remodeling of endocardial cushions into cardiac valve leaflets in the zebrafish embryo (Beis et al., 2005; Pestel et al., 2016; Scherz et al., 2008; Steed et al., 2016). Prior to the formation of cardiac cushions, the oscillatory pattern of blood-flow induces expression of the mechanotransduction pathway components zinc-finger transcription factors Krüppel like factors 2a (klf2a) (Vermot et al., 2009) and klf2b (Renz et al., 2015). KLFs are important blood-flow-responsive genes within ECs that are strongly activated within regions of high shear stress in tissue culture and various in vivo models (Dekker et al., 2002, 2005; Groenendijk et al., 2004, 2005; Lee et al., 2006; Novodvorsky and Chico, 2014; Parmar et al., 2005; Zhou et al., 2016). As zebrafish cardiac atrioventricular (AV) cushions are remodeled into AV valve leaflets, endocardial klf2a is highly expressed on the luminal side of the developing valve leaflet, which is exposed to blood-flow, whereas its expression is low on the abluminal side of the leaflet (Steed et al., 2016). Zebrafish klf2a mutants exhibit defective cardiac valve leaflets (Steed et al., 2016) and a loss of murine Klf2 also results in atrioventricular cushion defects (Chiplunkar et al., 2013). One of the targets of klf2a within cardiac cushions is notch1b (Vermot et al., 2009). The precise spatiotemporal regulation of Klf2 expression within cardiac valve leaflets indicates that fine-tuning the response to blood-flow has a conserved role in shaping functional leaflets during cardiac morphogenesis. The control of Klf2 expression has been linked to the cerebral cavernous malformations protein complex (Maddaluno et al., 2013; Renz et al., 2015; Zhou et al., 2015, 2016). Within this complex, KRIT1 (also known as CCM1) and the transmembrane protein HEG1 (also known as Heart of glass) physically interact with each other. This interaction results in stabilization of both proteins at EC junctions (Gingras et al., 2012; Kleaveland et al., 2009). The loss of HEG1, KRIT1, CCM2, or PDCD10 (also referred to as CCM3) causes severe cardiovascular and cardiac developmental defects (Kleaveland et al., 2009; Mably et al., 2003; Mably et al., 2006; Whitehead et al., 2009; Yoruk et al., 2012; Zheng et al., 2010). However, functional studies in zebrafish suggest that Ccm3 functions in a manner that is separate from Krit1 and Ccm2 (Yoruk et al., 2012). The name CCM refers to pathologies with familial inheritance that have been attributed to mutations in human KRIT1, CCM2, or PDCD10. Affected individuals exhibit morphological malformations of low-perfused venous endothelial beds of the neuro-vasculature that can result in dangerous cerebral bleeding [reviewed in Riant et al., 2010]. Similarly, the conditional endothelial-specific loss of Krit1, Ccm2, or Pdcd10 in postnatal mice causes CCM lesions (Boulday et al., 2011; Chan et al., 2011). Strikingly, postnatal loss of Heg1 in mice does not cause CCM lesions and familial forms of the CCM pathology have never been associated with mutations in HEG1 (Zheng et al., 2014). These findings suggest a developmental role for HEG1-CCM signaling which differs from postnatal functions of the other CCM proteins. Functional studies in zebrafish ccm and murine Ccm mutants have linked cardiovascular developmental defects to elevated expression levels of Klf2 (Renz et al., 2015; Zhou et al., 2015; 2016). Two major pathways have been implicated in regulation of KLF2 by the CCM proteins KRIT1 and CCM2. First, the core adaptor protein KRIT1 and its associated β1-Integrin binding protein 1 (ICAP1) suppress β1-Integrin signaling in human umbilical vein endothelial cells (HUVECs) (Faurobert et al., 2013). A loss either of CCM proteins or of ICAP1 enhances Integrin signaling and this causes strong upregulation of KLF2 expression in HUVECs, which is suppressed by the depletion of β1-Integrin (Renz et al., 2015). Similarly in zebrafish, ccm mutant cardiovascular defects are suppressed by a knockdown of β1-Integrin (Renz et al., 2015). Secondly, the binding of CCM2 to MEKK3 (also known as MAP3K3) (Cullere et al., 2015; Uhlik et al., 2003; Zhou et al., 2015) inhibits the MEKK3-MEK5-ERK5 mechanotransduction pathway, which controls expression levels of murine Klf2 (Zhou et al., 2015). These findings point to the importance of CCM proteins in regulating the physiological responsiveness of ECs to blood-flow. In support of such a physiological role, CCM proteins antagonize activation of β1-Integrin and thus interfere with the orientation of endothelial cells in response to shear stress (Macek Jilkova et al., 2014). The developmental connection of Ccm proteins with the regulation of klf2a expression led us to investigate whether expression of zebrafish heg1 and krit1 within the vasculature is controlled in a mechanosensitive manner. We find that expression of heg1 is positively regulated in response to blood-flow and klf2a/b. We also explored the role of Heg1 and Krit1 in Klf2-dependent endothelial mechanotransduction during the formation of cardiac valve leaflets. Here, we show that Krit1 dampens levels of klf2a and notch1b expression. In tune with this finding, loss of Krit1 results in strong expression of klf2a and notch1b within the endocardium and prevents formation of an abluminal population of valve leaflet cells from endocardial cushions. Our findings reveal an important developmental role of Ccm proteins in fine-tuning the sensitivity of ECs in response to the strength of the biomechanical stimulus of blood-flow during valvulogenesis.

Results

Expression levels of heg1 mRNA are positively regulated by blood-flow and Klf2a/b

To test whether the regulation of heg1 or krit1 mRNAs responds to changes in blood-flow, we measured their expression levels using RT-qPCR in troponin T type 2a (tnnt2a) morphants that have a non-contractile heart and thus lack blood-flow (Sehnert et al., 2002). Under this condition, mRNA levels of heg1 but not of krit1 were significantly lower than in wild-type (WT) embryos at 54 hr post fertilization (hpf) (Figure 1A). Similarly, antisense oligonucleotide morpholino (MO)-mediated knockdown of Klf2a/b caused significant downregulation of heg1 mRNA. In comparison, the expression levels of krit1 mRNA were not significantly altered (Figure 1A). To test whether heg1 is positively regulated by Klf2a, we generated transgenic lines of zebrafish for heat-shock-mediated induction of klf2a [Tg(hsp70l:klf2a_IRES_EGFP)]. We found that overexpression of klf2a upon heat-shock at 48–50 hpf led to a significant upregulation of heg1 mRNA expression by 54–55 hpf (Figure 1B). However, the treatment did not significantly upregulate levels of krit1 mRNA.
Figure 1.

Mechanosensitive expression of heg1 mRNA and stabilization of Krit1 protein levels by heg1.

(A) RT-qPCR quantifications of heg1 and krit1 mRNA levels at 54 hpf in morphant embryos lacking blood-flow [troponin T type 2a (tnnt2a)], or Krüppel like factors 2a and 2b (klf2a/b) compared with wild-type expression levels. (B) RT-qPCR quantification showing that heat-shock-induced overexpression of klf2a causes significant upregulation of heg1 but not of krit1 expression at 54 hpf. (C–E) Morpholino-mediated knockdown of Heg1 significantly reduces endocardial EGFP-Krit1 protein levels of 30 hpf Tg(fli:GAL4FF); Tg(UAS:EGFP-Krit1) embryos. Scale bars are 50 µm. Mean values ± SEM of three (tnnt2a MO, hs:klf2a, heg1 MO) or four (klf2a/b MO) individual experiments are shown. Ratio paired (A, B) or unpaired (E) t-test was used to compare each condition with controls (ns: not significant, *p<0.05, ***p<0.001).

(A) At 30 hpf, heg1 is expressed throughout the entire endocardium. (B) Later, at 48 hpf, heg1 expression becomes restricted to high fluid shear stress regions of the endocardium including the atrioventricular canal (AVC). (C) The strong expression of heg1 at the AVC persists at 72 hpf. (D) Expression of heg1 was reduced in morphant embryos lacking blood-flow [troponin T type 2a (tnnt2a)] at 48 hpf. A: atrium, V: ventricle, OFT: outflow tract, arrowheads in B, C, and D point at the AVC.

(A–C) Morpholino-mediated knockdown of Heg1 significantly reduces EGFP-Krit1 protein levels in the trunk vasculature of 30 hpf Tg(fli:GAL4FF); Tg(UAS:EGFP-Krit1) embryos. Scale bars are 50 µm. Mean values ± SEM of three individual experiments are shown. Unpaired t-test was used to compare conditions with control (****p<0.0001).

It has previously been shown that heg1 is expressed within endocardium (Mably et al., 2003). To determine the regional expression of heg1 mRNA within the endocardium, we performed whole-mount in situ hybridizations in WT and tnnt2a morphants. Whereas heg1 was initially expressed throughout the entire endocardium at 30 hpf, by 48 hpf, expression became more restricted to cells exposed to a high fluid shear stress including the atrioventricular canal (AVC) endocardium, and this was even more striking at 72 hpf [Figure 1—figure supplement 1A–C; (Münch et al., 2017)]. In tune with flow-dependent regulation within the endocardium, expression of heg1 mRNA was reduced in tnnt2a morphants at 48 hpf (Figure 1—figure supplement 1D).
Figure 1—figure supplement 1.

Whole-mount in situ hybridization of heg1 cardiac expression.

(A) At 30 hpf, heg1 is expressed throughout the entire endocardium. (B) Later, at 48 hpf, heg1 expression becomes restricted to high fluid shear stress regions of the endocardium including the atrioventricular canal (AVC). (C) The strong expression of heg1 at the AVC persists at 72 hpf. (D) Expression of heg1 was reduced in morphant embryos lacking blood-flow [troponin T type 2a (tnnt2a)] at 48 hpf. A: atrium, V: ventricle, OFT: outflow tract, arrowheads in B, C, and D point at the AVC.

As Heg1 and Krit1 proteins are known to interact in vitro (Kleaveland et al., 2009), we next tested whether Heg1 protein affects protein levels of its binding partner Krit1. To this end, we first generated a transgenic line of zebrafish for expression of EGFP-Krit1 [Tg(UAS:EGFP-krit1)]. Next, we analyzed the levels of EGFP-Krit1 protein in heg1 MO-injected embryos and found that they were significantly lower than in WT control embryos in the heart (Figure 1C–E) and the caudal vasculature at 30 hpf (Figure 1—figure supplement 2). Taken together, the levels of heg1 mRNA expression are positively regulated by blood-flow and Klf2a-dependent mechanotransduction. In turn, Heg1 has a stabilizing effect on Krit1 levels.
Figure 1—figure supplement 2.

Stabilization of Krit1 protein levels by heg1 in the trunk vasculature.

(A–C) Morpholino-mediated knockdown of Heg1 significantly reduces EGFP-Krit1 protein levels in the trunk vasculature of 30 hpf Tg(fli:GAL4FF); Tg(UAS:EGFP-Krit1) embryos. Scale bars are 50 µm. Mean values ± SEM of three individual experiments are shown. Unpaired t-test was used to compare conditions with control (****p<0.0001).

Overexpression of heg1 or krit1 mRNA dampens expression levels of klf2a mRNA

A loss of Ccm proteins in zebrafish or mice results in higher levels of klf2 mRNA expression, suggesting that the physiological role of Ccm proteins is to modulate klf2 expression levels in response to blood-flow (Renz et al., 2015; Zhou et al., 2015, 2016). Given that levels of heg1 mRNA expression are affected by blood-flow, we explored whether upregulation of Heg1 or Krit1 would have an impact on endothelial mechanotransduction pathways. First, we injected heg1 mRNA at the one-cell stage and assessed klf2a mRNA levels at 24 and 48 hpf. At both times, high levels of heg1 mRNA correlated with significantly lower levels of klf2a expression (Figure 2A). Next, we tested whether overexpression of krit1 also downregulates levels of klf2a mRNA by using a transgenic line with heat-shock-inducible krit1 [Tg(hsp70l:krit1_IRES EGFP)]. Treatment with multiple heat-shocks at 14, 24, and 40 hpf resulted in significant downregulation of klf2a mRNA levels throughout the entire embryo at 48 hpf as determined by RT-qPCR (klf2a: fold change 0.63, p<0.05, n = 4 replicates; krit1: fold change 9.77, p<0.001, n = 4 replicates). Cardiac cushions formed normally after this treatment (Figure 2—figure supplement 1) and blood-flow was not affected as assessed by visual inspection (n > 100 embryos analyzed showed normal blood circulation). Hence, the forced upregulation of heg1 or krit1 dampens expression levels of klf2a mRNA. This finding suggests that the strength of the biomechanical forces resulting from blood-flow impacts the expression levels of Ccm proteins; this modulates mechanosensitive signaling within endothelial cells upstream of klf2a.
Figure 2.

Desensitization of endocardial cells to blood-flow by heg1, krit1, or ccm2 overexpression.

(A) Correlation of high heg1 and low klf2a mRNA expression levels at 24 and 48 hpf as determined by RT-qPCR. (B–D) Projections of confocal z-stack images of 54 hpf hearts expressing the flow-responsive marker Tg(TP1:VenusPEST) in heat-shocked wild-type (WT) (B), heat-shock- (hs) induced krit1 overexpression (C), and hs-induced ccm2 overexpression (D). (E) Different ratios of corrected total tissue fluorescence (CTTF) of atrial versus ventricular (+atrioventricular canal region (AVC), arrowhead) expression of the flow-responsive marker Tg(TP1:VenusPEST) between 54 hpf WT and krit1-overexpressing hearts (n = 37) and WT and ccm2-overexpressing hearts (n = 39). krit1- or ccm2-overexpression results in more equal chamber expression of flow-responsive marker Tg(TP1:VenusPEST) expression (depicted is a WT heart corresponding to the krit1-overexpression experiment). (F) Fold change of relative fluorescence (CTTF) in the AVC of Tg(TP1:VenusPEST) in krit1- and ccm2- overexpressing hearts versus the corresponding controls. Scale bars are 50 µm. Mean values ± SEM are shown. Unpaired t-test was used to compare each condition with the WT (*p<0.05, **p<0.01, ***p<0.001).

(A–C) (A) Maximum projections of confocal z-stacks of 48 hpf heat-shocked wild-type (WT) embryo, (B) heat-shock-induced (hs) krit1 overexpressing embryo, and (C) hs-induced ccm2 overexpressing embryo. Myocardial cells and endocardial cushions are stained for Alcam (Magenta). Myocardial cells do not express the destabilized Notch reporter Tg(TP1:VenusPEST) (yellow), which is expressed within endocardium and endocardial cushions. (A’–C’) Shown are projections of 3 confocal z-stack planes (1 μm each) of the same hearts as shown in (A–C). (A’’–C”’) Single confocal z-section images of the atrioventricular canal (AVC) region highlighted with a white square in the panels D-F. (A’’’–C’’’) Inverted images of Notch reporter shown in A’’-C’’ (asterisks mark endocardial cushion cells). Note dowregulation of Notch activity on Krit1 and Ccm2 overexpression (B, C, B’–C’’’). The morphology of endocardial cushions remains unaltered on krit1 and ccm2 overexpression at this stage (B’’–C’’). A: atrium, V: ventricle, arrowheads point at the AVC. Scale bars are 50 µm in A-F and 10 µm in D’-F’’.

Figure 2—figure supplement 1.

Exclusive endocardial expression of the Notch reporter Tg(TP1:VenusPEST) and cardiac cushions forming normally on overexpression of krit1 and ccm2.

(A–C) (A) Maximum projections of confocal z-stacks of 48 hpf heat-shocked wild-type (WT) embryo, (B) heat-shock-induced (hs) krit1 overexpressing embryo, and (C) hs-induced ccm2 overexpressing embryo. Myocardial cells and endocardial cushions are stained for Alcam (Magenta). Myocardial cells do not express the destabilized Notch reporter Tg(TP1:VenusPEST) (yellow), which is expressed within endocardium and endocardial cushions. (A’–C’) Shown are projections of 3 confocal z-stack planes (1 μm each) of the same hearts as shown in (A–C). (A’’–C”’) Single confocal z-section images of the atrioventricular canal (AVC) region highlighted with a white square in the panels D-F. (A’’’–C’’’) Inverted images of Notch reporter shown in A’’-C’’ (asterisks mark endocardial cushion cells). Note dowregulation of Notch activity on Krit1 and Ccm2 overexpression (B, C, B’–C’’’). The morphology of endocardial cushions remains unaltered on krit1 and ccm2 overexpression at this stage (B’’–C’’). A: atrium, V: ventricle, arrowheads point at the AVC. Scale bars are 50 µm in A-F and 10 µm in D’-F’’.

Mechanosensitive expression of heg1 mRNA and stabilization of Krit1 protein levels by heg1.

(A) RT-qPCR quantifications of heg1 and krit1 mRNA levels at 54 hpf in morphant embryos lacking blood-flow [troponin T type 2a (tnnt2a)], or Krüppel like factors 2a and 2b (klf2a/b) compared with wild-type expression levels. (B) RT-qPCR quantification showing that heat-shock-induced overexpression of klf2a causes significant upregulation of heg1 but not of krit1 expression at 54 hpf. (C–E) Morpholino-mediated knockdown of Heg1 significantly reduces endocardial EGFP-Krit1 protein levels of 30 hpf Tg(fli:GAL4FF); Tg(UAS:EGFP-Krit1) embryos. Scale bars are 50 µm. Mean values ± SEM of three (tnnt2a MO, hs:klf2a, heg1 MO) or four (klf2a/b MO) individual experiments are shown. Ratio paired (A, B) or unpaired (E) t-test was used to compare each condition with controls (ns: not significant, *p<0.05, ***p<0.001).

Whole-mount in situ hybridization of heg1 cardiac expression.

(A) At 30 hpf, heg1 is expressed throughout the entire endocardium. (B) Later, at 48 hpf, heg1 expression becomes restricted to high fluid shear stress regions of the endocardium including the atrioventricular canal (AVC). (C) The strong expression of heg1 at the AVC persists at 72 hpf. (D) Expression of heg1 was reduced in morphant embryos lacking blood-flow [troponin T type 2a (tnnt2a)] at 48 hpf. A: atrium, V: ventricle, OFT: outflow tract, arrowheads in B, C, and D point at the AVC.

Stabilization of Krit1 protein levels by heg1 in the trunk vasculature.

(A–C) Morpholino-mediated knockdown of Heg1 significantly reduces EGFP-Krit1 protein levels in the trunk vasculature of 30 hpf Tg(fli:GAL4FF); Tg(UAS:EGFP-Krit1) embryos. Scale bars are 50 µm. Mean values ± SEM of three individual experiments are shown. Unpaired t-test was used to compare conditions with control (****p<0.0001).

Desensitization of endocardial cells to blood-flow by heg1, krit1, or ccm2 overexpression.

(A) Correlation of high heg1 and low klf2a mRNA expression levels at 24 and 48 hpf as determined by RT-qPCR. (B–D) Projections of confocal z-stack images of 54 hpf hearts expressing the flow-responsive marker Tg(TP1:VenusPEST) in heat-shocked wild-type (WT) (B), heat-shock- (hs) induced krit1 overexpression (C), and hs-induced ccm2 overexpression (D). (E) Different ratios of corrected total tissue fluorescence (CTTF) of atrial versus ventricular (+atrioventricular canal region (AVC), arrowhead) expression of the flow-responsive marker Tg(TP1:VenusPEST) between 54 hpf WT and krit1-overexpressing hearts (n = 37) and WT and ccm2-overexpressing hearts (n = 39). krit1- or ccm2-overexpression results in more equal chamber expression of flow-responsive marker Tg(TP1:VenusPEST) expression (depicted is a WT heart corresponding to the krit1-overexpression experiment). (F) Fold change of relative fluorescence (CTTF) in the AVC of Tg(TP1:VenusPEST) in krit1- and ccm2- overexpressing hearts versus the corresponding controls. Scale bars are 50 µm. Mean values ± SEM are shown. Unpaired t-test was used to compare each condition with the WT (*p<0.05, **p<0.01, ***p<0.001).

Exclusive endocardial expression of the Notch reporter Tg(TP1:VenusPEST) and cardiac cushions forming normally on overexpression of krit1 and ccm2.

(A–C) (A) Maximum projections of confocal z-stacks of 48 hpf heat-shocked wild-type (WT) embryo, (B) heat-shock-induced (hs) krit1 overexpressing embryo, and (C) hs-induced ccm2 overexpressing embryo. Myocardial cells and endocardial cushions are stained for Alcam (Magenta). Myocardial cells do not express the destabilized Notch reporter Tg(TP1:VenusPEST) (yellow), which is expressed within endocardium and endocardial cushions. (A’–C’) Shown are projections of 3 confocal z-stack planes (1 μm each) of the same hearts as shown in (A–C). (A’’–C”’) Single confocal z-section images of the atrioventricular canal (AVC) region highlighted with a white square in the panels D-F. (A’’’–C’’’) Inverted images of Notch reporter shown in A’’-C’’ (asterisks mark endocardial cushion cells). Note dowregulation of Notch activity on Krit1 and Ccm2 overexpression (B, C, B’–C’’’). The morphology of endocardial cushions remains unaltered on krit1 and ccm2 overexpression at this stage (B’’–C’’). A: atrium, V: ventricle, arrowheads point at the AVC. Scale bars are 50 µm in A-F and 10 µm in D’-F’’.

Krit1 and Ccm2 impact expression of the mechanosensitive Notch activity reporter Tg(TP1:VenusPEST)

To further assess the physiological effects of altered levels of CCM proteins for endocardial patterning, we analyzed expression levels of the transgenic line Tg(TP1:VenusPEST), which expresses destabilized Venus protein in regions of strong Notch activity (Ninov et al., 2012). In zebrafish, notch1b is a blood-flow-responsive gene that is highly expressed at cardiac cushions (Vermot et al., 2009). By 54 hpf, the expression of Tg(TP1:VenusPEST) is restricted to the ventricular chamber and is particularly strong within the AVC region (Figure 2B). To induce upregulation of krit1 or ccm2, Tg(hsp70l:krit1_IRES EGFP) or Tg(hsp70l:ccm2_IRES EGFP) embryos were treated with multiple heat-shocks at 14, 24, 40, and 48 hpf. On krit1 or ccm2 overexpression, and consistent with a dampening of blood-flow responses, expression from the Tg(TP1:VenusPEST) reporter was generally weakened and was not restricted to the ventricle and AVC region at 54 hpf (Figure 2B–F; Figure 2—figure supplement 1). Hence, overexpression of krit1 or ccm2 affects the expression levels and pattern of the Tg(TP1:VenusPEST) reporter, which is responsive to blood-flow within the heart. Notably, the expression of this Notch reporter was exclusively endocardial in all of these experimental conditions (Figure 2—figure supplement 1). This result suggests that endocardial cells become desensitized to blood-flow-induced mechanosensitive signaling when krit1 or ccm2 are overexpressed.

Krit1 is required for generation of abluminal cell fates during valvulogenesis

Given the strong involvement of Ccm proteins in mechanotransduction pathways, we next explored whether they have a developmental role during remodeling of cardiac cushions into valve leaflets, a morphogenetic process that is highly sensitive to the biomechanical stimulus of blood-flow (Beis et al., 2005; Pestel et al., 2016; Scherz et al., 2008; Steed et al., 2016; Vermot et al., 2009). Previously, it was not possible to address such a potential developmental role as zebrafish ccm mutant endocardial cells fail to form cardiac cushions [Figure 3B; (Renz et al., 2015). This is in contrast to WT endocardial cushion cells that acquire cuboidal shapes at 48 hpf and express activated leukocyte cell adhesion molecule (Alcam) (Figure 3A; Beis et al., 2005). To elucidate whether CCM proteins play a role in this process, we performed a rescue experiment by injecting mRNA encoding EGFP-Krit1 into krit1 mutants, which rescued the cardiovascular defects associated with the loss of Krit1 at 48 hpf (Figure 3C, Figure 3—figure supplement 1). Zebrafish ccm mutants have increased endocardial cell numbers by 48 hpf (Renz et al., 2015). To determine whether injection of mRNA encoding EGFP-Krit1 into krit1 mutants could rescue endocardial cell numbers, we compared ventricular endocardial cell numbers of WT and krit1 rescued embryos at 48 and 55 hpf (Figure 3—figure supplement 2). Consistent with the strong rescue of the krit1 mutant phenotype at 48 hpf, the number of ventricular endocardial cells was normal at this stage. However, by 55 hpf, ventricular endocardial cell numbers had increased beyond those in WT, which suggests that at this stage the krit1 mutant phenotype becomes expressed again. To assay whether the re-appearance of a late krit1 mutant phenotype correlated with decreasing egfp-krit1 mRNA levels, we monitored krit1 mRNA levels over time using RT-qPCR. Indeed, WT embryos injected with egfp-krit1 mRNA showed a significant decrease of krit1 mRNA levels between 24 and 96 hpf (Figure 3—figure supplement 3). This result is consistent with recurrence of the krit1 mutant phenotype at 55 hpf.
Figure 3.

Krit1 is required for abluminal cell fates during valvulogenesis.

(A–F) Single confocal z-section images of endocardial cells within the atrioventricular canal (AVC) region marked by Tg(kdrl:EGFP) expression (cyan) and Alcam staining (magenta). (A) At 48 hpf, wild-type (WT) endocardial cushion cells express Alcam (asterisks). (B) In krit1 mutants, endocardial cells of the AVC region do not express Alcam and cushions do not form (arrow). (C) Injection of egfp-krit1 mRNA rescues cardiac cushion formation in krit1 mutants (n = 15/15). krit1 mutant hearts form cardiac cushions and endocardial cushion cells express Alcam. (D) By 96 hpf, Alcam expression is mainly restricted to luminal endocardial cells of the developing WT cardiac valve leaflet (asterisks). (E) krit1 mutants do not form valve leaflets but AVC endocardial cells express Alcam (asterisks). (F) krit1 mutant that was initially rescued by egfp-krit1 mRNA injection has a dysmorphic cardiac valve leaflet at 96 hpf with an agglomeration of luminal Alcam-positive cells (asterisks). (G–L) Whole-mount in situ hybridization of klf2a cardiac expression. (G) At 54 hpf, klf2a expression is restricted to endocardial cells of the AVC in WT while (H) klf2a is strongly expressed throughout the entire endocardium in krit1 mutant. (I) krit1 mutant rescued by injection of egfp-krit1 mRNA has a restricted and strong klf2a expression at the AVC (n = 6/6). (J) By 96 hpf, klf2a expression is restricted to the AVC in WT while (K) klf2a is strongly expressed throughout the entire endocardium in krit1 mutants. (L) krit1 mutant embryo injected with egfp-krit1 mRNA has high klf2a levels throughout the entire endocardium (n = 8/8). A: atrium, V: ventricle, L: luminal, AL: abluminal. Scale bars are 10 μm.

(A–C) Projections of confocal z-stack images of (A) 48 hpf wild-type (WT), (B) krit1 mutant, and (C) rescued krit1 mutant hearts marked by Tg(kdrl:EGFP) expression. In comparison to WT, krit1 mutant hearts are dilated and lack the atrioventricular canal (AVC) (red arrowhead). (C) Injection of egfp-krit1 mRNA into krit1 mutants rescues the krit1 mutant cardiac phenotype (n = 82/82 krit1 mutant embryos rescued). (D–F) Projections of confocal z-stack images of 48 hpf caudal plexus regions of the vasculature marked by Tg(kdrl:EGFP) expression. (D) In comparison to the highly branched WT morphology of the caudal vein plexus (red asterisks), (E) the krit1 mutant vasculature has a fused morphology. (F) Injection of egfp-krit1 mRNA into krit1 mutants rescues the krit1 mutant vascular phenotype including a highly branched WT-like caudal vein plexus (red asterisks). A: atrium, V: ventricle. Scale bars are 50 µm.

Quantification of ventricular endocardial cell numbers reveals normal numbers in rescued krit1 mutants by 48 hpf. At 55 hpf, ventricular endocardial cell numbers in krit1 mutants injected with mRNA encoding EGFP-Krit1 increase considerably compared to wild-type (WT). Mean values ± SEM are shown. ns: not significant, *p<0.05, **p<0.01.

Significant decrease of krit1 levels from 24 to 48 hpf and from 48 to 96 hpf as determined by RT-qPCR. Mean values ± SEM are shown. ns: not significant, *p<0.05, **p<0.01.

(A–C) Projections of confocal z-stack images of 96 hpf embryonic hearts marked by Cadherin 5 (Cdh5) staining. (A’–C’’’) Details are shown in single confocal plane sections of the atrioventricular canal (AVC) region (boxes) of superior cardiac valve leaflets of 96 hpf hearts marked by Tg(kdrl:EGFP) expression (cyan), Cdh5 staining (yellow), and Alcam staining (magenta). (A’–A’’’) At 96 hpf, Alcam and Cdh5 expression is mainly restricted to luminal endocardial cells of the developing wild-type (WT) cardiac valve leaflet (asterisks). (B’–B’’’) krit1 mutants do not form valve leaflets and endocardial cells express Alcam and Cdh5 (asterisks). (C’–C’’’) Injection of egfp-krit1 mRNA into krit1 mutants results in a dysmorphic cardiac valve leaflet at 96 hpf with an agglomeration of luminal leaflet cells marked by Alcam and Cdh5 expression (asterisks) (n = 17/23 krit1 mutants). A: atrium, V: ventricle, L: luminal, AL: abluminal. Scale bars are 50 μm (A–C) and 20 µm (A’–C’’’).

(A) Details of a single confocal plane section of the atrioventricular canal (AVC) region of superior cardiac valve leaflet. A group of krit1 mutants injected with egfp-krit1 mRNA showing a normal distribution of Alcam (magenta) positive luminal endocardial cells by 96 hpf (n = 6/23 krit1 mutants). A: atrium, V: ventricle, L: luminal, AL: abluminal. Scale bars are 10 µm.

Figure 3—figure supplement 1.

Rescue of krit1 mutant cardiovascular phenotypes by injection of mRNA encoding EGPF-Krit1.

(A–C) Projections of confocal z-stack images of (A) 48 hpf wild-type (WT), (B) krit1 mutant, and (C) rescued krit1 mutant hearts marked by Tg(kdrl:EGFP) expression. In comparison to WT, krit1 mutant hearts are dilated and lack the atrioventricular canal (AVC) (red arrowhead). (C) Injection of egfp-krit1 mRNA into krit1 mutants rescues the krit1 mutant cardiac phenotype (n = 82/82 krit1 mutant embryos rescued). (D–F) Projections of confocal z-stack images of 48 hpf caudal plexus regions of the vasculature marked by Tg(kdrl:EGFP) expression. (D) In comparison to the highly branched WT morphology of the caudal vein plexus (red asterisks), (E) the krit1 mutant vasculature has a fused morphology. (F) Injection of egfp-krit1 mRNA into krit1 mutants rescues the krit1 mutant vascular phenotype including a highly branched WT-like caudal vein plexus (red asterisks). A: atrium, V: ventricle. Scale bars are 50 µm.

Figure 3—figure supplement 2.

Injection of mRNA encoding EGFP-Krit1 into krit1 mutants prevents overgrowth of ventricular endocardial cells.

Quantification of ventricular endocardial cell numbers reveals normal numbers in rescued krit1 mutants by 48 hpf. At 55 hpf, ventricular endocardial cell numbers in krit1 mutants injected with mRNA encoding EGFP-Krit1 increase considerably compared to wild-type (WT). Mean values ± SEM are shown. ns: not significant, *p<0.05, **p<0.01.

Figure 3—figure supplement 3.

krit1 expression decreases to a basal level by 96 hpf in rescued embryos.

Significant decrease of krit1 levels from 24 to 48 hpf and from 48 to 96 hpf as determined by RT-qPCR. Mean values ± SEM are shown. ns: not significant, *p<0.05, **p<0.01.

Krit1 is required for abluminal cell fates during valvulogenesis.

(A–F) Single confocal z-section images of endocardial cells within the atrioventricular canal (AVC) region marked by Tg(kdrl:EGFP) expression (cyan) and Alcam staining (magenta). (A) At 48 hpf, wild-type (WT) endocardial cushion cells express Alcam (asterisks). (B) In krit1 mutants, endocardial cells of the AVC region do not express Alcam and cushions do not form (arrow). (C) Injection of egfp-krit1 mRNA rescues cardiac cushion formation in krit1 mutants (n = 15/15). krit1 mutant hearts form cardiac cushions and endocardial cushion cells express Alcam. (D) By 96 hpf, Alcam expression is mainly restricted to luminal endocardial cells of the developing WT cardiac valve leaflet (asterisks). (E) krit1 mutants do not form valve leaflets but AVC endocardial cells express Alcam (asterisks). (F) krit1 mutant that was initially rescued by egfp-krit1 mRNA injection has a dysmorphic cardiac valve leaflet at 96 hpf with an agglomeration of luminal Alcam-positive cells (asterisks). (G–L) Whole-mount in situ hybridization of klf2a cardiac expression. (G) At 54 hpf, klf2a expression is restricted to endocardial cells of the AVC in WT while (H) klf2a is strongly expressed throughout the entire endocardium in krit1 mutant. (I) krit1 mutant rescued by injection of egfp-krit1 mRNA has a restricted and strong klf2a expression at the AVC (n = 6/6). (J) By 96 hpf, klf2a expression is restricted to the AVC in WT while (K) klf2a is strongly expressed throughout the entire endocardium in krit1 mutants. (L) krit1 mutant embryo injected with egfp-krit1 mRNA has high klf2a levels throughout the entire endocardium (n = 8/8). A: atrium, V: ventricle, L: luminal, AL: abluminal. Scale bars are 10 μm.

Rescue of krit1 mutant cardiovascular phenotypes by injection of mRNA encoding EGPF-Krit1.

(A–C) Projections of confocal z-stack images of (A) 48 hpf wild-type (WT), (B) krit1 mutant, and (C) rescued krit1 mutant hearts marked by Tg(kdrl:EGFP) expression. In comparison to WT, krit1 mutant hearts are dilated and lack the atrioventricular canal (AVC) (red arrowhead). (C) Injection of egfp-krit1 mRNA into krit1 mutants rescues the krit1 mutant cardiac phenotype (n = 82/82 krit1 mutant embryos rescued). (D–F) Projections of confocal z-stack images of 48 hpf caudal plexus regions of the vasculature marked by Tg(kdrl:EGFP) expression. (D) In comparison to the highly branched WT morphology of the caudal vein plexus (red asterisks), (E) the krit1 mutant vasculature has a fused morphology. (F) Injection of egfp-krit1 mRNA into krit1 mutants rescues the krit1 mutant vascular phenotype including a highly branched WT-like caudal vein plexus (red asterisks). A: atrium, V: ventricle. Scale bars are 50 µm.

Injection of mRNA encoding EGFP-Krit1 into krit1 mutants prevents overgrowth of ventricular endocardial cells.

Quantification of ventricular endocardial cell numbers reveals normal numbers in rescued krit1 mutants by 48 hpf. At 55 hpf, ventricular endocardial cell numbers in krit1 mutants injected with mRNA encoding EGFP-Krit1 increase considerably compared to wild-type (WT). Mean values ± SEM are shown. ns: not significant, *p<0.05, **p<0.01.

krit1 expression decreases to a basal level by 96 hpf in rescued embryos.

Significant decrease of krit1 levels from 24 to 48 hpf and from 48 to 96 hpf as determined by RT-qPCR. Mean values ± SEM are shown. ns: not significant, *p<0.05, **p<0.01.

Cadherin-5 is misexpressed in krit1 mutant embryonic hearts.

(A–C) Projections of confocal z-stack images of 96 hpf embryonic hearts marked by Cadherin 5 (Cdh5) staining. (A’–C’’’) Details are shown in single confocal plane sections of the atrioventricular canal (AVC) region (boxes) of superior cardiac valve leaflets of 96 hpf hearts marked by Tg(kdrl:EGFP) expression (cyan), Cdh5 staining (yellow), and Alcam staining (magenta). (A’–A’’’) At 96 hpf, Alcam and Cdh5 expression is mainly restricted to luminal endocardial cells of the developing wild-type (WT) cardiac valve leaflet (asterisks). (B’–B’’’) krit1 mutants do not form valve leaflets and endocardial cells express Alcam and Cdh5 (asterisks). (C’–C’’’) Injection of egfp-krit1 mRNA into krit1 mutants results in a dysmorphic cardiac valve leaflet at 96 hpf with an agglomeration of luminal leaflet cells marked by Alcam and Cdh5 expression (asterisks) (n = 17/23 krit1 mutants). A: atrium, V: ventricle, L: luminal, AL: abluminal. Scale bars are 50 μm (A–C) and 20 µm (A’–C’’’).

Krit1 is required for abluminal cell fates during cardiac valve leafet formation.

(A) Details of a single confocal plane section of the atrioventricular canal (AVC) region of superior cardiac valve leaflet. A group of krit1 mutants injected with egfp-krit1 mRNA showing a normal distribution of Alcam (magenta) positive luminal endocardial cells by 96 hpf (n = 6/23 krit1 mutants). A: atrium, V: ventricle, L: luminal, AL: abluminal. Scale bars are 10 µm. During the stage at which cardiac cushions form, we selected egfp-krit1 mRNA injected krit1 mutant embryos with normal blood-flow and found that they had developed normal endocardial cushions by 48 hpf (Figure 3C). Next, we analyzed whether these rescued krit1 mutant embryos would revert to a mutant cardiovascular phenotype by 96 hpf, a point at which endocardial cushions have been transformed via complex cellular rearrangements into double-layered valve leaflets (Beis et al., 2005; Pestel et al., 2016; Scherz et al., 2008; Steed et al., 2016). In WT, those endocardial cells that face the luminal side of the valve leaflet and are exposed to the strongest shear stress, express high levels of klf2a (Steed et al., 2016) and can be identified by strong Alcam (Figure 3D) and Cdh5 expression (Steed et al., 2016) (Figure 3—figure supplement 4A’–A’’’). In comparison, endocardial cells on the abluminal side of the valve leaflet have lower levels of klf2a, (Steed et al., 2016) and Alcam (Figure 3D) and Cdh5 are only weakly expressed in abluminal cells (Figure 3—figure supplement 4A’–A’’’). This is in tune with the more mesenchymal identity ascribed to this endocardial cell population (Pestel et al., 2016; Steed et al., 2016). We found that krit1 mutant embryos with a cardiac rescue that were exposed to normal blood-flow at 48 hpf, developed strongly dysmorphic valve leaflets by 96 hpf (n = 17/23 krit1 mutant embryos). At that stage, most mutants had valve leaflet endocardial cells on the abluminal sides that strongly expressed high levels of Alcam similar to luminal klf2a-positive cells in WT (Figure 3F; n = 17/23 krit1 mutant embryos). In addition, Cdh5 colocalized with Alcam on the abluminal side of dysmorphic valve leaflets (Figure 3—figure supplement 4C’–C’’’). This phenotype corresponded with an agglomeration of endocardial cushion cells with characteristics of luminal cells. We ruled out that the observed phenotype resulted from an egfp-krit1 overexpression effect because krit1 mRNA levels in these rescued embryos had decreased to a basal level of expression by 96 hpf (Figure 3—figure supplement 3). In tune with this observation, untreated krit1 mutants express high levels of Cdh5 throughout the entire endocardium at 96 hpf (Figure 3—figure supplement 4B–B’’’) and Alcam is expressed at high levels within the AVC region (Figure 3E, Figure 3—figure supplement 4B’–B’’’). Only few krit1 mutant embryos had a normal distribution of Alcam-positive luminal endocardial cells by 96 hpf, a phenotype more similar to WT (n = 6/23 krit1 mutant embryos; Figure 3—figure supplement 5). Taken together, the loss of Krit1 mostly resulted in a failure of endocardial cells to acquire mesenchymal-like fates and to generate an abluminal population of valve leaflet cells.
Figure 3—figure supplement 4.

Cadherin-5 is misexpressed in krit1 mutant embryonic hearts.

(A–C) Projections of confocal z-stack images of 96 hpf embryonic hearts marked by Cadherin 5 (Cdh5) staining. (A’–C’’’) Details are shown in single confocal plane sections of the atrioventricular canal (AVC) region (boxes) of superior cardiac valve leaflets of 96 hpf hearts marked by Tg(kdrl:EGFP) expression (cyan), Cdh5 staining (yellow), and Alcam staining (magenta). (A’–A’’’) At 96 hpf, Alcam and Cdh5 expression is mainly restricted to luminal endocardial cells of the developing wild-type (WT) cardiac valve leaflet (asterisks). (B’–B’’’) krit1 mutants do not form valve leaflets and endocardial cells express Alcam and Cdh5 (asterisks). (C’–C’’’) Injection of egfp-krit1 mRNA into krit1 mutants results in a dysmorphic cardiac valve leaflet at 96 hpf with an agglomeration of luminal leaflet cells marked by Alcam and Cdh5 expression (asterisks) (n = 17/23 krit1 mutants). A: atrium, V: ventricle, L: luminal, AL: abluminal. Scale bars are 50 μm (A–C) and 20 µm (A’–C’’’).

Figure 3—figure supplement 5.

Krit1 is required for abluminal cell fates during cardiac valve leafet formation.

(A) Details of a single confocal plane section of the atrioventricular canal (AVC) region of superior cardiac valve leaflet. A group of krit1 mutants injected with egfp-krit1 mRNA showing a normal distribution of Alcam (magenta) positive luminal endocardial cells by 96 hpf (n = 6/23 krit1 mutants). A: atrium, V: ventricle, L: luminal, AL: abluminal. Scale bars are 10 µm.

Krit1 dampens klf2a expression and Notch activation during cardiac valve morphogenesis

Ingression of abluminal cells from cardiac cushions has been associated with a bias in klf2a expression levels: whereas some endocardial cushion cells express high levels of klf2a and contribute to the luminal part of the valve leaflet, others express lower levels of klf2a which correlates with a mesenchymal-like morphology and their contribution to the abluminal portion of the valve leaflet (Steed et al., 2016). Our findings suggest that elevated levels of klf2a mRNA are the cause for defects in valve leaflet morphogenesis. To assess klf2a expression in rescued krit1 mutant hearts, we used whole-mount in situ hybridization. By 54 hpf, klf2a was strongly expressed within cardiac cushions at the AVC, whereas in other regions of the endocardium expression levels were lower or undetectable (Figure 3G). In krit1 mutants, klf2a was strongly expressed throughout the entire endocardium and was not restricted to the AVC (Figure 3H). At 54 hpf, in krit1 mutant embryos that were rescued by injection of mRNA encoding EGFP-Krit1, the expression of klf2a had a normal pattern with a localized strong expression at the AVC cushions (n = 6/6) (Figure 3I). However, by 96 hpf, the expression of klf2a was not restricted to the AVC and outflow tract regions of the endocardium as in WT (Figure 3J) but had reverted to wide and strong expressionpresent throughout the entire endocardium (n = 8/8) (Figure 3L). klf2a is a regulator of notch1b expression at cardiac cushions (Vermot et al., 2009). In addition, several studies have demonstrated that the reduction of CCM protein levels is associated with decreased Notch activity in human endothelial cells (Wüstehube et al., 2010; You et al., 2013). Hence, changes in Notch activity may contribute to defective cardiac valve leaflet morphogenesis in ccm mutants. To address this question, we first assessed notch1b expression by whole-mount in situ hybridization. At 48 hpf, notch1b was strongly expressed within high shear stress regions including the AVC of the WT heart (Figure 4A). In contrast, notch1b was expressed throughout the entire endocardium in krit1 mutant embryos (Figure 4B). Next, we characterized Notch signaling activity using the Tg(TP1:VenusPEST) reporter. In WT, Notch activity was in a mosaic pattern within endocardial cushions and a few cushion cells neighboring the ventricle were consistently downregulating Notch activity (Figure 4C’; n > 30 embryos analyzed). Those cells lacking Notch activity were in positions that have been shown to initiate endocardial sprouting behaviors and to contribute to formation of the abluminal portion of the cardiac valve leaflets (Steed et al., 2016). In striking contrast, in ccm2 and krit1 mutants, Notch reporter expression was expanded throughout large regions of the endocardium (Figure 4D, Figure 4—figure supplement 1B), and was especially active within all endocardial cells at the AVC region which demonstrated that a singling-out process and downregulation of Notch signaling among few cushions cells did not occur (Figure 4D’; n > 30 embryos analyzed). In comparison, the expression of tbx2b, another AVC marker gene (Sedletcaia and Evans, 2011), was not expanded in ccm2 mutants (Figure 4—figure supplement 1C–D). Hence, expansion of notch1b expression domain in ccm2 or krit1 mutants is not a result of regional expansion of the AVC. Taken together, our findings suggest a critical role for Krit1 in modulating expression levels of klf2a and for Notch signaling among endocardial cushion cells which may control endocardial sprouting during the formation of cardiac valve leaflets.
Figure 4.

Notch activity within endocardial cushion cells is affected in ccm mutants.

(A, B) Whole-mount in situ hybridization of notch1b cardiac expression at 48 hpf. (A) notch1b expression is restricted to endocardial cells of the atrioventricular canal (AVC) in wild-type (WT), while notch1b is strongly expressed throughout all ventricular cells in krit1 mutants (B). (C, D) Projections of single confocal z-section images of endocardial cells marked by Tg(TP1:VenusPEST) expression (yellow) and Alcam staining (magenta) at 54 hpf. (C) In WT, Notch activity is highest in endocardial cells of the AVC and outflow regions. (C’) Single confocal plane section of the AVC (white box in C) reveals that some endocardial cells close to the ventricle lack Notch activity (asterisks). (D) In ccm2 mutants, the domain of high Notch activity is expanded to most ventricular endocardial cells. (D’) Single confocal plane section of the AVC region (box in D, arrow) shows high Notch expression in all endocardial cells of the AVC region. A: atrium, V: ventricle, Scale bars are 50 μm (C, D), and 10 µm (C’, D’).

(A, B) Projections of confocal z-stack images of embryonic hearts marked by Tg(TP1:VenusPEST) expression (yellow), Myh6 staining (cyan), and Actin staining (magenta) at 54 hpf. (A) In wild-type (WT), Notch activity is highest in endocardial cells of the atrioventricular canal (AVC) and outflow regions. (B) In krit1 mutants, the domain of high Notch activity is expanded to ventricular and atrial endocardial cells. (C, D) Whole-mount in situ hybridization of tbx2 cardiac expression at 48 hpf. (A) Tbx2 expression is restricted to the atrioventricular canal (AVC) both in wild-type (WT) and in ccm2 mutants (B). Arrowheads point at the AVC. A: atrium, V: ventricle, Scale bars are 50 μm (A, B).

Figure 4—figure supplement 1.

The region of Notch activity within the endocardium is expanded in krit1 mutants.

(A, B) Projections of confocal z-stack images of embryonic hearts marked by Tg(TP1:VenusPEST) expression (yellow), Myh6 staining (cyan), and Actin staining (magenta) at 54 hpf. (A) In wild-type (WT), Notch activity is highest in endocardial cells of the atrioventricular canal (AVC) and outflow regions. (B) In krit1 mutants, the domain of high Notch activity is expanded to ventricular and atrial endocardial cells. (C, D) Whole-mount in situ hybridization of tbx2 cardiac expression at 48 hpf. (A) Tbx2 expression is restricted to the atrioventricular canal (AVC) both in wild-type (WT) and in ccm2 mutants (B). Arrowheads point at the AVC. A: atrium, V: ventricle, Scale bars are 50 μm (A, B).

Notch activity within endocardial cushion cells is affected in ccm mutants.

(A, B) Whole-mount in situ hybridization of notch1b cardiac expression at 48 hpf. (A) notch1b expression is restricted to endocardial cells of the atrioventricular canal (AVC) in wild-type (WT), while notch1b is strongly expressed throughout all ventricular cells in krit1 mutants (B). (C, D) Projections of single confocal z-section images of endocardial cells marked by Tg(TP1:VenusPEST) expression (yellow) and Alcam staining (magenta) at 54 hpf. (C) In WT, Notch activity is highest in endocardial cells of the AVC and outflow regions. (C’) Single confocal plane section of the AVC (white box in C) reveals that some endocardial cells close to the ventricle lack Notch activity (asterisks). (D) In ccm2 mutants, the domain of high Notch activity is expanded to most ventricular endocardial cells. (D’) Single confocal plane section of the AVC region (box in D, arrow) shows high Notch expression in all endocardial cells of the AVC region. A: atrium, V: ventricle, Scale bars are 50 μm (C, D), and 10 µm (C’, D’).

The region of Notch activity within the endocardium is expanded in krit1 mutants.

(A, B) Projections of confocal z-stack images of embryonic hearts marked by Tg(TP1:VenusPEST) expression (yellow), Myh6 staining (cyan), and Actin staining (magenta) at 54 hpf. (A) In wild-type (WT), Notch activity is highest in endocardial cells of the atrioventricular canal (AVC) and outflow regions. (B) In krit1 mutants, the domain of high Notch activity is expanded to ventricular and atrial endocardial cells. (C, D) Whole-mount in situ hybridization of tbx2 cardiac expression at 48 hpf. (A) Tbx2 expression is restricted to the atrioventricular canal (AVC) both in wild-type (WT) and in ccm2 mutants (B). Arrowheads point at the AVC. A: atrium, V: ventricle, Scale bars are 50 μm (A, B).

Discussion

Our study establishes CCM proteins as having an important role in endothelial mechanosensitive signaling. We report that levels of heg1 mRNA expression are positively regulated by blood-flow in a Klf2-dependent manner and that Heg1 stabilizes Krit1 protein levels. We also show that overexpression of Heg1 and Krit1 dampens expression of klf2a mRNA. This establishes a negative feedback loop that desensitizes endothelial cells to blood-flow-induced mechanosensitive signaling by dampening expression levels of klf2a. The fine-tuning of blood-flow-sensitive responses is particularly important during developmental processes such as cardiac valvulogenesis, which involves establishment of regionalized differences in klf2a expression levels (Steed et al., 2016). While the endocardial cells facing the lumen of the heart experience high fluid shear forces, and consequently begin to express high levels of klf2a, those on the other side do not. In tune with this observation, the process of valvulogenesis is critically dependent on the biophysical stimulus by blood-flow (Beis et al., 2005; Heckel et al., 2015; Pestel et al., 2016; Steed et al., 2016) and is affected by the loss of klf2a (Steed et al., 2016). Hence, mechanosensitive signaling pathways actively reshape cardiac valve leaflets in a manner that is highly sensitive to constantly changing blood-flow conditions. The present work suggests that Krit1 plays an important role in modulating expression levels of klf2a during this complex morphogenetic process. Our results suggest that downregulation of endocardial mechanosensitivity by CCM proteins generates a bias in expression levels of klf2a which is critical for correct valvulogenesis. In accordance with our findings, expression of the KRIT1-CCM2-associated protein CCM2L has also been reported in a blood-flow-dependent manner (Cullere et al., 2015). In a complex with KRIT1 and CCM2, CCM2L directly binds to the MAP kinase MEKK3 and inhibits its activation. This reduces the ability of MEKK3 to phosphorylate MEK5 which is required to activate ERK5 (Cullere et al., 2015). The MEKK3-MEK5-ERK5 pathway is involved in activation of KLF2 expression (Zhou et al., 2015; Zhou et al., 2016), the control of endoMT (reviewed in Drew et al., 2012), and murine cardiovascular development (Yang et al., 2000; reviewed in Rose et al., 2010). Activation of klf2a expression and control of endoMT processes could be particularly important during formation of functional cardiac valve leaflets. Within abluminal endocardial cells of the zebrafish cardiac valve leaflet, the loss of Krit1 prevents downregulation of Cdh5 and Alcam proteins, a function that might ultimately be related to elevated levels of Klf2a. As yet, no blood-flow-independent mechanism has been identified that would trigger such an upregulation of Klf2a in the absence of Ccm proteins (see model, Figure 5). As Klf2a regulates the expression of endocardial notch1b within endocardial cushions (Vermot et al., 2009), the formation of abluminal valve leaflets may be regulated by a Notch-dependent lateral inhibition process similar to angiogenic sprouting of tip cells. Whereas high klf2a expression corresponds to expression of the endothelial junctional proteins Cdh5 and Alcam within luminal endocardial valve cells, abluminal endocardial cells that are shielded from blood-flow and express lower levels of klf2a and notch1b downregulate the expression of Cdh5 (Steed et al., 2016) and Alcam and acquire a more mesenchymal-like state. Several publications have discussed the possibility that downregulation of Cdh5 and Alcam in abluminal endocardial cells and the behaviour of these endocardial cells during zebrafish valvulogenesis (Beis et al., 2005; Lagendijk et al., 2011; Scherz et al., 2008; Steed et al., 2016) is highly reminiscent of the endoMT process that occurs during cardiac valve formation in the mouse (Chiplunkar et al., 2013). Our findings now implicate CCM proteins in providing a bias in klf2a and notch1b expression levels within cardiac cushions, which may be further elaborated by Notch-dependent lateral inhibition that could allocate cells to an abluminal fate (see model, Figure 5). In tune with such a model, Notch activity was in a mosaic pattern within WT endocardial cushions, while in ccm mutants, Notch signaling was widely active. Interestingly, pharmacological inhibition of Notch signalling has been shown to cause similar cardiac valve leaflet morphogenesis defects (Beis et al., 2005). Hence, it remains an important question for future research to elucidate whether Notch-dependent endocardial sprouting morphogenesis and/or endoMT are involved in the process of valve leaflet formation.
Figure 5.

Model of the molecular pathways involved in endocardial cushion cell sprouting at 54 hpf.

In wild-type, endocardial cells exposed to blood-flow have high levels of Klf2a, Notch, Alcam, and maintain cell adhesion. Ccm proteins provide a bias in Klf2a and Notch expression levels. Some cells that express lower levels of klf2a and have lower Notch activity establish protrusions and migrate into the cardiac jelly (endocardial sprouting). In ccm mutants, endocardial cells overexpress klf2a and have higher Notch activity because of a blood-flow-independent mechanism. As a consequence, high levels of Notch activity throughout the entire endocardium result in failure of endocardial sprouting.

Model of the molecular pathways involved in endocardial cushion cell sprouting at 54 hpf.

In wild-type, endocardial cells exposed to blood-flow have high levels of Klf2a, Notch, Alcam, and maintain cell adhesion. Ccm proteins provide a bias in Klf2a and Notch expression levels. Some cells that express lower levels of klf2a and have lower Notch activity establish protrusions and migrate into the cardiac jelly (endocardial sprouting). In ccm mutants, endocardial cells overexpress klf2a and have higher Notch activity because of a blood-flow-independent mechanism. As a consequence, high levels of Notch activity throughout the entire endocardium result in failure of endocardial sprouting. Taken together, our findings uncover crucial roles of Heg1 and Krit1 in controlling the sensitivity of endothelial cells to hemodynamic forces. This may promote developmental adaptations in response to changes in the strength of hemodynamic forces that occur during cardiovascular development. Within the early zebrafish heart tube, shear forces resulting from blood-flow increase rapidly within the first 4–5 days post fertilization (Hove et al., 2003). Similar changes in blood-flow dynamics also occur during the remodelling of the vasculature or during pathological changes of blood-flow patterns. It will be important to assess the physiological roles of CCM proteins during these different adaptations of the vasculature.

Materials and methods

Zebrafish genetics and maintenance

Handling of zebrafish was done in compliance with German and Brandenburg state law, carefully monitored by the local authority for animal protection (LUVG, Brandenburg, Germany; Animal protocol #2347-18-2015). The following strains of zebrafish were maintained under standard conditions as previously described (Westerfield et al., 1997): krit1 (Mably et al., 2006), ccm2 (Driever et al., 1996), Tg(EPV.Tp1-Mmu.Hbb:Venus-Mmu.Odc1) [here referred to as Tg(TP1:VenusPEST)] (Ninov et al., 2012), Tg(kdrl:EGFP) (Jin et al., 2005), Tg(fli1a:GAL4FF) (Herwig et al., 2011). Some embryos were treated with 1-phenyl-2-thiourea (PTU) (Sigma Aldrich) prior to the appearance of pigmentation.

Morpholino injections

The following morpholinos were used: tnnt2a (5’-CATGTTTGCTCTGATCTGACACGCA-3’) (2 ng/embryo) (Sehnert et al., 2002), klf2a (5’-CTCGCCTATGAAAGAAGAGAGGATT-3’) (1 ng/embryo) (Nicoli et al., 2010), klf2b (5’-AAAGGCAAGGTAAAGCCATGTCCAC-3’) (5 ng/embryo) (Renz et al., 2015), heg1 (5’-GTAATCGTACTTGCAGCAGGTGACA-3’) (5 ng/embryo) (Mably et al., 2003).

Molecular cloning

The open reading frames of zebrafish krit1 (NM_001317001), klf2a (NM_131856), and ccm2 (NM_001002315) were amplified by PCR and cloned into the Gateway pDONR221 vector (referred to as pME-krit1, pME-klf2a, and pME-ccm2, respectively). To generate the krit1 fusion plasmids, EGFP was fused in the N-terminal site of krit1 (pME-EGFP-krit1). These middle entry constructs were used in combination with the following Gateway plasmids to generate final constructs by standard Gateway cloning recombination reactions: pDestTol2 (#426, obtained from N. Lawson), p5E-hsp70l (#222, obtained from N. Lawson), p5E-CMV/SP6 (#382, obtained from Chien, Univ. Utah), p5E-UAS (#327, obtained from Chien, Univ. Utah), p3E-IRES_EGFPpA (#389, obtained from N. Lawson), p3E-cryaa:EGFPpA, p3E-EGFPpA (#366, obtained from Chien, Univ. Utah), p3E-pA (#383, obtained from Chien, Univ. Utah). Final plasmids: pDest_Tol2pA_Hsp70l:Krit1_IRES_EGFPpA, pDest_Tol2pA_Hsp70l:Ccm2_IRES_EGFPpA, pDest_Tol2pA_Hsp70l:Klf2a_IRES_EGFPpA, pDest_Tol2pA_UAS:EGFP-Krit1pA,cryaa:EGFPpA, pDest_Tol2pA_CMV/SP6:EGFP-Krit1pA.

Generation of transgenic lines of zebrafish

Transformation plasmids (25 pg/embryo) were co-injected together with mRNA encoding Tol2 transposase (50 pg/embryo) into one-cell-stage zebrafish embryos. Several independent transgenic lines were established for each construct. In functional tests and localization studies, these independent lines resulted in comparable phenotypes. One transgene for each construct was selected for further analyses: Tg(hsp70l:Krit1_IRES_EGFP)md6 Tg(hsp70l:Ccm2_IRES_EGFP)md12 Tg(hsp70l:Klf2a_IRES_EGFP)pbb22 Tg(UAS:EGFP-Krit1,cryaa:EGFP) [here referred to as Tg(UAS:EGFP-Krit1)]

Heat-shock experiments

To assess levels of klf2a mRNA following krit1 overexpression, Tg(hsp70l:Krit1_IRES_EGFP) was crossed to wild-type and the resulting embryos were heat-shocked at 14 hpf (30 min at 37°C), at 24 hpf (40 min at 38°C), and at 40 hpf (45 min at 38°C). Alternatively, for the experiment shown in Figure 2C,D, embryos obtained from Tg(hsp70l:Krit1_IRES_EGFP) or Tg(hsp70l:Ccm2_IRES_EGFP) crossed to Tg(TP1:VenusPEST) were additionally heat-shocked at 48 hpf (45 min at 38°C). For the experiment shown in Figure 1B, Tg(hsp70l:Klf2a_IRES_EGFP) were crossed to wild-type and the resulting embryos were heat-shocked at 48 hpf (45 min at 38°C).

mRNA injection experiments

Capped mRNA encoding EGFP-Krit1 or Heg1 was synthesized using SP6 polymerase (mMessage Machine kit, Ambion). For rescue experiments, 150 pg of egfp-krit1 mRNA was injected into one-cell-stage zebrafish embryos. Embryos were selected for EGFP fluorescence at 6 hpf and the genotype was assessed by sequencing. For heg1 overexpression, 100 pg of heg1 mRNA was injected into one-cell-stage zebrafish embryos.

Statistical analysis of the efficiency of mRNA rescue experiments

Statistical analysis of the efficiency of egfp-krit1 mRNA rescue experiments (as shown in Figure 3—figure supplement 1) was done using GraphPad Prism6 (Student’s t-test, p=0.008 and p=0.005, respectively). Statistical analysis of the rescue efficiency of egfp-krit1 mRNA injection into krit1 mutant embryos was based on the presence of blood-flow at 48 hpf for all embryos, and at 96 hpf for those embryos that had blood-flow at 48hpf. The percentages of embryos with blood-flow was recorded for three individual experiments and compared with GraphPad Prism6, using a 2way ANOVA with Multiple comparisons without correction.

Quantifications of ventricular endocardial cell numbers

Endocardial cell numbers of the ventricles at 48 hpf and 55 hpf of WT and krit1 mutants were quantified as previously shown (Renz et al., 2015). Nuclei were visualized by Tg(kdrl:GFP) expression and were counted within the ventricle (for endocardium). Cell numbers are shown as means with SEM. Prism 6 (GraphPad) was used to perform an unpaired t-test (Figure 3—figure supplement 2). Means are significantly different when p<0.05.

Whole-mount immunohistochemistry and in situ hybridization

Zebrafish whole-mount immunohistochemistry was performed on 30 hpf, 48 hpf, 54 hpf, and 96 hpf embryos as previously described (Renz et al., 2015). The following antibodies were used: rabbit anti-VE-Cadherin (Cdh5) (1:200, a kind donation from Markus Affolter, Basel) (Blum et al., 2008), mouse anti-Zn-8/Alcam (1:25, Developmental Studies Hybridoma Bank), and mouse anti-Myh6 (1:10, Developmental Studies Hybridoma Bank, S46). Secondary antibodies were Alexa Fluor 633-conjugated goat anti-rabbit (1:200, Invitrogen A21070), Rhodamine Red-X-conjugated goat anti-mouse (1:200, Jackson ImmunoResearch Laboratories 115-295-003), and Dylight 649-conjugated goat anti-mouse (1:200, Jackson ImmunoResearch Laboratories 115-495-003). Rhodamine-Phalloidin (1:250, Invitrogen R415) was incubated together with secondary antibodies. For Cdh5 antibody staining, embryos were fixed with 2% PFA overnight and permeabilized with PBST with 0.5% Triton X-100 for 1 hr and subsequently incubated with primary antibody diluted in PBST with 0.2% Triton X-100, 1% BSA, and 5% NGS. All specimens were mounted in SlowFade Gold (Invitrogen S36936). Images were recorded on LSM 710, or LSM 780 confocal microscopes (Zeiss) and processed with Imaris (Bitplane, Version 8.1) or Fiji software (Schindelin et al., 2012). Whole-mount in situ hybridization experiments were performed as previously described (Jowett and Lettice, 1994). For all experiments embryos were fixed overnight with 4% PFA. For Figures 3G–L, 54 hpf and 96 hpf embryos were stained with a klf2a probe previously published (Renz et al., 2015). For Figures 4A–B, 48 hpf embryos were stained with a notch1b probe previously published (Walsh and Stainier, 2001) (the plasmid was a kind gift from Didier Stainier). For Figure 1—figure supplements 1, 30 hpf and 48 hpf embryos were stained with a heg1 probe previously published (Münch et al., 2017). For Figure 4—figure supplements 1C–D, 48 hpf embryos were stained with a tbx2b probe (Sedletcaia and Evans, 2011). Images were recorded with 10x or 20x objectives on an Axioskop (Zeiss) with an EOS 5 D Mark III (Canon) camera, and processed using Adobe Bridge and Photoshop (Adobe Systems).

Live imaging

Embryos were dechorionated manually and embedded in 1% low melting agarose (Lonza 50081) containing 0.16 mg/ml Tricaine (3-amino benzoic acidethylester, Sigma-Aldrich A-5040). Images were recorded with a LSM 710 confocal microscope (Zeiss) at 10x.

Ratiometric corrected total tissue fluorescence (CTTF) image analysis

The ratiometric measurements of Tg(TP1:VenusPEST) fluorescence in atrium versus ventricle and AVC of the embryonic heart (Figure 2E) was done as previously described (McCloy et al., 2014). As overexpression of krit1 also resulted in an upregulation of EGFP, the overlap of EGFP with Tg(TP1:VenusPEST) fluorescence was safely separated into two different channels by recording the images using the online fingerprinting function of the Zen 8.1 Software (Zeiss). Images were acquired maintaining fixed recording settings. From a 3D confocal image, the z-portion corresponding to the entire heart was selected. Regions of single z-planes corresponding to atrium or to ventricle plus the AVC were selected and fluorescence was measured until entire hearts were covered. The corrected total tissue fluorescence [CTTF = integrated density – (area of selected tissue x mean fluorescence of background readings)] was calculated using Excel 2010 (Microsoft Office). Next, all CTTF values collected for atrium as well as for ventricle plus AVC of each heart were averaged. The mean of atrium CTTF values was divided by the mean of ventricle plus AVC CTTF values. A mean value of 1 corresponds to an equal expression of Tg(TP1:VenusPEST) in both heart chambers. All measurements and tissue selection were performed using Fiji software (Schindelin et al., 2012). Statistical analysis was done with Excel 2010 (Microsoft Office) using an unpaired t-test (n: number of hearts analyzed, hs: heat-shock, *p<0.05, **p<0.01). To quantify the fluorescent levels of Tg(TP1:VenusPEST) in the AVC of WT (heat-shock control) (Figure 2F), hs:Krit1 and hs:Ccm2, a section of 20 µm corresponding to the entire AVC was selected from a maximum projection of confocal z-stacks of the AVC. The CTTF value of each AVC was measured and all the values were divided by the average CTTF of the controls for normalization. To quantify the fluorescent levels of EGFP-Krit1 in WT and heg1 morphants, maximum projections of confocal z-stacks of manually extracted 30 hpf hearts (Figure 1C–E) or of the caudal plexus region (Figure 1—figure supplement 2) were used. The background intensity was measured in five different areas of each image. To measure the caudal plexus region, an area between two intersegmental vessels from the most dorsal to the most ventral side of the caudal plexus was selected. This was repeated in three different areas for each embryo. All measurements and tissue selection were performed using Fiji software (Schindelin et al., 2012). The CTTF was calculated using Excel 2010 (Microsoft Office). All the values were divided by the average intensity of the controls.

Quantifications of mRNA expression by RT-qPCR

For RT-qPCR experiments, 25 zebrafish embryos were pooled for each condition (three biological replicates). For heat-shock conditions, controls of each biological replicate were composed of heat-shocked siblings from the same clutch lacking EGFP expression. Total RNA was extracted with Trizol (Sigma) and Phase Lock Gel Heavy tubes (1.5 mL, Prime 5) and the corresponding cDNA was synthesized from total RNA with the RevertAid H Minus First Strand cDNA Synthesis kit (ThermoFisher Scientific). RT-qPCR experiments were performed as described (Renz et al., 2015) using 18 ng cDNA per technical replicate and the KAPA Sybr Fast qPCR kit (Peqlab) on a PikoReal 96 Real-Time PCR System (ThermoFisher Scientific). Cycle threshold (Ct) values were determined by PikoReal software 2.2 (ThermoFisher Scientific). eif1b was used as a housekeeping gene. The following primers were used for qRT-PCR: Results were analyzed using the comparative threshold cycle method (2–ΔΔCt) to compare gene expression levels between samples as previously described (Livak and Schmittgen, 2001). As an internal reference, we used zebrafish eif1b (Renz et al., 2015). Control sample values were normalized to 1. In the table below, the mean of the fold changes and the corresponding SEM of each biological replicate after normalization is shown. As each single biological replicate represents an independent experiment from an independent clutch of embryos, ratio paired t-tests were done with Prism 6 (GraphPad) (Stg: developmental stage of zebrafish embryos at RNA extraction, n: number of independent biological replicates analyzed, *p<0.05, **p<0.01, hs: heat-shock, mean >1 corresponds with target upregulation; mean <1 represents target downregulation). To prove that differences in average values of krit1 mRNA levels between 24 hpf and 48 hpf, 48 hpf and 96 hpf, 24 hpf and 96 hpf were significant, a ratio paired t-test was performed, as in each single biological replicate, embryos of 24, 48, and 96 hpf were from the same clutches. The mean of the ratio indicated in the table below is always between 1 and 0, and this accounts for target downregulation. In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included. Thank you for submitting your article "CCM proteins control endocardial mechanosensitivity during zebrafish valvulogenesis" for consideration by eLife. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Marianne Bronner as the Senior Editor. The following individuals involved in review of your submission have agreed to reveal their identity: Ian C Scott (Reviewer #1); Dimitris Beis (Reviewer #3). The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission. Summary: In this manuscript, Donat and colleagues investigate the roles of the CCM-associated genes heg1 and krit1 during atrioventricular valve leaflet formation in the endocardium of the developing zebrafish heart. The authors first show that heg1 transcripts are positively regulated by blood flow. Heg1 in turn acts to stabilize Krit1, and these genes repress klf2a, a major mechanosensitive gene. As a result, the absence of Heg1 and Krit1 function leads to overexpression of klf2a and mis-activation of Notch signaling throughout the endocardium, which impairs valve leaflet formation. Overall, the authors present a model where Heg1/Krit1/CCM2 "establishes a negative feedback loop that desensitizes endothelial cells to blood flow-induced mechanosensitive signaling by dampening expression levels of Klf2a". As the links between Heg/Krit1/CCM2 and Klf2a/Notch have been previously described (including by Dr. Abdelilah-Seyfried), the most novel element of this model is the implication of the Heg1/Krit1/CCM2 pathway in valve leaflet development, with its potential function being a means to fine-tune the response to flow during valve development. This is an interesting model, particularly in terms of providing a mechanistic link between blood flow and specific features of cardiac morphology, and it would therefore be of interest to the readers of eLife. However, there are a number of caveats inherent in the authors' experimental design and results, and further work is needed to fully support the authors' interpretations and conclusions. Essential revisions: 1) Most of the expression data is supported by quantitative PCR (i.e. Figure 1A and B, Figure 2A) on vascular endothelial cells. This technique, although quantitative, does not provide any information about the localization of the expression of the studied genes. Whole mount in situ hybridizations would greatly help to reveal spatial differences in the expression of these genes, particularly in the heart. Ideally, qPCR should be performed in isolated AV endocardial cells, given the focus of the manuscript. 2) Figure 1: The stabilization of Krit1 protein by Heg1 is shown in trunk vessels, yet this research is focused on valve development. This should be analyzed in the AVC. Additionally, the conclusion that Heg1 stabilizes the levels of Krit1 is based on an experiment using a Gal4-UAS system that overexpresses EGFP-Krit1. Thus, it is somewhat challenging to draw a meaningful conclusion about the ability of Heg1 to stabilize Krit1 protein levels from these non-physiologic studies. Western analysis would be a better approach in determining Krit1 levels in heg1 morphant and wild-type hearts. 3) Figure 2: The evidence that "endocardial cells become desensitized to blood flow-induced mechanosensitive signaling when krit1 or ccm2 are overexpressed" is not compelling. The authors state that hearts with CCM1/2 overexpression resemble silent heart morphant (no flow) hearts, and that the atrium/ventricle flt1:YFP expression ratio is increased over time, but this may simply reflect aberrant heart development rather than a specific desensitization. In addition, the authors' use of flt1:YFP as a reporter of flow responses is based on the prior studies of Hogan, which were focused on the vascular endothelium. However, the ability of this line to sense hemodynamic flow has not been validated in the heart. Particularly concerning is the expression of flt1:YFP in the ventricle of the tnnt2a MO hearts. Is this endocardial or myocardial expression that is observed? Using endocardial and myocardial lines in combination with the flt1:YFP might help resolve these issues. Performing studies to validate the ability of this line to sense hemodynamic flow in the heart would help with interpretation of studies as well. 4) Although the authors conclude that notch1b is expressed throughout the endocardium in the krit1 mutant, the notch1b in situs and the notch reporter do not support this interpretation. It is possible that the AVC region is expanded in the krit1 mutant. How are the authors defining the AVC? Without atrial, ventricular or AV boundary markers, it is difficult to determine where the endocardial cushions are in the krit1 mutant. Providing this data would help with interpretation of the studies. In addition, it would be useful to examine the ccm2 mutant in addition to the krit1 mutant, to strengthen the demonstration of how loss of ccm genes affects endocardial notch activation. 5) The studies on the overexpression of exogenous mRNA of egfp-krit1 in the krit1 mutant do not have sufficient controls and validation of assays to allow for a meaningful interpretation. Many assumptions are made in order for the authors to come to their conclusions. For example, there is insufficient evidence to show that injected mRNA is no longer present at 55 or 96 hpf. Moreover, over/mis-expression of krit1 may lead to a phenotype irrespective of the krit1 mutant. In fact, the phenotype is surprisingly similar to that found in late Notch inhibition and in the klf2a mutant (Beis et al., 2005, Steed et al., 2016). 6) It would be beneficial to provide further support for the requirement of Krit1 for the generation of abluminal cell fates during valvulogenesis. The transient rescue of krit1 mutants allows AVC endocardial cells to differentiate properly at 48 hpf. Alcam levels do appear higher in most AVC cells at 96 hpf (Figure 3F, duplicated in Figure 3—figure supplement 4C’) but the morphology of the AV valve seems to also include abluminal cells (cardiac jelly cells or mesenchymal-like cells). Repeating the experiment in combination with a Wnt signaling readout (TCF reporter or other) and/or using the inducible hs:Krit1 line in the krit1 mutant background to better control krit1 levels, would strengthen their claim. 7) The model in Figure 5 is somewhat confusing. It might be helpful to show a model for the ccm mutant with blood flow and then when there is no blood flow. Based on the authors' current model, it seems that Notch would be activated throughout the endocardium in the ccm mutant with blood flow since ccm is not present to block klf2a expression. If this is the case, this seems to be in conflict with the current ccm mutant and no blood flow model where the lack of blood flow would lead to no klf2a expression and downstream Notch signaling. Additionally, the authors also speculate "Notch-mediated lateral inhibition" in their model; however, there is insufficient data to support this notion. This should be modified in the model. [Editors' note: further revisions were requested prior to acceptance, as described below.] Thank you for resubmitting the revised version of your manuscript entitled "CCM proteins control endocardial mechanosensitivity during zebrafish valvulogenesis" for further consideration at eLife. Your revised manuscript has now been favorably evaluated by Marianne Bronner (Senior editor), a Reviewing editor, and its original three reviewers. The reviewers appreciate the improvements made in your revised manuscript, but they have also raised several issues that remain to be addressed through further revision, as outlined below. 1) The Abstract is confusing in its current form, as it is not made clear in which direction many of the genes/pathways mentioned affect outcome. As an example: does the abstract make it clear whether heg1 expression is increased or reduced by low blood flow? The last paragraph of the Introduction section is similarly vague and does not refer to the heg1 results. 2) In the Title, it may be better to mention CCM1/2, since CCM3 is not addressed in this study. Non-CCM experts may not appreciate what "CCM proteins" are. 3) From the data shown in the revised manuscript, it is not clear whether heg1 is expressed in the endocardium or the myocardium, although it is stated that it is expressed in the endocardium. Can the evidence for this be clarified? 4) The use of the Notch reporter, in place of the previous Flt reporter, to monitor flow response is appreciated. However, the images in Figure 2B–D are hard to interpret. Although the ratios measured by the authors (Figure 2E–F) demonstrate the same trend following overexpression of Krit1 and Ccm2, the patterns of expression shown in Figure 2C–D seem markedly different; hard to interpret. This apparent discrepancy should be addressed. In addition, in light of recent studies showing myocardial Notch reporter activity in developing zebrafish hearts, it is unclear whether the Notch reporter activity shown here (and in Figure 4) is endocardial or myocardial. Can this be clarified? 5) The authors utilize Cdh5 as a marker for the lumenal side of the AV valve, but they do not cite references for its use as a lumenal marker. If they are introducing this marker here, its characterization as such should be clearly described. 6) In Figure 4—figure supplement 1, the authors use a single marker (Myh6) to define the location of the AVC in krit1 mutants. This marker indicates the edge of the atrium but isn't sufficient to demonstrate whether the AVC is or isn't expanded in the mutant hearts. Can the authors use specific AVC markers to indicate whether the AVC region is expanded in krit1 mutants? 7) At the beginning of the Discussion section, the authors allude to evidence that Cdh5/VEcadherin plays into this pathway, but such evidence is not reported in this manuscript. 8) The new model figure is appreciated, but, in light of what is suggested by Figure 1, it does not address the effect of flow on Heg1 and Krit1 levels. This is confusing – can it be revised to include these elements of the model? Essential revisions: 1) Most of the expression data is supported by quantitative PCR (i.e. Figure 1A and B, Figure 2A) on vascular endothelial cells. This technique, although quantitative, does not provide any information about the localization of the expression of the studied genes. Whole mount in situ hybridizations would greatly help to reveal spatial differences in the expression of these genes, particularly in the heart. Ideally, qPCR should be performed in isolated AV endocardial cells, given the focus of the manuscript. Within the revised version of the manuscript, we now provide expression data of heg1 mRNA (Figure 1—figure supplement 1). Consistent with a blood-flow responsive expression, heg1 mRNA has a stronger expression at the AVC and in the ventricle at 48 hpf. In support of our finding, another study reported a similar pattern of heg1 mRNA cardiac expression recently (Münch et al., 2017). We are now also referring to this work in our revised manuscript. The expression of krit1 has been published previously (Mably et al.,2006) and, similar to that study, we have not found any regional expression of krit1 that would point at a blood-flow responsive regulation. This finding is in tune with the fact that krit1 mRNA levels are not affected in tnnt2a morphants as assayed by RT-qPCR. This lends further support to an important role particularly of heg1 in response to biomechanical stimuli. The reviewers’ suggestion to use isolated AVC endocardial cells for RT-qPCR experiments is very good but technically very challenging. Unfortunately, we have not been able yet to establish a technology for AVC dissection. 2) Figure 1: The stabilization of Krit1 protein by Heg1 is shown in trunk vessels, yet this research is focused on valve development. This should be analyzed in the AVC. Additionally, the conclusion that Heg1 stabilizes the levels of Krit1 is based on an experiment using a Gal4-UAS system that overexpresses EGFP-Krit1. Thus, it is somewhat challenging to draw a meaningful conclusion about the ability of Heg1 to stabilize Krit1 protein levels from these non-physiologic studies. Western analysis would be a better approach in determining Krit1 levels in heg1 morphant and wild-type hearts. Within revised Figure 1C–D, we now show that EGFP-Krit1 levels are significantly reduced within the heart. This finding is in tune with the changes of EGFP-Krit1 levels within the vasculature (now shown in Figure 1—figure supplement 2). Due to the lack of an antibody that recognizes zebrafish Krit1, it has remained a challenge to quantify the physiological levels of Krit1 upon loss of Heg1. To assess physiological levels of Krit1, we therefore undertook mass spectrometric analyses of the cardiac proteome under WT and heg1 mutant conditions (with 150 purified hearts per genetic condition and replicate) in an attempt to detect CCM complex proteins. Unfortunately, this approach was not sufficiently sensitive to detect Krit1 protein levels. Faurobert and colleagues recently demonstrated that, similar to our findings, in HUVECs, a loss of CCM2 also causes a depletion of KRIT1 (Faurobert et al., (2013). 3) Figure 2: The evidence that "endocardial cells become desensitized to blood flow-induced mechanosensitive signaling when krit1 or ccm2 are overexpressed" is not compelling. The authors state that hearts with CCM1/2 overexpression resemble silent heart morphant (no flow) hearts, and that the atrium/ventricle flt1:YFP expression ratio is increased over time, but this may simply reflect aberrant heart development rather than a specific desensitization. In addition, the authors' use of flt1:YFP as a reporter of flow responses is based on the prior studies of Hogan, which were focused on the vascular endothelium. However, the ability of this line to sense hemodynamic flow has not been validated in the heart. Particularly concerning is the expression of flt1:YFP in the ventricle of the tnnt2a MO hearts. Is this endocardial or myocardial expression that is observed? Using endocardial and myocardial lines in combination with the flt1:YFP might help resolve these issues. Performing studies to validate the ability of this line to sense hemodynamic flow in the heart would help with interpretation of studies as well. We agree with the reviewers that the ability of the Tg(flt1:YFP) line to sense the hemodynamic forces of blood flow has not previously been shown. Within the revised manuscript, we have now repeated the above experiments using the well-established blood flow-sensitive Notch reporter line Tg(EPV.Tp1-Mmu.Hbb:Venus-Mmu.Odc1)(Ninov et al., 2012). Within the revised manuscript, we now show that the forced overexpression of Krit1 or Ccm2 alters the expression of the Tg(EPV.Tp1-Mmu.Hbb:Venus-Mmu.Odc1) reporter within the endocardium which, in WT, is particularly strong within the ventricle and AVC. Due to the overexpression of Krit1 or Ccm2, the expression from the Tg(TP1:VenusPEST) reporter is weakened and not restricted to the ventricle and AVC region at 54 hpf (figure 2B–F). These expression changes of the Notch reporter line occur while blood flow is not obviously affected as assayed by visual inspection. Hence, we suggest that the blood flow responsiveness of endocardial cells is affected. 4) Although the authors conclude that notch1b is expressed throughout the endocardium in the krit1 mutant, the notch1b in situs and the notch reporter do not support this interpretation. It is possible that the AVC region is expanded in the krit1 mutant. How are the authors defining the AVC? Without atrial, ventricular or AV boundary markers, it is difficult to determine where the endocardial cushions are in the krit1 mutant. Providing this data would help with interpretation of the studies. In addition, it would be useful to examine the ccm2 mutant in addition to the krit1 mutant, to strengthen the demonstration of how loss of ccm genes affects endocardial notch activation. To visualize the AVC region for a better assessment of the AVC endocardial Notch expression, we have counterstained the hearts using chamber-specific markers in WT and krit1 mutants (Figure 4—figure supplement 1). The fact that myocardial chamber identities are not affected in ccm mutants provides a strong boundary-marker for the AVC. Based on that sharply defined border between both chambers, we have assessed the endocardial Notch reporter expression which expands far beyond that boundary region. We also agree with the reviewers that it is important to verify the results obtained in krit1 mutants also in ccm2 mutants. The appropriate results for these mutants are now shown for ccm2 (Figure 4D,D’) and for krit1 mutants (Figure 4—figure supplement 1). In both cases, the domain of Notch signaling is expanded within the endocardium. 5) The studies on the overexpression of exogenous mRNA of egfp-krit1 in the krit1 mutant do not have sufficient controls and validation of assays to allow for a meaningful interpretation. Many assumptions are made in order for the authors to come to their conclusions. For example, there is insufficient evidence to show that injected mRNA is no longer present at 55 or 96 hpf. Moreover, over/mis-expression of krit1 may lead to a phenotype irrespective of the krit1 mutant. In fact, the phenotype is surprisingly similar to that found in late Notch inhibition and in the klf2a mutant (Beis et al., 2005, Steed et al., 2016). We have now measured krit1 mRNA levels over time and find that the levels are depleted by 96 hpf (shown in revised Figure 3—figure supplement 3). Since there is no evidence for EGFP-Krit1 protein levels at that stage (no EGFP detectable), the evidence is very strong that we are analyzing a krit1 loss-of-function phenotype. In further support of this interpretation, the endocardial over proliferation phenotype that is associated with a loss of krit1 becomes apparent by 55 hpf (shown in Figure 3—figure supplement 2). As the reviewers pointed out, there are some phenotypic similarities of the late krit1 phenotype with the loss of Notch (Beis et al., 2005-this initial description of the Notch inhibited cardiac valve phenotype is now also cited and discussed within the revised manuscript) or loss of klf2a phenotypes (Steed et al., 2016). However, in our study, we show that not only klf2a mRNA levels are increased (Figure 3L) but also that Notch signaling is expressed in a larger domain throughout the endocardium in late loss of krit1 conditions (Figure 4B; Figure 4—figure supplement 3B). Taken together this argues for an activated late Notch and Klf2a signaling that is causing the cardiac valve leaflet morphogenesis defects. This observation raises the interesting point that both a late loss and gain of Klf2a/Notch signaling causes comparable morphological defects in cardiac valve leaflet morphogenesis. We have now also included a short discussion of this point within the revised manuscript. 6) It would be beneficial to provide further support for the requirement of Krit1 for the generation of abluminal cell fates during valvulogenesis. The transient rescue of krit1 mutants allows AVC endocardial cells to differentiate properly at 48 hpf. Alcam levels do appear higher in most AVC cells at 96 hpf (Figure 3F, duplicated in Figure 3—figure supplement 4C’) but the morphology of the AV valve seems to also include abluminal cells (cardiac jelly cells or mesenchymal-like cells). Repeating the experiment in combination with a Wnt signaling readout (TCF reporter or other) and/or using the inducible hs:Krit1 line in the krit1 mutant background to better control krit1 levels, would strengthen their claim. We agree with the reviewers on the need to provide additional markers for abluminal versus luminal fates in the rescue experiment. Due to the genetic complexity of setting up this rescue experiment, we have not been able to construct lines that also contain the Wnt reporter strain to show that abluminal fates are indeed absent/ suppressed. Also, the construction of a line for hs:Krit1 overexpression in that genetic background was not feasible. Unfortunately, constructing these lines would have exceeded the time allocated for these revisions by several months. Instead, we have now included data on Cdh5, another luminal fate marker. Using this additional marker, we now show that the late loss of Krit1 causes cells in abluminal positions to maintain high levels of Cdh5 while, in WT, Cdh5 is rapidly degraded within abluminal cells (Figure 3—figure supplement 4C–C’’’). This finding is further supported by the finding that, in krit1 mutants, Cdh5 levels are generally increased within endocardium (Figure 3—figure supplement 4B). We have now removed all duplicated figures from the revised manuscript. 7) The model in Figure 5 is somewhat confusing. It might be helpful to show a model for the ccm mutant with blood flow and then when there is no blood flow. Based on the authors' current model, it seems that Notch would be activated throughout the endocardium in the ccm mutant with blood flow since ccm is not present to block klf2a expression. If this is the case, this seems to be in conflict with the current ccm mutant and no blood flow model where the lack of blood flow would lead to no klf2a expression and downstream Notch signaling. Additionally, the authors also speculate "Notch-mediated lateral inhibition" in their model; however, there is insufficient data to support this notion. This should be modified in the model. We agree with the reviewers that the speculation on “Notch-mediated lateral inhibition” should be removed from the model as shown in the revised figure 5. Importantly, Klf2a has two modes of induction as indicated in that model figure: 1). the physiological induction by blood flow and 2). a blood-flow independent suppression of expression by CCM proteins. Hence, the loss of CCM proteins causes Klf2a expression (and hence Notch1b expression) also in a blood-flow independent manner. [Editors' note: further revisions were requested prior to acceptance, as described below.] The reviewers appreciate the improvements made in your revised manuscript, but they have also raised several issues that remain to be addressed through further revision, as outlined below. 1) The Abstract is confusing in its current form, as it is not made clear in which direction many of the genes/pathways mentioned affect outcome. As an example: does the abstract make it clear whether heg1 expression is increased or reduced by low blood flow? The last paragraph of the Introduction section is similarly vague and does not refer to the heg1 results. The Abstract has been rephrased and clarified to clearly state that heg1 is positively regulated by blood flow. The revised Abstract now states: “We find that the expression of heg1, which encodes a binding partner of Krit1, is positively regulated by blood flow. In turn, Heg1 stabilizes levels of Krit1 protein and both, Heg1 and Krit1, dampen expression levels of klf2a, a major mechanosensitive gene which is a regulator of notch1b. Conversely, loss of Krit1 results in increased expression of klf2a and notch1b throughout the endocardium and also prevents endocardial sprouting which is required for cardiac valve leaflet formation.” Similarly, the last paragraph of the Introduction section has been clarified: “We find that expression of heg1 is positively regulated in response to blood flow and klf2a/b. We also explored the role of Heg1 and Krit1 in Klf2-dependent endothelial mechanotransduction during the formation of cardiac valve leaflets. Here, we show that Krit1 dampens levels of klf2a and notch1b expression. In tune with this finding, loss of Krit1 results in the strong expression of klf2a and notch1b within the endocardium and prevents the formation of an abluminal population of valve leaflet cells from endocardial cushions.” 2) In the Title, it may be better to mention CCM1/2, since CCM3 is not addressed in this study. Non-CCM experts may not appreciate what "CCM proteins" are. The title has been changed to explicitly refer to Heg1 and Ccm1/2. 3) From the data shown in the revised manuscript, it is not clear whether heg1 is expressed in the endocardium or the myocardium, although it is stated that it is expressed in the endocardium. Can the evidence for this be clarified? The endocardial expression has been described by Mably et al., 2003 (Figure 7B). Within the revised manuscript, we now also include an improved Figure 1—figure supplement 1D which shows that heg1 expression is strongly reduced in tnnt2a morphants that lack blood flow. This finding is in tune with a blood flow-dependent regulation of heg1 within the endocardium. 4) The use of the Notch reporter, in place of the previous Flt reporter, to monitor flow response is appreciated. However, the images in Figure 2B–D are hard to interpret. Although the ratios measured by the authors (Figure 2E–F) demonstrate the same trend following overexpression of Krit1 and Ccm2, the patterns of expression shown in Figure 2C–D seem markedly different; hard to interpret. This apparent discrepancy should be addressed. In addition, in light of recent studies showing myocardial Notch reporter activity in developing zebrafish hearts, it is unclear whether the Notch reporter activity shown here (and in Figure 4) is endocardial or myocardial. Can this be clarified? We apologize for the previous figure which has been misleading with respect to the expression of Notch activity in hs:Ccm2 conditions. Within the revised version of the manuscript, we have now exchanged, within Figure 2D, a more representative subfigure of the hs:Ccm2 condition which is similar to hs:Krit1 (which is also supported by the quantifications shown in subfigures Figure 2E,F. The strong downregulation of Notch activity upon activation of Krit1 or ccm2 is also strikingly visible in a new Figure 2—figure supplement 1. Notably, the expression of this Notch reporter was exclusively endocardial in all of these experimental conditions (Figure 2—figure supplement 1). 5) The authors utilize Cdh5 as a marker for the lumenal side of the AV valve, but they do not cite references for its use as a lumenal marker. If they are introducing this marker here, its characterization as such should be clearly described. Within the revised manuscript, we have referenced the work of Steed et al., 2016 which has first described Cdh5 as a luminal marker at the AVC valves whereas the protein is lost from the membrane on the abluminal side of the cardiac valve leaflets. This has been shown in Steed et al., 2016, Figure 3 and in the model thereof. 6) In Figure 4—figure supplement 1, the authors use a single marker (Myh6) to define the location of the AVC in krit1 mutants. This marker indicates the edge of the atrium but isn't sufficient to demonstrate whether the AVC is or isn't expanded in the mutant hearts. Can the authors use specific AVC markers to indicate whether the AVC region is expanded in krit1 mutants? Within the revised version of the manuscript, we have now included a figure showing a whole-mount in situ hybridization against tbx2b, which is a marker of the AVC region (shown in Figure 4—figure supplement 1C–D). We conclude: “In comparison, the expression of tbx2b, another AVC marker gene (Sedletcaia and Evans, 2011), was not expanded in ccm2mutants (Figure 4—figure supplement 1C–D). Hence, the expansion of the notch1b expression domain in krit1 or ccm2 mutants is not due to a regional expansion of the AVC.” 7) At the beginning of the Discussion section, the authors allude to evidence that Cdh5/VEcadherin plays into this pathway, but such evidence is not reported in this manuscript. We apologize for this error which has been corrected within the revised version of the manuscript. 8) The new model figure is appreciated, but, in light of what is suggested by Figure 1, it does not address the effect of flow on Heg1 and Krit1 levels. This is confusing – can it be revised to include these elements of the model? We have now adjusted model Figure 5 to show that the expression of CCM proteins is positively regulated by blood flow and Klf2. We also show that the expression of klf2a is affected by blood flow (this activation is dampened by CCM proteins) and that there is another blood flow-independent mechanism of Klf2 activation that is inhibited by CCM proteins in WT. Upon loss of CCM proteins, a blood-flow independent activation of klf2 expression throughout the endocardium inhibits endocardial sprouting of cardiac valve leaflet cells. Within the revised figure legend, we state: Ccm proteins provide a bias in Klf2a and Notch expression levels. Some cells that express lower levels of klf2a expression and have a lower Notch activity establish protrusions and migrate into the cardiac jelly (endocardial sprouting). In ccm mutants, endocardial cells overexpress klf2a and have a higher Notch activity due to a blood flow-independent mechanism. As a consequence, high levels of Notch activity throughout the entire endocardium result in a failure of endocardial sprouting.”
Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
gene (heg1)heg1ZFINZFIN ID: ZDB-GENE-040714–1
gene (krit1)krit1ZFINZFIN ID: ZDB-GENE-030131–555
gene (klf2a)klf2aZFINZFIN ID: ZDB-GENE-011109–1
gene (klf2b)klf2bZFINZFIN ID: ZDB-GENE-011109–2
gene (tnnt2a)tnnt2aZFINZFIN ID: ZDB-GENE-000626–1
gene (ccm2)ccm2ZFINZFIN ID: ZDB-GENE-040712–6
gene (notch1b)notch1bZFINZFIN ID: ZDB-GENE-990415–183
strain, strain background (krit1ty219c)krit1ty219cDOI:10.1242/dev.02469ZFIN ID: ZDB-ALT-980203–1289
strain, strain background (ccm2m201)ccm2m201PMID:9007227ZFIN ID: ZDB-ALT-980203–523
strain, strain background (Tg(EPV.Tp1-Mmu.Hbb: Venus-Mmu.Odc1)s940)Tg(EPV.Tp1-Mmu.Hbb: Venus-Mmu.Odc1)s940DOI:10.1242/dev.076000ZFIN ID: ZDB-ALT-120419–6
strain, strain background (Tg(kdrl:EGFP)s843)Tg(kdrl:EGFP)s843DOI:10.1242/dev.02087ZFIN ID: ZDB-ALT-050916–14
strain, strain background (Tg(fli1a:GAL4FF)ubs3)Tg(fli1a:GAL4FF)ubs3DOI:10.1016/j.cub. 2011.10.016ZFIN ID: ZDB-ALT-120113–6
strain, strain background (Tg(hsp70l:Krit1_IRES_EGFP)md6)Tg(hsp70l: Krit1_IRES_EGFP)md6this paper
strain, strain background (Tg(hsp70l:Ccm2_IRES_EGFP)md12)Tg(hsp70l: Ccm2_IRES_EGFP)md12this paper
strain, strain background (Tg(hsp70l:Klf2a_IRES_EGFP)pbb22)Tg(hsp70l: Klf2a_IRES_EGFP)pbb22this paper
strain, strain background (Tg(UAS:EGFP-Krit1, cryaa:EGFP)pbb21)Tg(UAS:EGFP-Krit1, cryaa:EGFP)pbb21this paper
genetic reagent (tnnt2a morpholino)tnnt2a MODOI:10.1038/ng875ZFIN ID: ZDB-MRPHLNO-060317–4
genetic reagent (klf2a morpholino)klf2a MODOI:10.1038/nature08889ZFIN ID: ZDB-MRPHLNO-100610–92 ng/embryo
genetic reagent (klf2b morpholino)klf2b MODOI:10.1016/j.devcel. 2014.12.016ZFIN ID: ZDB-MRPHLNO-150427–11 ng/embryo
genetic reagent (heg1 morpholino)heg1 MOPMID:14680629ZFIN ID: ZDB-MRPHLNO-080714–55 ng/embryo
genetic reagent (klf2a probe)klf2aDOI:10.1016/j.devcel. 2014.12.016ZFIN ID: ZDB-FIG-150407–15 ng/embryo
genetic reagent (notch1b probe)notch1bDOI:10.1126/science. 293.5535.1670ZFIN ID: ZDB-FIG-151113–25
genetic reagent (heg1 probe)heg1DOI: 10.1242/dev.143362ZFIN ID: ZDB-PUB-031217–1
genetic reagent (tbx2 probe)tbx2DOI: 10.1002/dvdy.22622ZFIN ID: ZDB-PUB-110502–3
Antibody (rabbit anti-VE- Cadherin (Cdh5))Cdh5DOI:10.1016/j.ydbio. 2008.01.038ZFIN ID: ZDB-PUB-080326–181:200
Antibody (mouse anti-Zn-8/Alcam)AlcamDevelopmental Studies Hybridoma BankZFIN ID: ZDB-ATB-081002–221:25
Antibody (mouse anti-Myh6)Myh6Developmental Studies Hybridoma BankZFIN ID: ZDB-ATB-081002–541:10
Antibody (Alexa Fluor 633-conjugated goat anti-rabbit)Alexa Fluor 633- conjugated goat anti-rabbitInvitrogen A210701:200
Antibody (Rhodamine Red- X-conjugated goat anti-mouse)Rhodamine Red- X- conjugated goat anti-mouseJackson ImmunoResearch Laboratories 115-295-0031:200
Antibody (Dylight 649- conjugated goat anti-mouse)Dylight 649- conjugated goat anti-mouseJackson ImmunoResearch Laboratories 115-495-0031:200
recombinant DNA reagent (pDestTol2 (#426))pDestTol2N. LawsonLawson Lab: #426
recombinant DNA reagent (p5E-hsp70l (#222))p5E-hsp70lN. LawsonLawson Lab: #222
recombinant DNA reagent (p5E-CMV/SP6 (#382))p5E-CMV/SP6Chien, Univ. UtahTol2kit: #382
recombinant DNA reagent (p5E-UAS (#327))p5E-UASChien, Univ. UtahTol2kit: #327
recombinant DNA reagent (p3E-IRES_EGFPpA (#389))p3E-IRES_EGFPpAN. LawsonLawson Lab: #389
recombinant DNA reagent (p3E-cryaa:EGFPpA)p3E-cryaa:EGFPpAotherplasmid was generated in our lab
recombinant DNA reagent (p3E-EGFPpA (#366))p3E-EGFPpAChien, Univ. UtahTol2kit: #366
recombinant DNA reagent (p3E-pA (#383))p3E-pAChien, Univ. UtahTol2kit: #383
recombinant DNA reagent (pDest_Tol2pA_Hsp70l: Krit1_IRES_EGFPpA)pDest_Tol2pA_Hsp70l: Krit1_IRES_EGFPpAthis paper
recombinant DNA reagent (pDest_Tol2pA_Hsp70l: Ccm2_IRES_EGFPpA)pDest_Tol2pA_Hsp70l: Ccm2_IRES_EGFPpAthis paper
recombinant DNA reagent (p3E-pA (pDest_Tol2pA_ Hsp70l:Klf2a_IRES_EGFPpA)pDest_Tol2pA_Hsp70l: Klf2a_IRES_EGFPpAthis paper
recombinant DNA reagent (pDest_Tol2pA_UAS: EGFP-Krit1pA,cryaa:EGFPpA)pDest_Tol2pA_UAS: EGFP-Krit1pA,cryaa:EGFPpAthis paper
recombinant DNA reagent (pDest_Tol2pA_CMV/SP6: EGFP-Krit1pA)pDest_Tol2pA_CMV/SP6: EGFP-Krit1pAthis paper
sequence-based reagent (qPCR-primer heg1 FW)heg1 FWthis paper
sequence-based reagent (qPCR-primer heg1 RW)heg1 RWthis paper
sequence-based reagent (qPCR-primer krit1 FW)krit1 FWthis paper
sequence-based reagent (qPCR-primer krit1 RW)krit1 RWthis paper
sequence-based reagent (qPCR-primer klf2a FW)klf2a FWthis paper
sequence-based reagent (qPCR-primer klf2a RW)klf2a RWthis paper
sequence-based reagent (qPCR-primer eif1b FW)eif1b FWthis paper
sequence-based reagent (qPCR-primer eif1b RW)eif1b RWthis paper
commercial assay or kit (SP6 polymerase (mMessage Machine kit, Ambion))SP6 polymeraseAmbionAmbion:AM1340
commercial assay or kit (RevertAid H Minus First Strand cDNA Synthesis kit (ThermoFisher Scientific))RevertAid H Minus First Strand cDNA Synthesis kitThermoFisher ScientificThermoFisher Scientific:K1631
commercial assay or kit (KAPA Sybr Fast qPCR kit (Peqlab))KAPA Sybr Fast qPCR kitPeglabPeglab:4385612
chemical compound, drug (1- phenyl-2-thiourea (PTU))PTUSigma AldrichSigma Aldrich:P76290.003%
chemical compound, drug (Rhodamine-Phalloidin)Rhodamine-PhalloidinInvitrogenInvitrogen:R4151:250
chemical compound, drug (Tricaine (3-amino benzoic acidethylester))TricaineSigma-AldrichSigma Aldrich:A-50400.16 mg/ml
software, algorithm (GraphPad Prism6)GraphPad Prism6GraphPad
software, algorithm (Imaris (Bitplane, Version 8.1))ImarisBitplane
software, algorithm (Fiji software)FijiDOI:10.1038/nmeth.2019
software, algorithm (Adobe Bridge and Photoshop (Adobe Systems))Adobe Bridge and PhotoshopAdobe
software, algorithm (Zen 8.1 Software (Zeiss))ZenZeiss
software, algorithm (Excel 2010 (Microsoft Office))ExcelMicrosoft
software, algorithm (PikoReal software 2.2 (ThermoFisher Scientific))PikoReal softwareThermoFisher Scientific
Unpaired t-testMean diff.SummaryIndividual P value
48 hpf egfp-krit1 mRNAWT vs. krit1100.0****<0.0001
WT vs. WT + egfp-krit1 mRNA0.0ns>0.9999
WT vs. krit1 + egfp-krit1 mRNA28***0.0004
48 hpfNumber of WT with blood-flow/totalNumber of krit1ty219c with blood-flow/totalNumber ofWT + egfp-krit1 mRNA with blood-flow/totalNumber ofkrit1ty219c + egfp-krit1 mRNA with blood-flow/total
15/50/332/3215/15
278/780/1740/4042/42
369/690/2621/2111/11
96 hpfNumber of WT with blood-flow at 48 hpf and 96 hpf/totalNumber of krit1ty219c with blood-flow at 48 hpf and 96 hpf/totalNumber of WT + egfp- krit1 mRNA withblood-flow at 48 hpf and 96 hpf/totalNumber ofkrit1ty219c + egfp-krit1 mRNA with blood-flowat 48 hpf and 96hpf/total
167/670/2859/595/22
270/700/1120/211/11
357/570/1330/307/18
Within each row, compare columns (simple effects within rows)
Uncorrected Fisher's LSDMean diff.SummaryIndividual P value
48 hpfWT vs. krit1100.0****<0.0001
WT vs. WT + egfp-krit1 mRNA0.0ns>0.9999
WT vs. krit1 + egfp-krit1 mRNA0.0ns>0.9999
96 hpfWT vs. krit1100.0****<0.0001
WT vs. WT + egfp-krit1 mRNA1.590ns0.7212
WT vs. krit1 + egfp-krit1 mRNA76.44****<0.0001
48 hpfnAverage cell numberSEMp-value
WT668±2.3620.5723
krit1 + egfp-krit1 mRNA665±3.572
55 hpfnAverage cell numberSEMp-value
WT378±2.0280.0093
krit1 + egfp-krit1 mRNA3112±7.024
nRatio TP1:VenusPEST Atrium/Ventricle (CTTF)SEMp
WT190.213±0.0240.0005
hs:Krit1180.418±0.048
nRatio TP1:VenusPEST Atrium/Ventricle (CTTF)SEMp
WT190.290±0.0400.0261
hs:Ccm2200.428±0.044
nCTTF meanSEMp
WT191.000±0.1210.0426
hs:Krit1190.671±0.099
nCTTF meanSEMp
WT191.000±0.0590.0481
hs:Ccm2200.798±0.078
nCTTF mean heartsSEMP
EGFP-Krit1 levels WT51.000±0.074≤0.0005
EGFP-Krit1 levels heg1 MO100.600±0.049
nCTTF mean caudal plexus regionSEMp
EGFP-Krit1 levels WT51.000±0.081<0.0001
EGFP-Krit1 levels heg1 MO50.305±0.059
TargetSequence 5’−3’
heg1Fw _ GCTCTTATTGTCACCTGCTGC Rv _ CGGATAGATGCAGGAATGCC
krit1Fw _ GTCTGAGCACTAGTGAGGGTG Rv _ GACCTGTCCTGTGAAAAACGC
klf2aFw _ CTGGGAGAACAGGTGGAAGGA Rv _ CCAGTATAAACTCCAGATCCAGG
eif1bFw _ CAGAACCTCCAGTCCTTTGATC Rv _ GCAGGCAAATTTCTTTTTGAAGGC
TreatmentStg (hpf)nheg1krit1klf2a
MeanSEMpMeanSEMpMeanSEMp
tnnt2a MO5430.850.0080.0131.060.0090.103---
klf2a/b MO5440.770.0340.0451.170.0290.103---
hs:Klf2a5432.560.0890.0441.380.0610.151---
hs:Krit1484---9.770.0630.0010.630.0590.044
heg1 mRNA2434.010.0590.0095---0.310.1070.04
heg1 mRNA4832.470.0360.0082---0.680.0230.019
egfp-krit1 mRNA243---7.060.1250.021---
egfp-krit1 mRNA483---3.240.0530.011---
egfp-krit1 mRNA963---1.200.1610.675---
Compared stages (hpf)Mean of the ratioSEMp
24–480.4594±0.0820.027
48–960.3691±0.1100.029
24–960.1696±01070.009
  56 in total

1.  Rac-MEKK3-MKK3 scaffolding for p38 MAPK activation during hyperosmotic shock.

Authors:  Mark T Uhlik; Amy N Abell; Nancy L Johnson; Weiyong Sun; Bruce D Cuevas; Katherine E Lobel-Rice; Eric A Horne; Mark L Dell'Acqua; Gary L Johnson
Journal:  Nat Cell Biol       Date:  2003-11-23       Impact factor: 28.824

Review 2.  Mitogen-activated protein kinase signaling in the heart: angels versus demons in a heart-breaking tale.

Authors:  Beth A Rose; Thomas Force; Yibin Wang
Journal:  Physiol Rev       Date:  2010-10       Impact factor: 37.312

3.  Mekk3 is essential for early embryonic cardiovascular development.

Authors:  J Yang; M Boerm; M McCarty; C Bucana; I J Fidler; Y Zhuang; B Su
Journal:  Nat Genet       Date:  2000-03       Impact factor: 38.330

4.  An on-line database for zebrafish development and genetics research

Authors: 
Journal:  Semin Cell Dev Biol       Date:  1997-10       Impact factor: 7.727

5.  Regulation of β1 integrin-Klf2-mediated angiogenesis by CCM proteins.

Authors:  Marc Renz; Cécile Otten; Eva Faurobert; Franziska Rudolph; Yuan Zhu; Gwénola Boulday; Johan Duchene; Michaela Mickoleit; Ann-Christin Dietrich; Caroline Ramspacher; Emily Steed; Sandra Manet-Dupé; Alexander Benz; David Hassel; Julien Vermot; Jan Huisken; Elisabeth Tournier-Lasserve; Ute Felbor; Ulrich Sure; Corinne Albiges-Rizo; Salim Abdelilah-Seyfried
Journal:  Dev Cell       Date:  2015-01-26       Impact factor: 12.270

6.  Different levels of Notch signaling regulate quiescence, renewal and differentiation in pancreatic endocrine progenitors.

Authors:  Nikolay Ninov; Maxim Borius; Didier Y R Stainier
Journal:  Development       Date:  2012-05       Impact factor: 6.868

7.  Development-related changes in the expression of shear stress responsive genes KLF-2, ET-1, and NOS-3 in the developing cardiovascular system of chicken embryos.

Authors:  Bianca C W Groenendijk; Beerend P Hierck; Adriana C Gittenberger-De Groot; Robert E Poelmann
Journal:  Dev Dyn       Date:  2004-05       Impact factor: 3.780

Review 8.  Recent insights into cerebral cavernous malformations: the molecular genetics of CCM.

Authors:  Florence Riant; Francoise Bergametti; Xavier Ayrignac; Gwenola Boulday; Elisabeth Tournier-Lasserve
Journal:  FEBS J       Date:  2010-01-22       Impact factor: 5.542

9.  The cerebral cavernous malformation signaling pathway promotes vascular integrity via Rho GTPases.

Authors:  Kevin J Whitehead; Aubrey C Chan; Sutip Navankasattusas; Wonshill Koh; Nyall R London; Jing Ling; Anne H Mayo; Stavros G Drakos; Christopher A Jones; Weiquan Zhu; Douglas A Marchuk; George E Davis; Dean Y Li
Journal:  Nat Med       Date:  2009-01-18       Impact factor: 53.440

10.  The Krüppel-like factor 2 and Krüppel-like factor 4 genes interact to maintain endothelial integrity in mouse embryonic vasculogenesis.

Authors:  Aditi R Chiplunkar; Benjamin C Curtis; Gabriel L Eades; Megan S Kane; Sean J Fox; Jack L Haar; Joyce A Lloyd
Journal:  BMC Dev Biol       Date:  2013-11-22       Impact factor: 1.978

View more
  16 in total

1.  A Role for Sensory end Organ-Derived Signals in Regulating Muscle Spindle Proprioceptor Phenotype.

Authors:  Dawei Wu; Ira Schieren; Yingzhi Qian; Chaolin Zhang; Thomas M Jessell; Joriene C de Nooij
Journal:  J Neurosci       Date:  2019-03-29       Impact factor: 6.167

Review 2.  Mechanisms of heart valve development and disease.

Authors:  Anna O'Donnell; Katherine E Yutzey
Journal:  Development       Date:  2020-07-03       Impact factor: 6.868

Review 3.  Fluid forces shape the embryonic heart: Insights from zebrafish.

Authors:  Pragya Sidhwani; Deborah Yelon
Journal:  Curr Top Dev Biol       Date:  2019-01-02       Impact factor: 4.897

Review 4.  Mechanical regulation of chromatin and transcription.

Authors:  Sirio Dupont; Sara A Wickström
Journal:  Nat Rev Genet       Date:  2022-05-23       Impact factor: 59.581

5.  Mechanically activated piezo channels modulate outflow tract valve development through the Yap1 and Klf2-Notch signaling axis.

Authors:  Anne-Laure Duchemin; Hélène Vignes; Julien Vermot
Journal:  Elife       Date:  2019-09-16       Impact factor: 8.140

6.  Llgl1 regulates zebrafish cardiac development by mediating Yap stability in cardiomyocytes.

Authors:  Michael A Flinn; Cécile Otten; Zachary J Brandt; Jonathan R Bostrom; Aria Kenarsary; Tina C Wan; John A Auchampach; Salim Abdelilah-Seyfried; Caitlin C O'Meara; Brian A Link
Journal:  Development       Date:  2020-08-25       Impact factor: 6.868

Review 7.  Biomechanical Cues Direct Valvulogenesis.

Authors:  Neha Ahuja; Paige Ostwald; David Bark; Deborah Garrity
Journal:  J Cardiovasc Dev Dis       Date:  2020-05-19

Review 8.  Epigenetics and Mechanobiology in Heart Development and Congenital Heart Disease.

Authors:  Dillon K Jarrell; Mallory L Lennon; Jeffrey G Jacot
Journal:  Diseases       Date:  2019-09-01

Review 9.  The Zebrafish Cardiac Endothelial Cell-Roles in Development and Regeneration.

Authors:  Vanessa Lowe; Laura Wisniewski; Caroline Pellet-Many
Journal:  J Cardiovasc Dev Dis       Date:  2021-05-01

Review 10.  Cerebral Cavernous Malformation: From Mechanism to Therapy.

Authors:  Daniel A Snellings; Courtney C Hong; Aileen A Ren; Miguel A Lopez-Ramirez; Romuald Girard; Abhinav Srinath; Douglas A Marchuk; Mark H Ginsberg; Issam A Awad; Mark L Kahn
Journal:  Circ Res       Date:  2021-06-24       Impact factor: 23.213

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.