Engineering and stable production of recombinant IgE for cancer immunotherapy and AllergoOncology.

To the Editor:

AllergoOncology, the emerging discipline of cancer immunology aiming to exploit features of allergy-related immunity to treat tumors,1, 2, 3 has catalyzed the development of tumor-specific IgE mAbs as powerful alternatives to commonly used therapeutic IgGs.4, 5, 6 IgE, which is associated typically with the pathogenesis of allergic responses and is known for Fc-mediated protective effects in parasitic infection clearance, presents exciting opportunities to unleash previously untapped immune mechanisms and effective antitumor surveillance when focused against cancer antigens. The antitumor efficacy of IgE has been demonstrated in numerous studies,1, 2, 3 and an early clinical trial of the first-in-class antitumor IgE in oncology is open (NCT02546921, www.clinicaltrials.gov). A major impediment in the field relates to lack of efficient cloning and production strategies for recombinant IgE at high enough yields for preclinical and clinical studies.

We aimed to develop stable expression application to generate recombinant IgE, as exemplified by an antibody recognizing the melanoma-associated antigen chondroitin sulfate proteoglycan 4 (CSPG4). Our strategy incorporates seamless cloning, selection, and fast antibody production at high yields (Fig 1, A). To prevent promoter silencing, we developed a novel dual-plasmid system containing Ubiquitous Chromatin Opening Element (UCOE) sequences located upstream of the transgene promoter. We isolated the coding sequences of anti-CSPG4 IgE heavy and light chains from a previously described (pVITRO1-CSPG4 IgE/k) vector (Fig 1, B) and cloned these into 2 UCOE vectors (UCOE-CSPG4-HC[ε] and UCOE-CSPG4-LC[κ]; Fig 1, C) by using Polymerase Incomplete Primer Extension (PIPE) cloning. UCOE enables higher transfection efficiency and higher proportions of medium- and high-expressing transfectomas than pVITRO1 (see Fig E1 in this article's Online Repository at www.jacionline.org). Vectors were linearized before transfection to allow correct integration into the host genome, and transgene-expressing cells were selected. The choice of Expi293F cells as hosts was based on human-like glycosylation profiles, ability to grow in suspension, high-density and serum-free conditions, and characteristics crucial for expediting production, scaling up, and adaptability to good manufacturing practice conditions. We adapted Expi293F cells from suspension to adherent growth conditions and vice versa. Adherent cells were transfected and seeded in selection medium to promote host genome integration of exogenous DNA. Resistant cells were cloned by limiting dilution. We designed a cell-based flow cytometric method to detect functional IgE recognizing natively expressed antigens to screen antibody-secreting clones (see Fig E1). Clones with high antibody expression were amplified and readapted to grow in high-density suspension cultures for antibody harvesting.

Fig 1

Development of a stable platform for the expression of recombinant IgE. A, Flow chart summarizing the development of stable cell lines expressing anti-CSPG4 IgE. B and C, pVITRO1-CSPG4-IgE/κ vector (Fig 1, B) and UCOE-CSPG4-HC(ε) and UCOE-CSPG4-LC(κ) vector (Fig 1, C) maps. To optimize antibody production, Expi-CSPG4-IgE cells were cultured in different conditions, and IgE secretion and cell viability were monitored daily. D, Secreted IgE in cultures seeded at 0.5, 2, 5, or 11 × 106 cells/mL in fresh medium. E, Secreted IgE in cultures seeded at 5 × 106 or 11 × 106 cells/mL in 25 mL of fresh medium and reseeded at the initial concentration every day (5M/mL 1D, 11M/mL 1D) or every 2 days (5M/mL 2D). Data in Fig 1, D and E, represent means ± SEMs of 4 independent experiments.

Fig E1

Detection of functionally active antibodies in culture supernatants by using flow cytometry. A, Schematic depicting the principle for antibody detection in cell-culture supernatants by using a classical sandwich ELISA (ELISA) and our novel cytofluorometry-based assay (flow cytometry). B and C, Standard curves showing ranges of linearity (dotted lines) for ELISA (Fig E1, B) and for flow cytometry (Fig E1, C). D, Comparison between IgE concentrations calculated with ELISA and flow cytometry. Error bars represent SEMs of 3 independent experiments. E, Screening of clones transfected with pVITRO1-vector or UCOE-vector system graph representing secreted anti-CSPG4 IgE detected with flow cytometry. Clones secreting between 2 and 4 μg/mL anti-CSPG4 IgE were considered medium-expressing clones, and those that produced greater than 4 μg/mL were considered high-expressing clones. The right panel summarizes absolute numbers and percentages of different antibody expression levels.

After selecting the highest-expressing clone, we optimized culture conditions to maximize IgE production and minimize time and resources. We observed a slow decrease in specific daily antibody productivity consistent with cell growth rate and consumption of culture medium nutrients. This productivity decrease was due to nutrient depletion in the medium rather than cell density (see Fig E2 in this article's Online Repository at www.jacionline.org).

Fig E2

Culture medium conditions for optimal antibody production. To optimize antibody production, Expi-CSPG4-IgE cells were cultured in different conditions, and IgE secretion and cell viability were monitored daily. A, Secreted IgE and viable cells in cultures seeded at 0.5 × 106 cells/mL in fresh medium. B, Antibody-specific productivity calculated from Fig E2, A. Graphs in Fig E2, A and B, represent one of 2 independent experiments. C, Secreted IgE (left panel) and viable cells (right panel) in cultures seeded at 5 × 106 cells/mL in fresh or metabolized medium. Secreted IgE is normalized on secreted IgE at day 0. Data represent means ± SEMs of 4 independent experiments.

To maximize yields, we tested different seeding Expi-CSPG4 IgE cell concentrations in fresh medium, measuring secreted antibody daily for 5 days. As expected, higher starting cell concentrations yielded faster and greater antibody production, with cells seeded at 11 × 106 cells/mL generating 2 mg/d (Fig 1, D).

Using high cell concentrations (5 × 106 and 11 × 106 cells/mL), which place cells under stress, we analyzed production consistency over time by passaging every 2 days at 5 × 106 cells/mL (5M/mL 2D) or every day at 5 × 106 cells/mL (5M/mL 1D) or 11 × 106 cells/mL (11M/mL 1D), replacing medium at every passage. After 4 days, all conditions yielded consistent antibody production (Fig 1, E). The 11M/mL 1D and 5M/mL 2D conditions yielded similar production per passage. However, 11M/mL 1D resulted in the highest production per day (see Fig E3 in this article's Online Repository at www.jacionline.org), suggesting this is optimal for reducing resources and time.

Fig E3

Analysis of data reported in Fig 1, E. The bar chart represents the average yield per passage (in milligrams per liter; A) or average yield per day (in milligrams per day; B). Data represent means ± SEMs of 4 independent experiments.

IgE production reached yields of up to 87 mg/L/d (83 ± 4 mg/L/d [mean ± SD]), with the ability to repeat the process with the same cells at least 3 times without losing production efficiency. Yields in 4 days in small shaking flask cultures were approximately 33-fold greater than the most optimal 14-day stable IgE production recorded in shaking flask conditions and 13-fold higher than 14-day IgE production reported by using bioreactors. Optimized high-density conditions allowed maximized yields and substantially reduced medium volumes, achieving 2 mg/25 mL/d, with similar yields scaling down to 15-mL and up to 300-mL cultures.

Different culture conditions can affect antibody quality and structural and functional properties, including posttranslational modifications, such as glycosylation. This is highly pertinent for IgE based on larger size and higher glycosylation levels compared with IgG. We performed structural, glycosylation, and functional analyses comparing affinity chromatography–purified antibodies from high- and low-density cultures with IgE produced with the previous pVITRO method.

Size-exclusion HPLC showed very similar antibody main peak profiles (Fig 2, A). Lectin blot and liquid chromatography–mass spectrometry (LC-MS) glycosylation analyses revealed no significant differences among IgE produced with our method (Fig 2, B and C), particularly with regard to oligomannose structures, removal of which is reported to abrogate anaphylaxis. LC-MS glycosylation analyses showed a reduction in MAN5 oligomannose structure in new preparations compared with pVITRO IgE. Antibodies from all conditions showed binding characteristics comparable with those of target antigen on A375 melanoma cells and rat basophilic leukemia RBL-SX38 cells expressing human FcεRI (Fig 2, D). All preparations triggered significant and comparable levels of mast cell degranulation when cross-linked by polyclonal anti-IgE or target antigen on CSPG4high melanoma cells (Fig 2, E). The hapten-specific NIP-IgE cross-linked by polyclonal anti-IgE, but not by CSPG4high cells, triggered significant degranulation. These suggest that different preparations and density conditions preserve receptor recognition and antibody potency. Importantly, reduced MAN5 in the new IgE is insufficient to affect IgE binding or functionality.

Fig 2

Structural and functional characterization of IgE produced under different conditions. IgE was purified from supernatants of Freestyle293F-CSPG4 IgE (pVITRO) or Expi-CSPG4 IgE cultured at 0.5 × 106 for 4 days, (0.5M/mL 4D), 5 × 106 for 2 days (5M/mL 2D), 5 × 106 for 1 day (5M/mL 1D) or 11 × 106 cells/mL for 1 day (11M/mL 1D). A, Structural characterization was performed by using HPLC. B, Lectin blotting was performed by using Con-A, AAL, and RCAI. Images show 1 representative experiment. Graphs show densitometric analyses normalized by means of kappa light chain Western blotting. Data represent means ± SEMs of 2 independent experiments. C, LC-MS glycosylation analysis. The graph represents relative percentage areas for each ultra-HPLC chromatogram peak of procainamide-labeled N-glycan released from each sample. Data represent means ± SDs. Monosaccharide compositions assigned to peaks: F, fucose; H, hexose; N, N-acetylhexosamine; S, sialic acid. Possible N-glycan structures shown in brackets: A, antenna; F, fucose; G, galactose; MAN, mannose; S, sialic acid. D, IgE-binding kinetics to CSPG4 antigen (A375 cells) and FcεRI (RBL-SX38 cells). E, IgE-mediated degranulation of RBL-SX38 mast cells measured in negative control (no cross-linker), positive control (polyclonal anti-IgE), and using a CSPG4-expressing tumor cell line to trigger cross-linking of anti-CSPG4 IgE-FcεRI complexes. Data represent means ± SEMs of 4 independent. **P < .01 and ****P < .0001. ns, Not significant.

Therefore we present a novel process for serum-free production of IgE with comparable structural and functional characteristics to the previous pVITRO method but at higher yield and in less time than any documented stable platforms and with less resources than transient systems (see Methods and Table E1 in this article's Online Repository at www.jacionline.org). This offers new opportunities to expedite the design of novel therapeutic antibodies with enhanced effector functions suitable for basic and translational research, scaling up, process development, and manufacturing for clinical trials of IgE therapy in patients with cancer. Rapid generation of IgE antibodies recognizing allergens, cancer antigens, or parasitic targets can find direct applications for exploring multifaceted functions of IgE in allergy, oncology, and AllergoOncology.

Table E1

Main features of the proposed method

Expression host	Expi293F (human origin, suitable for high-density and serum-free culture conditions)
Vector	Dual system with monocistronic UCOE-vectors (strong CMV promoter for high expression, UCOE sequence able to prevent promoter silencing)
Expression system	Stable
Vessel and physical conditions	Shaking flasks (125 rpm), 37°C, 8% CO2
Medium	Expi293 Expression Medium, serum free
Yield	Up to 87 mg/L
Volume	Suitable for small and upscaled cultures (from 15-300 mL)
Cell density	Up to 11 × 106 cells/mL
Time to set up the stable platform	Approximately 50 days
Time for antibody expression	Twenty-four hours (2 mg in 25 mL of culture)
Cost for setup of the stable platform	PIPE cloning, adhesion-based and small-volume stable transfection with Lipofectamine 2000 and FACS-based screening of clones, make the development of the stable platform cost-effective compared with the production of antibody by using transient transfection
Cost for antibody expression	High yield in a small volume of Expi293 Expression Medium (up to 87 mg of IgE for 1 L of medium)

Table E2

PIPE cloning primers

Primer name	5′-3′ sequence
Isolation of ε heavy chain
H F	AGTTAACGGCCGGCCATGGACTGGACCTGGAGGATCCTC
E R	TGCAGCTCGAGTCATTTACCGGGATTTACAGACACCGCT
Isolation of κ light chain
K F	AGTTAACGGCCGGCCATGTTGCCATCACAACTCATTGGG
K R	TGCAGGTCGACCTAACACTCTCCCCTGTTGAAGCTC
UCOE vector linearization in 3 segments (U1, U2, and U3)
U1 F	GTCGACCTGCAGGCATGCAAG
U1 R	CGTTGTCAGAAGTAAGTTGG
U2 F	CCAACTTACTTCTGACAACG
U2 R	AGCACTAACGAAGTAGAGGG
U3 F	CCCTCTACTTCGTTAGTGCT
U3 R	GGCCGGCCGTTAACTTAACTAAC

Table E3

PIPE cloning PCR conditions

Temperature (°C)	Time (s)
	ε heavy chain	κ light chain	U1	U2	U3
98	10	10	10	10	10
98	1	1	1	1	1
60	5	5	5	5	5
72	23	9	43	42	34