Meritxell Espino Guarch1,2,3, Mariona Font-Llitjós2,4, Isabel Varela-Nieto4,5,6, Paolo Gasparini7,8, Manuel Palacín3,4,9, Virginia Nunes2,4,10, Silvia Murillo-Cuesta4,5,6, Ekaitz Errasti-Murugarren3,4, Adelaida M Celaya4,5, Giorgia Girotto7,8, Dragana Vuckovic7,8, Massimo Mezzavilla1, Clara Vilches2, Susanna Bodoy3,4, Ignasi Sahún4,11, Laura González2,4, Esther Prat2,4,10, Antonio Zorzano3,9,12, Mara Dierssen4,11. 1. Experimental Genetics, Sidra Medical and Research Center, Doha, Qatar. 2. Genes, Disease and Therapy Program, Molecular Genetics Laboratory - IDIBELL, Barcelona, Spain. 3. Institute for Research in Biomedicine (IRB Barcelona), The Barcelona Institute of Science and Technology, Barcelona, Spain. 4. Biomedical Research Networking Centre on Rare Diseases (CIBERER), Institute of Health Carlos III, Barcelona, Spain. 5. Alberto Sols Biomedical Research Institute (CSIC/UAM), Madrid, Spain. 6. Hospital La Paz Institute for Health Research (IdiPAZ), Madrid, Spain. 7. Department of Medicine, Surgery and Health Sciences, University of Trieste, Trieste, Italy. 8. Medical Genetics, Institute for Maternal and Child Health - IRCCS "Burlo Garofolo", Trieste, Italy. 9. Biochemistry and Molecular Biomedicine Department, Faculty of Biology, University of Barcelona, Barcelona, Spain. 10. Genetics Section, Physiological Sciences Department, Health Sciences and Medicine Faculty, University of Barcelona, Barcelona, Spain. 11. Center for Genomic Regulation (CRG), The Barcelona Institute of Science and Technology, Barcelona, Spain. 12. Biomedical Research Networking Centre on Diabetes and Associated Metabolic Diseases (CIBERDEM), Barcelona, Spain.
Abstract
Age-related hearing loss (ARHL) is the most common sensory deficit in the elderly. The disease has a multifactorial etiology with both environmental and genetic factors involved being largely unknown. SLC7A8/SLC3A2 heterodimer is a neutral amino acid exchanger. Here, we demonstrated that SLC7A8 is expressed in the mouse inner ear and that its ablation resulted in ARHL, due to the damage of different cochlear structures. These findings make SLC7A8 transporter a strong candidate for ARHL in humans. Thus, a screening of a cohort of ARHL patients and controls was carried out revealing several variants in SLC7A8, whose role was further investigated by in vitro functional studies. Significant decreases in SLC7A8 transport activity was detected for patient's variants (p.Val302Ile, p.Arg418His, p.Thr402Met and p.Val460Glu) further supporting a causative role for SLC7A8 in ARHL. Moreover, our preliminary data suggest that a relevant proportion of ARHL cases could be explained by SLC7A8 mutations.
Age-related hearing loss (ARHL) is the most common sensory deficit in the elderly. The disease has a multifactorial etiology with both environmental and genetic factors involved being largely unknown. SLC7A8/SLC3A2 heterodimer is a neutral amino acid exchanger. Here, we demonstrated that SLC7A8 is expressed in the mouse inner ear and that its ablation resulted in ARHL, due to the damage of different cochlear structures. These findings make SLC7A8 transporter a strong candidate for ARHL in humans. Thus, a screening of a cohort of ARHL patients and controls was carried out revealing several variants in SLC7A8, whose role was further investigated by in vitro functional studies. Significant decreases in SLC7A8 transport activity was detected for patient's variants (p.Val302Ile, p.Arg418His, p.Thr402Met and p.Val460Glu) further supporting a causative role for SLC7A8 in ARHL. Moreover, our preliminary data suggest that a relevant proportion of ARHL cases could be explained by SLC7A8 mutations.
Age-related hearing loss (ARHL) or presbycusis is one of the most prevalent chronic medical conditions associated with aging. Indeed, more than 30% of people aged over 65 years suffer ARHL (Gates and Mills, 2005; Huang and Tang, 2010; Van Eyken et al., 2007). Clinically, ARHL is defined as a progressive bilateral sensorineural impairment of hearing in high sound frequencies mainly caused by a mixture of 3 pathological changes: loss of the hair cells of the organ of Corti (sensory), atrophy of the stria vascularis (metabolic) and degeneration of spiral ganglion neurons (SGN), as well as the central auditory pathway (neural) (Gates and Mills, 2005; Schuknecht, 1955; Yamasoba et al., 2013). ARHL has a complex multifactorial etiology with both genetic and environmental factors contributing (Cruickshanks et al., 2010; Christensen et al., 2001). Although most people lose hearing acuity with age, it has been demonstrated that genetic heritability affects the susceptibility, onset and severity of ARHL (Wingfield et al., 2007; Cruickshanks et al., 2001; Gates et al., 1999; Karlsson et al., 1997; Cruickshanks et al., 1998). Unfortunately, the complexity of the pathology coupled with highly variable nature of the environmental factors, which cause cumulative effects, increases the difficulty in identifying the genetic contributors underlying ARHL. Most of the findings from genome-wide association studies (GWAS) performed into adult hearing function could neither be replicated between populations, nor the functional validation of those candidates be confirmed (Dawes and Payton, 2016). Mouse models, including inbred strains, have been essential for the identification of several defined loci that contribute to ARHL (Bowl and Dawson, 2015).SLC7A8/SLC3A2 is a Na+‐independent transporter of neutral amino acids that corresponds to system L also known as LAT2 (L-type Amino acid Transporter-2) (Pineda et al., 1999; Rossier et al., 1999; Oxender and Christensen, 1963). SLC7A8 is the catalytic subunit of the heterodimer and mediates obligatory exchange with 1:1 stoichiometry of all neutral amino acids, including the small ones (e.g. alanine, glycine, cysteine and serine), which are poor substrates for SLC7A5 (18), another exchanger with system L activity. Functional data indicate that the role of SLC7A8 is to equilibrate the relative concentrations of different amino acids across the plasma membrane instead of mediating their net uptake (Pineda et al., 1999; Meier et al., 2002; Verrey, 2003). The SLC7A8/SLC3A2 heterodimer is primarily expressed in renal proximal tubule, small intestine, blood-brain barrier and placenta, where it is thought to have a role in the flux of amino acids across cell barriers (Rossier et al., 1999; Bauch et al., 2003; Kanai and Endou, 2001; del Amo et al., 2008). So far, SLC7A8 research has been focused mainly on amino acid renal reabsorption. However, in vitro studies demonstrated that SLC7A8 could have a role in cystine efflux in epithelial cells and the in vivo deletion of Slc7a8 in a mouse model showed a moderate neutral aminoaciduria (Braun et al., 2011), suggesting compensation by other neutral amino acid transporters.Therefore, in order to better understand the physiology of SLC7A8, we generated null Slc7a8 knockout mice (Slc7a8−/−) (Font-LLitjós, 2009) and (Figure 1—figure supplement 1A). Here, we describe the detection of a hypoacusic phenotype in the Slc7a8−/− mouse model and demonstrate that novel loss-of-function SLC7A8 mutations constitute a primary cause in the development of ARHL in a cohort of elderly people from two isolated villages in Italy.
Figure 1—figure supplement 1.
Scheme of Slc7a8 knockout mouse generation.
(A) Diagram of the homologous recombination in Slc7a8 locus, the vector used to replace the coding region of the gene for a neomycin (Neo) resistance and the resulting recombinant locus. (B) Scheme of LAT2 protein, in gray deleted region in the Slc7a8
−/− mouse and in red is represented the epitope which anti-SLC7A8 antibody was generated.
Results
Slc7a8 ablation causes ARHL
SLC7A8 is highly expressed in the kidney, intestine and brain, and neither full-length nor truncated SLC7A8 protein were detected in membrane samples of Slc7a8−/− mice (Figure 1A). The Allen Brain Atlas (Allen Institute for Brain Science, 2004) localizes mouse brain SLC7A8 to the cortical subplate, cerebellum, thalamus and olfactory bulb. Our results showed that SLC7A8 protein was localized to the plasma membrane of neuronal axons in different brain regions such as, the choroid plexus, subfornical organ, cerebral cortex and hypothalamus by immunohistochemistry (Figure 1—figure supplement 2A). This specific localization in the brain pointed to the possibility that the absence of the transporter could potentially lead to neurological disorders. Behavioral screening showed that absence of SLC7A8 in mice does not affect either learning or memory (Figure 1—figure supplement 3). In contrast, a significant reduction in latency was observed in the rotarod acceleration test indicating impairment in motor coordination in Slc7a8−/− mice (Figure 1—figure supplement 3G). Reaffirming poorer motor coordination performance in the Slc7a8−/− mice, an increased exposure to shock on the treadmill was also observed (Figure 1—figure supplement 3B). Interestingly, a marked impairment was observed in the pre-pulse inhibition of acoustic startle response, which assesses the response to a high intensity acoustic stimulus (pulse) and its inhibition by a weaker pre-pulse. The response to a 120 dB single-pulse was significantly reduced in Slc7a8−/− mice (Figure 1B). The higher threshold required for responding to the acoustic stimulus in the PPI tests in Slc7a8−/− animals could potentially be indicative of a hearing impairment or to a defect in the stress response signaling.
Figure 1.
Hearing phenotype of C57BL6/J-129Sv Slc7a8 knockout mice.
(A) Representative image of western bloting of total membranes from kidney, brain and intestine of wild-type (+/+) and Slc7a8 knock out (-/-) mice in the absence (-) or presence (+) of 100 mM dithiothreitol reducing agent (DTT) of three independent biological samples for both sexes (male and female). Protein (50 μg) were loaded in 7% acrylamide SDS-PAGE gel. Molecular mass standard (KDa) are indicated. Red arrows point SLC7A8/CD98hc heterodimer band as well as the light subunit SLC7A8. Upper panel: Rabbit anti-SLC7A8. Bottom panel: Mouse anti-βactin. (B) Pre-Pulse Inhibition of the acoustic startle response (PPI). Mean and SEM are represented. Pulse: 120 dB single pulse. Pre-pulse inhibition test: six different pre-pulse intensities (70 to 90 dB) in pseudo random order with 15 s inter-trial intervals. Wild type (white circles, n = 19) and Slc7a8 (blue circles, n = 15) from 4- to 7-month-old are represented. Significant differences were determined using paired Student’s t-test, ***p<0.001 (C–F) Hearing phenotype in wild-type (Slc7a8 white, n = 11), heterozygous (Slc7a8, green, n = 12) and knockout (Slc7a8, blue, n = 14) mice, grouped by age (4–6 and 7–13 month old). (C,D) Auditory Brainstem Response (ABR) threshold in response to click, expressed as mean ±standard error (C), individual value (scatter plot, (D) and median (boxplot, (D). The significance of the differences was evaluated using ANOVA test, *p<0.05, **p<0.01 (Slc7a8 versus Slc7a8) and # p<0.05 (Slc7a8 versus Slc7a8). (E) Pie plot showing the percentage of normal hearing (all thresholds <45 dB SPL, white) mice and mice with mild (at least two tone burst threshold >45 dB SPL, orange) and severe (at least two tone burst threshold >60 dB SPL, red) hearing loss (HL), within each genotype and age group. (F) ABR thresholds in response to click and tone burst stimuli (8, 16, 24, 32 and 40 kHz) in mice from three genotypes separated by age group and hearing phenotype (normal hearing or hearing loss). Significant differences were determined using ANOVA test, *p<0.05, **p<0.01, ***p<0.001 (hearing impaired Slc7a8 versus normal hearing Slc7a8) and # p<0.05 (hearing impaired Slc7a8 versus Slc7a8).
(A) Diagram of the homologous recombination in Slc7a8 locus, the vector used to replace the coding region of the gene for a neomycin (Neo) resistance and the resulting recombinant locus. (B) Scheme of LAT2 protein, in gray deleted region in the Slc7a8
−/− mouse and in red is represented the epitope which anti-SLC7A8 antibody was generated.
(A) Wild-type mouse brain immunohistochemistry against SLC7A8 in wild type 4- to 7 months of age in mixed C57BL6/J-129Sv genetic background mice. Arrow is pointing SLC7A8 expression in cell membranes. (1) Cerebral cortex, SLC7A8 expression is localized to apical dendrites and synaptic area. (2 and 3) Preoptic Area. SLC7A8 expression in fibers. (4) Hypophysis. (5) Brain blood vessel. (6) Subfornical organ. (7) Choroid plexus. (B) Representative Image from the scan (Nanozoomer, Hamamatsu Photon) of the whole cochlea immunofluorescence. SLC7A8 (green), phalloidin (red) and DAPI (blue) markers of wild type (upper row) and Slc7a8−/− (bottom row) adult mice (4- to 7 months of age in mixed C57BL6/J-129Sv genetic background) are represented. The selected spiral ganglion areas (orange square) are magnified on the right, where white arrow points SLC7A8 signal in the spiral ganglia neurons that is specific as it fades completely in the Slc7a8−/− mice. Scale bar 100 μm.
(A to G) Behavior tests data (mean ±SEM) of wild type (open circles) and Slc7a8−/− (black circles) mice of 4- to 7 months of age in mixed C57BL6/J-129Sv genetic background. (A) Latency to fall off the rod in the rotarod test at increasing fixed rotating speed (rpm) (n = 16 wild type and 14 Slc7a8−/−); (B and C) Time of exposure to shock in the treadmill test. Higher values indicate poorer performance (n = 8 wild type and 8 Slc7a8−/−). (D to F) Morris Water Maze (MWM) test of 5 wild type and 8 Slc7a8−/− mice. (G) Represents Rotarod Acceleration Time from 4 to 40 rpm in 60 s. Unpaired Student’s t-test statistical analysis, p-value: *, ≤0.05. (H) Western blot against SLC7A8 of 50 µg of total membranes from hypophysis of wild type (+/+), Slc7a8+/− (+/-) and Slc7a8−/− (-/-) mice. Kidney sample from wild-type mice was used as a positive control. Samples were loaded in 7% acrylamide SDS-PAGE gel in non-reducing conditions. SLC7A8/CD98hc heterodimers (120 kDa) were detected. (I) Plasma corticosterone levels after acute stress. Data (mean ±SEM) from four wild type (open bars) and 5 Slc7a8−/− mice (black bars) are represented. Basal: time 0, Stress: just after mice were exposed to a 15 min restraint stress and Recovery: 90 min after the stress.
(A) Representative ABR recordings in response to click at decreasing intensities from 90 to 10 dB SPL from wild type (Slc7a8 white, n = 11), heterozygous (Slc7a8, green, n = 12) and knockout (Slc7a8, blue, n = 14) mice, grouped by age (4–6 and 7–13 month old). ABR waves I to IV are indicated and thresholds highlighted in bold. Detail of the first ms of the ABR recording in response to 70 dB SPL click showing the differences in the wave I latency and amplitude among genotypes (dashed lines). (B–E) Latency and amplitude of ABR waves, expressed as mean ±SE, in wild type (Slc7a8 white, n = 14), heterozygous (Slc7a8, green, n = 12) and knockout (Slc7a8, blue, n = 11) separated by age group (4–6 and 7–13 month old) and hearing phenotype (normal hearing and hearing loss). (B) Latency-intensity curves for ABR wave I. (C) Interpeak latencies I-II, II-IV and I-IV in response to 70 dB SPL click. Significant differences were determined using ANOVA test, *p<0.05 (Slc7a8 versus Slc7a8 mice). (D) Amplitude-intensity curves for ABR wave I. (E) Amplitudes of ABR wave I, II and IV. Significant differences were determined using ANOVA test, #p<0.05 (hearing loss Slc7a8 vs normal hearing Slc7a8+/−mice).
(A, B) Auditory Brainstem Response (ABR) thresholds in response to click stimuli in from wild type (Slc7a8 white, n = 18), heterozygous (Slc7a8, green, n = 5) and knockout (Slc7a8, blue, n = 15) mice, grouped by age (1–3, 4–6 and 7–13 month-old) and expressed as mean ±standard error (A), individual value (scatter plot, B) and median (boxplot, B). The significance of the differences was evaluated using ANOVA test, *p<0.05 (Slc7a8, vs Slc7a8). (C) Auditory Brainstem Response (ABR) thresholds in response to click stimuli in from wild type (Slc7a8 white, n = 18) and knockout (Slc7a8, blue, n = 15) mice at 2-, 3-, 4- and 5-month life. (D) Pie chart showing the percentage of mice showing normal hearing (all thresholds < 45 dB SPL, white), mild hearing loss (at least two tone burst threshold >45 dB SPL, orange) and severe (at least two tone burst threshold >60 dB SPL, red) hearing loss (HL), within each genotype and age group. (E) ABR thresholds in response to click and tone burst stimuli (8, 16, 24, 32 and 40 kHz) in mice from three genotypes separated by age group and hearing phenotype (normal hearing or hearing loss). Significant differences were determined using ANOVA test, **p<0.01, ***p<0.001 (hearing impaired Slc7a8 versus Slc7a8).
Figure 1—figure supplement 2.
SLC7A8 expression in mouse brain.
(A) Wild-type mouse brain immunohistochemistry against SLC7A8 in wild type 4- to 7 months of age in mixed C57BL6/J-129Sv genetic background mice. Arrow is pointing SLC7A8 expression in cell membranes. (1) Cerebral cortex, SLC7A8 expression is localized to apical dendrites and synaptic area. (2 and 3) Preoptic Area. SLC7A8 expression in fibers. (4) Hypophysis. (5) Brain blood vessel. (6) Subfornical organ. (7) Choroid plexus. (B) Representative Image from the scan (Nanozoomer, Hamamatsu Photon) of the whole cochlea immunofluorescence. SLC7A8 (green), phalloidin (red) and DAPI (blue) markers of wild type (upper row) and Slc7a8−/− (bottom row) adult mice (4- to 7 months of age in mixed C57BL6/J-129Sv genetic background) are represented. The selected spiral ganglion areas (orange square) are magnified on the right, where white arrow points SLC7A8 signal in the spiral ganglia neurons that is specific as it fades completely in the Slc7a8−/− mice. Scale bar 100 μm.
Figure 1—figure supplement 3.
Behavior phenotype.
(A to G) Behavior tests data (mean ±SEM) of wild type (open circles) and Slc7a8−/− (black circles) mice of 4- to 7 months of age in mixed C57BL6/J-129Sv genetic background. (A) Latency to fall off the rod in the rotarod test at increasing fixed rotating speed (rpm) (n = 16 wild type and 14 Slc7a8−/−); (B and C) Time of exposure to shock in the treadmill test. Higher values indicate poorer performance (n = 8 wild type and 8 Slc7a8−/−). (D to F) Morris Water Maze (MWM) test of 5 wild type and 8 Slc7a8−/− mice. (G) Represents Rotarod Acceleration Time from 4 to 40 rpm in 60 s. Unpaired Student’s t-test statistical analysis, p-value: *, ≤0.05. (H) Western blot against SLC7A8 of 50 µg of total membranes from hypophysis of wild type (+/+), Slc7a8+/− (+/-) and Slc7a8−/− (-/-) mice. Kidney sample from wild-type mice was used as a positive control. Samples were loaded in 7% acrylamide SDS-PAGE gel in non-reducing conditions. SLC7A8/CD98hc heterodimers (120 kDa) were detected. (I) Plasma corticosterone levels after acute stress. Data (mean ±SEM) from four wild type (open bars) and 5 Slc7a8−/− mice (black bars) are represented. Basal: time 0, Stress: just after mice were exposed to a 15 min restraint stress and Recovery: 90 min after the stress.
Hearing phenotype of C57BL6/J-129Sv Slc7a8 knockout mice.
(A) Representative image of western bloting of total membranes from kidney, brain and intestine of wild-type (+/+) and Slc7a8 knock out (-/-) mice in the absence (-) or presence (+) of 100 mM dithiothreitol reducing agent (DTT) of three independent biological samples for both sexes (male and female). Protein (50 μg) were loaded in 7% acrylamideSDS-PAGE gel. Molecular mass standard (KDa) are indicated. Red arrows point SLC7A8/CD98hc heterodimer band as well as the light subunit SLC7A8. Upper panel: Rabbit anti-SLC7A8. Bottom panel: Mouse anti-βactin. (B) Pre-Pulse Inhibition of the acoustic startle response (PPI). Mean and SEM are represented. Pulse: 120 dB single pulse. Pre-pulse inhibition test: six different pre-pulse intensities (70 to 90 dB) in pseudo random order with 15 s inter-trial intervals. Wild type (white circles, n = 19) and Slc7a8 (blue circles, n = 15) from 4- to 7-month-old are represented. Significant differences were determined using paired Student’s t-test, ***p<0.001 (C–F) Hearing phenotype in wild-type (Slc7a8 white, n = 11), heterozygous (Slc7a8, green, n = 12) and knockout (Slc7a8, blue, n = 14) mice, grouped by age (4–6 and 7–13 month old). (C,D) Auditory Brainstem Response (ABR) threshold in response to click, expressed as mean ±standard error (C), individual value (scatter plot, (D) and median (boxplot, (D). The significance of the differences was evaluated using ANOVA test, *p<0.05, **p<0.01 (Slc7a8 versus Slc7a8) and # p<0.05 (Slc7a8 versus Slc7a8). (E) Pie plot showing the percentage of normal hearing (all thresholds <45 dB SPL, white) mice and mice with mild (at least two tone burst threshold >45 dB SPL, orange) and severe (at least two tone burst threshold >60 dB SPL, red) hearing loss (HL), within each genotype and age group. (F) ABR thresholds in response to click and tone burst stimuli (8, 16, 24, 32 and 40 kHz) in mice from three genotypes separated by age group and hearing phenotype (normal hearing or hearing loss). Significant differences were determined using ANOVA test, *p<0.05, **p<0.01, ***p<0.001 (hearing impaired Slc7a8 versus normal hearing Slc7a8) and # p<0.05 (hearing impaired Slc7a8 versus Slc7a8).
Scheme of Slc7a8 knockout mouse generation.
(A) Diagram of the homologous recombination in Slc7a8 locus, the vector used to replace the coding region of the gene for a neomycin (Neo) resistance and the resulting recombinant locus. (B) Scheme of LAT2 protein, in gray deleted region in the Slc7a8
−/− mouse and in red is represented the epitope which anti-SLC7A8 antibody was generated.
SLC7A8 expression in mouse brain.
(A) Wild-type mouse brain immunohistochemistry against SLC7A8 in wild type 4- to 7 months of age in mixed C57BL6/J-129Sv genetic background mice. Arrow is pointing SLC7A8 expression in cell membranes. (1) Cerebral cortex, SLC7A8 expression is localized to apical dendrites and synaptic area. (2 and 3) Preoptic Area. SLC7A8 expression in fibers. (4) Hypophysis. (5) Brain blood vessel. (6) Subfornical organ. (7) Choroid plexus. (B) Representative Image from the scan (Nanozoomer, Hamamatsu Photon) of the whole cochlea immunofluorescence. SLC7A8 (green), phalloidin (red) and DAPI (blue) markers of wild type (upper row) and Slc7a8−/− (bottom row) adult mice (4- to 7 months of age in mixed C57BL6/J-129Sv genetic background) are represented. The selected spiral ganglion areas (orange square) are magnified on the right, where white arrow points SLC7A8 signal in the spiral ganglia neurons that is specific as it fades completely in the Slc7a8−/− mice. Scale bar 100 μm.
Behavior phenotype.
(A to G) Behavior tests data (mean ±SEM) of wild type (open circles) and Slc7a8−/− (black circles) mice of 4- to 7 months of age in mixed C57BL6/J-129Sv genetic background. (A) Latency to fall off the rod in the rotarod test at increasing fixed rotating speed (rpm) (n = 16 wild type and 14 Slc7a8−/−); (B and C) Time of exposure to shock in the treadmill test. Higher values indicate poorer performance (n = 8 wild type and 8 Slc7a8−/−). (D to F) Morris Water Maze (MWM) test of 5 wild type and 8 Slc7a8−/− mice. (G) Represents Rotarod Acceleration Time from 4 to 40 rpm in 60 s. Unpaired Student’s t-test statistical analysis, p-value: *, ≤0.05. (H) Western blot against SLC7A8 of 50 µg of total membranes from hypophysis of wild type (+/+), Slc7a8+/− (+/-) and Slc7a8−/− (-/-) mice. Kidney sample from wild-type mice was used as a positive control. Samples were loaded in 7% acrylamideSDS-PAGE gel in non-reducing conditions. SLC7A8/CD98hc heterodimers (120 kDa) were detected. (I) Plasma corticosterone levels after acute stress. Data (mean ±SEM) from four wild type (open bars) and 5 Slc7a8−/− mice (black bars) are represented. Basal: time 0, Stress: just after mice were exposed to a 15 min restraint stress and Recovery: 90 min after the stress.
ABR latencies and amplitudes of C57BL6/J-129Sv Slc7a8 knockout mice.
(A) Representative ABR recordings in response to click at decreasing intensities from 90 to 10 dB SPL from wild type (Slc7a8 white, n = 11), heterozygous (Slc7a8, green, n = 12) and knockout (Slc7a8, blue, n = 14) mice, grouped by age (4–6 and 7–13 month old). ABR waves I to IV are indicated and thresholds highlighted in bold. Detail of the first ms of the ABR recording in response to 70 dB SPL click showing the differences in the wave I latency and amplitude among genotypes (dashed lines). (B–E) Latency and amplitude of ABR waves, expressed as mean ±SE, in wild type (Slc7a8 white, n = 14), heterozygous (Slc7a8, green, n = 12) and knockout (Slc7a8, blue, n = 11) separated by age group (4–6 and 7–13 month old) and hearing phenotype (normal hearing and hearing loss). (B) Latency-intensity curves for ABR wave I. (C) Interpeak latencies I-II, II-IV and I-IV in response to 70 dB SPL click. Significant differences were determined using ANOVA test, *p<0.05 (Slc7a8 versus Slc7a8mice). (D) Amplitude-intensity curves for ABR wave I. (E) Amplitudes of ABR wave I, II and IV. Significant differences were determined using ANOVA test, #p<0.05 (hearing lossSlc7a8 vs normal hearing Slc7a8+/−mice).
Hearing phenotype of C57BL/6J Slc7a8 knockout mice.
(A, B) Auditory Brainstem Response (ABR) thresholds in response to click stimuli in from wild type (Slc7a8 white, n = 18), heterozygous (Slc7a8, green, n = 5) and knockout (Slc7a8, blue, n = 15) mice, grouped by age (1–3, 4–6 and 7–13 month-old) and expressed as mean ±standard error (A), individual value (scatter plot, B) and median (boxplot, B). The significance of the differences was evaluated using ANOVA test, *p<0.05 (Slc7a8, vs Slc7a8). (C) Auditory Brainstem Response (ABR) thresholds in response to click stimuli in from wild type (Slc7a8 white, n = 18) and knockout (Slc7a8, blue, n = 15) mice at 2-, 3-, 4- and 5-month life. (D) Pie chart showing the percentage of mice showing normal hearing (all thresholds < 45 dB SPL, white), mild hearing loss (at least two tone burst threshold >45 dB SPL, orange) and severe (at least two tone burst threshold >60 dB SPL, red) hearing loss (HL), within each genotype and age group. (E) ABR thresholds in response to click and tone burst stimuli (8, 16, 24, 32 and 40 kHz) in mice from three genotypes separated by age group and hearing phenotype (normal hearing or hearing loss). Significant differences were determined using ANOVA test, **p<0.01, ***p<0.001 (hearing impaired Slc7a8 versus Slc7a8).Response to stress is modulated by the hypothalamic-pituitary-adrenal axis via the release of corticosterone from the adrenal cortex (Smith and Vale, 2006). As SLC7A8 is expressed in the murine pituitary gland (Figure 1—figure supplement 2A and S3H), plasma corticosterone levels under stressing conditions were analyzed. No differences were observed in corticosterone levels at either basal conditions, nor under restraint stress in the Slc7a8−/− group, indicating a normal stress response in the absence of SLC7A8 (Figure 1—figure supplement 3I). Thus, a hearing impairment in Slc7a8−/− animals was considered the most probable cause of the differences observed in the acoustic startle response test (Figure 1B). The impact of the ablation of SLC7A8 on the auditory system was tested initially on mice with a mixed C57BL6/J‐129Sv genetic background.Auditory brainstem response (ABR) recording, which evaluates the functional integrity of the auditory system, was performed in Slc7a8−/− mice. Reinforcing our hypothesis, adult 4- to 6-month-old Slc7a8−/− mice showed significantly higher (p≤0.01) ABR thresholds in response to click stimulus, compared with age matched Slc7a8+/− and wild type mice, which maintain normal hearing thresholds (Figure 1C–E). The hearing loss observed in Slc7a8−/− mice affected the highest frequencies tested (20, 28 and 40 kHz) (Figure 1F). The analysis of latencies and amplitudes of the ABR waves in response to click stimuli, showed increased latency and decreased amplitude of wave I, but similar II-IV interpeak latency, in the Slc7a8−/− mice when compared with the other genotypes, pointing to a hypoacusis of peripheral origin without affectation of the central auditory pathway (Figure 1—figure supplement 4A to D).
Figure 1—figure supplement 4.
ABR latencies and amplitudes of C57BL6/J-129Sv Slc7a8 knockout mice.
(A) Representative ABR recordings in response to click at decreasing intensities from 90 to 10 dB SPL from wild type (Slc7a8 white, n = 11), heterozygous (Slc7a8, green, n = 12) and knockout (Slc7a8, blue, n = 14) mice, grouped by age (4–6 and 7–13 month old). ABR waves I to IV are indicated and thresholds highlighted in bold. Detail of the first ms of the ABR recording in response to 70 dB SPL click showing the differences in the wave I latency and amplitude among genotypes (dashed lines). (B–E) Latency and amplitude of ABR waves, expressed as mean ±SE, in wild type (Slc7a8 white, n = 14), heterozygous (Slc7a8, green, n = 12) and knockout (Slc7a8, blue, n = 11) separated by age group (4–6 and 7–13 month old) and hearing phenotype (normal hearing and hearing loss). (B) Latency-intensity curves for ABR wave I. (C) Interpeak latencies I-II, II-IV and I-IV in response to 70 dB SPL click. Significant differences were determined using ANOVA test, *p<0.05 (Slc7a8 versus Slc7a8 mice). (D) Amplitude-intensity curves for ABR wave I. (E) Amplitudes of ABR wave I, II and IV. Significant differences were determined using ANOVA test, #p<0.05 (hearing loss Slc7a8 vs normal hearing Slc7a8+/−mice).
Mice were grouped according to genotype, age and ABR threshold level and descriptive statistics calculated, showing that the penetrance of the hearing phenotype in the Slc7a8−/− mice is incomplete (Figure 1D and E). Therefore, mice were classified according to their hearing loss (HL) phenotype, defining normal hearing when ABR thresholds for all frequencies were <45 dB SPL, mild phenotype when at least two thresholds were between 45 and 60 dB SPL and severe hypoacusis when at least two thresholds were >60 dB SPL. At 4–6 months of age, Slc7a8−/− mice showed either severe (37.5%) or mild (25%) hearing loss, whilst mice from the other genotypic groups did not show hearing loss (Figure 1E). Next we studied 7–13 month-old mice, 50% of Slc7a8−/− mice presented severe hypoacusis and the hearing loss spread to lower frequencies with age. Slc7a8−/− mice with hearing loss showed statistically significant differences in ABR parameters when compared to the other genotypes (Figure 1F). Moreover, 43% of Slc7a8+/− mice developed mild hearing loss at 7–13 months, whereas the age-matched wild-type mice maintained intact hearing indicating a predisposition toward hearing loss in aged Slc7a8+/−mice (Figure 1E).The onset and severity of ARHL is attributed to both environmental and genetic factors (Cruickshanks et al., 2010). As the environmental factors were well controlled in all the experiments, thus the phenotypic variability could be attributed as the consequence of individual genetic differences. Indeed, it has been described that several strains of inbred mice present a predisposition to suffer ARHL dependent on multiple genetic factors (Kane et al., 2012; Murillo-Cuesta et al., 2010). Here, the hearing loss phenotype was confirmed in a second mouse strain, the inbread C57BL6/J genetic background (Figure 1—figure supplement 5). Additionally, longitudinal study of Slc7a8−/− mice into the inbred C57BL6/J genetic background showed higher penetrance than the mixed background throughout the ages studied (Figure 2—figure supplement 2).
Figure 1—figure supplement 5.
Hearing phenotype of C57BL/6J Slc7a8 knockout mice.
(A, B) Auditory Brainstem Response (ABR) thresholds in response to click stimuli in from wild type (Slc7a8 white, n = 18), heterozygous (Slc7a8, green, n = 5) and knockout (Slc7a8, blue, n = 15) mice, grouped by age (1–3, 4–6 and 7–13 month-old) and expressed as mean ±standard error (A), individual value (scatter plot, B) and median (boxplot, B). The significance of the differences was evaluated using ANOVA test, *p<0.05 (Slc7a8, vs Slc7a8). (C) Auditory Brainstem Response (ABR) thresholds in response to click stimuli in from wild type (Slc7a8 white, n = 18) and knockout (Slc7a8, blue, n = 15) mice at 2-, 3-, 4- and 5-month life. (D) Pie chart showing the percentage of mice showing normal hearing (all thresholds < 45 dB SPL, white), mild hearing loss (at least two tone burst threshold >45 dB SPL, orange) and severe (at least two tone burst threshold >60 dB SPL, red) hearing loss (HL), within each genotype and age group. (E) ABR thresholds in response to click and tone burst stimuli (8, 16, 24, 32 and 40 kHz) in mice from three genotypes separated by age group and hearing phenotype (normal hearing or hearing loss). Significant differences were determined using ANOVA test, **p<0.01, ***p<0.001 (hearing impaired Slc7a8 versus Slc7a8).
Figure 2—figure supplement 2.
Progression of hearing phenotype of C57BL/6J Slc7a8 knockout mice.
(A) Longitudinal analysis of Auditory Brainstem Response (ABR) thresholds in response to click stimuli in wild-type (Slc7a8+/+, white, n = 19), heterozygous (Slc7a8+/−, green, n = 13) and knockout (Slc7a8−/−, blue, n = 23) mice, through 2 to 5 months of age, and expressed as mean ±standard error. The significance of the differences was evaluated using ANOVA test, p<0.05 (Slc7a8−/− versus Slc7a8+/+ [*] or versus Slc7a8+/− [#]). (B) Pie chart showing the percentage of mice with normal hearing (all thresholds < 45 dB SPL, white), mild hearing loss (HL) (at least two tone burst threshold >45 dB SPL, orange) and severe HL (at least two tone burst threshold >60 dB SPL, red), within each genotype and age group.
Localization and quantification of SLC7A8 in the inner ear
The presence of SLC7A8 has previously been reported in the mouse cochlea (Yang et al., 2011; Uetsuka et al., 2015; Sharlin et al., 2011), and specifically localized to the stria vascularis by liquid chromatography tandem mass spectrophotometry and by Western blotting (Uetsuka et al., 2015). Here, SLC7A8 was detected in wild-type mouse cochlea by immunofluorescence supporting its localization to the spiral ligament and spiral limbus from the basal to the apical regions of the cochlea (Figure 2A and B). SLC7A8 immunolabeling was not observed in the stria vascularis. We observed an intense expression of SLC7A8 in the spiral ligament surrounding the stria indicating that the SLC7A8 epitope (Figure 1—figure supplement 1B) is either hidden or absent in the stria vascularis. Quantification of SLC7A8 expression in the cochlea showed half a dose of the transporter in the Slc7a8+/−than in wild-type mice, and its ablation in Slc7a8−/− mice (Figure 2C). A closer study of SLC7A8 immunofluorescence showed that the transporter is also expressed in the spiral ganglia neurons area (SGN) (Figure 1—figure supplement 2B).
Figure 2.
Immunolocalization of SLC7A8 in the mouse cochlea.
(A) Representative photomicrographs of cryosections of the base of the cochlea showing immunodetection for SLC7A8 (green) and s100 (red); and staining for DAPI (blue) or phalloidin (white) of wild type (upper row) and Slc7a8−/− mice (lower row). Scale bar, 100 µm. (B) On the left overlay image of a wild-type section indicating cochlea areas. Scale bar, 100 µm. On the right schematic drawing of the adult scala media adapted from Sanchez-Calderon et al. (2010). BC, border cells; CC, Claudius's cells; DC, Deiter's cells; HC, Hensen's cells; IC, intermediate cells; IHC, inner hair cells; IPC, inner phalangeal cells; Li, spiral limbus; MB, Basilar Membrane; OHC, outer hair cells; PC, pillar cells; RM, Reisner's membrane; SG, spiral ganglion; SL, spiral ligament; SV, stria vascularis; TM, tectorial membrane. (C) Quantification of SLC7A8 expression. Intensity of SLC7A8 immunofluorescence was normalized per mm2. Mean ±SEM from quadruplicates for each section, taken from apex, middle and basal cochlear turns of 4 wild-type (black), 3 Slc7a8+/− (green) and 4 Slc7a8−/− (blue) young (4- to 7-month-old) mice. Open and closed circles represent individual mice from C57BL6/J-129Sv or C57BL6/J backgrounds, respectevely. Unpaired Student’s t-test statistical analysis, p-values: *,≤0.05; **,≤0.01 and ***,≤0.001. (D) Quantification of SLC7A8 protein expression in the apex, middle and basal cochlear turns normalized per nuclei of young (2 month-old) (open bars) and old (12 month-old) (black bars) wild-type CBA mice. Data (mean ±SEM) were obtained from four cochlear sections obtained from three mice per group. Unpaired Student’s t-test statistical analysis, p-value: *,≤0.05.
(A) Slc7a8 mRNA expression in cochlea at different ages in mice in MF1/129Sv genetic background. Expression levels, normalized by Hrpt1 gene expression, are represented as n-fold relative to control group (1 to 2-month-old). Values are presented as mean ±SEM of triplicates from pooled sample of 3 mice per group. Unpaired Student’s t-test statistical analysis (*: E18.5 versus other groups. ^: 1–2 months versus other groups) p-values: *,^ p≤0.05; **,^^ p≤0.01; ***,^^^p≤0.001. (B and C) mRNA levels were determined by RT-qPCR in the cochlea of 3 wild-type and 3 Slc7a8−/− young (3 to 7-month-old) C57BL6/J mice run in triplicates. Data (mean ±SEM) correspond to relative value normalized with Rplp0 gene expression. Unpaired Student’s t-test statistical analysis, p-values: *,≤0.05, **, &&≤0.01, ***, &&&≤0.001 and ****, &&&&≤0.0001. (B) Potassium voltage-gated channel subfamily Q member 5 (Kcnq5), (C) interleukin-1 (Il1) and interleukin-6 (Il6).
(A) Longitudinal analysis of Auditory Brainstem Response (ABR) thresholds in response to click stimuli in wild-type (Slc7a8+/+, white, n = 19), heterozygous (Slc7a8+/−, green, n = 13) and knockout (Slc7a8−/−, blue, n = 23) mice, through 2 to 5 months of age, and expressed as mean ±standard error. The significance of the differences was evaluated using ANOVA test, p<0.05 (Slc7a8−/− versus Slc7a8+/+ [*] or versus Slc7a8+/− [#]). (B) Pie chart showing the percentage of mice with normal hearing (all thresholds < 45 dB SPL, white), mild hearing loss (HL) (at least two tone burst threshold >45 dB SPL, orange) and severe HL (at least two tone burst threshold >60 dB SPL, red), within each genotype and age group.
Immunolocalization of SLC7A8 in the mouse cochlea.
(A) Representative photomicrographs of cryosections of the base of the cochlea showing immunodetection for SLC7A8 (green) and s100 (red); and staining for DAPI (blue) or phalloidin (white) of wild type (upper row) and Slc7a8−/− mice (lower row). Scale bar, 100 µm. (B) On the left overlay image of a wild-type section indicating cochlea areas. Scale bar, 100 µm. On the right schematic drawing of the adult scala media adapted from Sanchez-Calderon et al. (2010). BC, border cells; CC, Claudius's cells; DC, Deiter's cells; HC, Hensen's cells; IC, intermediate cells; IHC, inner hair cells; IPC, inner phalangeal cells; Li, spiral limbus; MB, Basilar Membrane; OHC, outer hair cells; PC, pillar cells; RM, Reisner's membrane; SG, spiral ganglion; SL, spiral ligament; SV, stria vascularis; TM, tectorial membrane. (C) Quantification of SLC7A8 expression. Intensity of SLC7A8 immunofluorescence was normalized per mm2. Mean ±SEM from quadruplicates for each section, taken from apex, middle and basal cochlear turns of 4 wild-type (black), 3 Slc7a8+/− (green) and 4 Slc7a8−/− (blue) young (4- to 7-month-old) mice. Open and closed circles represent individual mice from C57BL6/J-129Sv or C57BL6/J backgrounds, respectevely. Unpaired Student’s t-test statistical analysis, p-values: *,≤0.05; **,≤0.01 and ***,≤0.001. (D) Quantification of SLC7A8 protein expression in the apex, middle and basal cochlear turns normalized per nuclei of young (2 month-old) (open bars) and old (12 month-old) (black bars) wild-type CBA mice. Data (mean ±SEM) were obtained from four cochlear sections obtained from three mice per group. Unpaired Student’s t-test statistical analysis, p-value: *,≤0.05.
Quantification of transcripts in the Slc7a8−/− mouse cochlea.
(A) Slc7a8 mRNA expression in cochlea at different ages in mice in MF1/129Sv genetic background. Expression levels, normalized by Hrpt1 gene expression, are represented as n-fold relative to control group (1 to 2-month-old). Values are presented as mean ±SEM of triplicates from pooled sample of 3 mice per group. Unpaired Student’s t-test statistical analysis (*: E18.5 versus other groups. ^: 1–2 months versus other groups) p-values: *,^ p≤0.05; **,^^ p≤0.01; ***,^^^p≤0.001. (B and C) mRNA levels were determined by RT-qPCR in the cochlea of 3 wild-type and 3 Slc7a8−/− young (3 to 7-month-old) C57BL6/J mice run in triplicates. Data (mean ±SEM) correspond to relative value normalized with Rplp0 gene expression. Unpaired Student’s t-test statistical analysis, p-values: *,≤0.05, **, &&≤0.01, ***, &&&≤0.001 and ****, &&&&≤0.0001. (B) Potassium voltage-gated channel subfamily Q member 5 (Kcnq5), (C) interleukin-1 (Il1) and interleukin-6 (Il6).
Progression of hearing phenotype of C57BL/6J Slc7a8 knockout mice.
(A) Longitudinal analysis of Auditory Brainstem Response (ABR) thresholds in response to click stimuli in wild-type (Slc7a8+/+, white, n = 19), heterozygous (Slc7a8+/−, green, n = 13) and knockout (Slc7a8−/−, blue, n = 23) mice, through 2 to 5 months of age, and expressed as mean ±standard error. The significance of the differences was evaluated using ANOVA test, p<0.05 (Slc7a8−/− versus Slc7a8+/+ [*] or versus Slc7a8+/− [#]). (B) Pie chart showing the percentage of mice with normal hearing (all thresholds < 45 dB SPL, white), mild hearing loss (HL) (at least two tone burst threshold >45 dB SPL, orange) and severe HL (at least two tone burst threshold >60 dB SPL, red), within each genotype and age group.The early HL onset and the progressive ARHL phenotype observed in Slc7a8−/− and Slc7a8+/− mice respectively, prompted us to compare the expression of SLC7A8 in wild-type cochlea at different ages (Figure 1D). Immunofluorescence quantification of SLC7A8 intensity at 2- and 12 months of age showed expression in the young mice and increased presence of the transporter in the older mice (Figure 2D). In the same line, Slc7a8 mRNA quantification from cochlea extracts showed a progressive increased expression throughout mouse life (Figure 2—figure supplement 1A).
Figure 2—figure supplement 1.
Quantification of transcripts in the Slc7a8−/− mouse cochlea.
(A) Slc7a8 mRNA expression in cochlea at different ages in mice in MF1/129Sv genetic background. Expression levels, normalized by Hrpt1 gene expression, are represented as n-fold relative to control group (1 to 2-month-old). Values are presented as mean ±SEM of triplicates from pooled sample of 3 mice per group. Unpaired Student’s t-test statistical analysis (*: E18.5 versus other groups. ^: 1–2 months versus other groups) p-values: *,^ p≤0.05; **,^^ p≤0.01; ***,^^^p≤0.001. (B and C) mRNA levels were determined by RT-qPCR in the cochlea of 3 wild-type and 3 Slc7a8−/− young (3 to 7-month-old) C57BL6/J mice run in triplicates. Data (mean ±SEM) correspond to relative value normalized with Rplp0 gene expression. Unpaired Student’s t-test statistical analysis, p-values: *,≤0.05, **, &&≤0.01, ***, &&&≤0.001 and ****, &&&&≤0.0001. (B) Potassium voltage-gated channel subfamily Q member 5 (Kcnq5), (C) interleukin-1 (Il1) and interleukin-6 (Il6).
Lack of Slc7a8 induced damage in the organ of Corti, spiral ganglion and stria vascularis
The cytoarchitecture of the inner ear was studied by hematoxylin/eosin staining (Figure 3), immunofluorescence (Figure 4 and Figure 4—figure supplement 1) and mRNA detection of several cochlear markers (Figure 3D and Figure 2—figure supplement 1). Most of the structures of the cochlear duct, including spiral ligament, spiral limbus, tectorial and basilar membranes showed a normal gross cytoarchitecture in the Slc7a8−/− mice. In contrast, in the basal turns of the cochlea we observed that 3 out of 6 Slc7a8−/− mice evaluated showed complete loss of hair cells and flat epithelia, while only one Slc7a8−/− mouse showed intact epithelia in the organ of Corti (Figure 3A). Likewise, loss of cells in the spiral ganglia, especially in the basal regions of the cochlea, was observed (Figure 3A). Slc7a8−/− mice at 4 to 7 months of age presented ~50% of cell loss in the spiral ganglion compared with wild type mice (Figure 3B). Decreased number of cells in the ganglia significantly correlates with ABR threshold and HL phenotype (Figure 3—figure supplement 1and B). Concomitantly with the loss of hair cells and spiral ganglion (SG) nuclei in Slc7a8−/− mice, the messenger levels of cell type specific biomarkers, such as the potassium voltage-gated channels Kcnq2, Kcnq3 and Kcnq5, and the transporter Slc26a5, which are expressed in the organ of Corti and SG were down-regulated respectively (Figure 3D and Figure 2—figure supplement 2B).
Figure 3.
Cytoarchitecture of the Slc7a8−/− mouse cochlea.
(A) Hematoxylin and Eosin staining of the base of the cochlea. Representative photomicrographs taken from paraffin sections of wild-type and hipoacusic Slc7a8−/− mice. OC, Organ of Corti; SG, spiral ganglia region; and SL, spiral ligament. * Indicates loss of hair cells in the organ of Corti (first column), loss of neurons in the spiral ganglia (second column) and lower nuclei density in the spiral ligament (third column). Scale bar 100 μm. (B) Quantification of the number of neurons in the spiral ganglia (SG) in the basal turns of the cochlea. Y axis represents the mean nuclei quantification of 5 to 10 areas in SG. (C) Quantification of the number of nuclei in the spiral ligament (SL) of the basal turns of the cochlea by immunofluorescence using DAPI staining. For each sample, 12 overlaps of Z-stacks areas were used to quantify number of nuclei. Unpaired Student’s t-test statistical analysis: **, p≤0.01 (A to C) 4 wild-type (black), 3 Slc7a8+/− (green) and 4 Slc7a8−/− (blue) mice at 4 to 7-month-old are represented. Circles represent the average of the quadruplicate analysis performed in each mouse of C57BL6/J-129Sv (open) and C57BL6/J (filled) background. (D) Quantification of mRNA markers by RT-qPCR PCR. Cochlear gene expression of Slc26a5, Tbx18, Kcnq2 and Kcnq3 in the cochlea at 3-month-old and 7 months wild-type (white bars) and Slc7a8−/− (blue bars) C57BL6/J mice. Expression levels, normalized with Rplp0 gene expression, are represented as n-fold relative to control group. Values are presented as mean ±SEM of triplicates from pool samples of three mice per condition. Unpaired Student’s t-test statistical analysis, p-values: *p≤0.05; **p≤0.01; ***p≤0.001.
(A) Pearson’s correlation (CI 95%) between ABR threshold and Spiral Ganglia (SG) nuclei number with a p-value of 0.001 is represented. (B–D) Individual mouse representation of SG nuclei number (B), Intensity of Kir4.1 marker (C) and number or fibrocytes in the spiral ligament (D) categorized by mouse phenotype: normal (open bars), mild (orange bars) and severe (red bars) hearing loss. Individual circles represent the average of the replicates for each analysis from wild-type (black bars), Slc7a8+/− (green bars) and Slc7a8−/− (blue bars) adult mice (4- to 7-month-old); either C57BL6/J-129Sv (open) or C57BL6/J (filled) backgrounds. Paired Student’s t-test statistical analysis, p-value: *,≤0.05 and **,≤0.01.
Figure 4.
Immunofluorescence of cochlear markers in the Slc7a8−/− mouse.
(A) Representative photomicrographs of cryosections (10 μm) from the basal turn of the cochlea from wild type (1 and 4), Slc7a8+/− (2 and 5) and Slc7a8−/− (3 and 6) mice labeled for Kir4.1 (green), phalloidin (red) and DAPI (blue) (1 to 3), or for s100 (red), phalloidin (cyan) and DAPI (blue) (4 to 6). Scale bar, 100 µm. (B, C and D) Graph representing the quantification of Kir4.1, s100 and phalloidin (Pha) labeling intensity in the basal turn of the cochlea. Means ± SEM, normalized per mm2 of 4 wild type (black bars), 3 Slc7a8+/− (green bars) and 4 Slc7a8−/− (blue bars) young (4- to 7-month-old) mice are represented. Individual circles represent the average of the quadruplicate analysis of sections from each mice of either C57BL6/J-129Sv (open) or C57BL6/J (filled) backgrounds. Unpaired Student’s t-test statistical analysis, p-value: *,≤0.05.
Quantification of immunofluorescence labeling normalized per mm2 of Kir4.1 (A), s100 (B), phalloidin (Pha) (C) and IBA1 (D) in apical, middle and basal turns cryosections of the cochlea. Mean ±SEM data were compiled from 3 to 4 wild type (black bars), 3 Slc7a8+/− (green bars) and 4 Slc7a8−/− (blue bars) adult (4- to 7-month-old) mice. Individual circles represent the average of the quadruplicate analysis of sections from mice of either C57BL6/J-129Sv (open) or C57BL6/J (filled) backgrounds. Unpaired Student’s t-test statistical analysis, p-value: *,≤0.05.
Figure 4—figure supplement 1.
Quantification of the intensity of cell type biomarkers in apical and middle cochlear regions.
Quantification of immunofluorescence labeling normalized per mm2 of Kir4.1 (A), s100 (B), phalloidin (Pha) (C) and IBA1 (D) in apical, middle and basal turns cryosections of the cochlea. Mean ±SEM data were compiled from 3 to 4 wild type (black bars), 3 Slc7a8+/− (green bars) and 4 Slc7a8−/− (blue bars) adult (4- to 7-month-old) mice. Individual circles represent the average of the quadruplicate analysis of sections from mice of either C57BL6/J-129Sv (open) or C57BL6/J (filled) backgrounds. Unpaired Student’s t-test statistical analysis, p-value: *,≤0.05.
Figure 3—figure supplement 1.
Correlations of the cell numbers and cell type biomarkers with HL phenotype.
(A) Pearson’s correlation (CI 95%) between ABR threshold and Spiral Ganglia (SG) nuclei number with a p-value of 0.001 is represented. (B–D) Individual mouse representation of SG nuclei number (B), Intensity of Kir4.1 marker (C) and number or fibrocytes in the spiral ligament (D) categorized by mouse phenotype: normal (open bars), mild (orange bars) and severe (red bars) hearing loss. Individual circles represent the average of the replicates for each analysis from wild-type (black bars), Slc7a8+/− (green bars) and Slc7a8−/− (blue bars) adult mice (4- to 7-month-old); either C57BL6/J-129Sv (open) or C57BL6/J (filled) backgrounds. Paired Student’s t-test statistical analysis, p-value: *,≤0.05 and **,≤0.01.
Cytoarchitecture of the Slc7a8−/− mouse cochlea.
(A) Hematoxylin and Eosin staining of the base of the cochlea. Representative photomicrographs taken from paraffin sections of wild-type and hipoacusic Slc7a8−/− mice. OC, Organ of Corti; SG, spiral ganglia region; and SL, spiral ligament. * Indicates loss of hair cells in the organ of Corti (first column), loss of neurons in the spiral ganglia (second column) and lower nuclei density in the spiral ligament (third column). Scale bar 100 μm. (B) Quantification of the number of neurons in the spiral ganglia (SG) in the basal turns of the cochlea. Y axis represents the mean nuclei quantification of 5 to 10 areas in SG. (C) Quantification of the number of nuclei in the spiral ligament (SL) of the basal turns of the cochlea by immunofluorescence using DAPI staining. For each sample, 12 overlaps of Z-stacks areas were used to quantify number of nuclei. Unpaired Student’s t-test statistical analysis: **, p≤0.01 (A to C) 4 wild-type (black), 3 Slc7a8+/− (green) and 4 Slc7a8−/− (blue) mice at 4 to 7-month-old are represented. Circles represent the average of the quadruplicate analysis performed in each mouse of C57BL6/J-129Sv (open) and C57BL6/J (filled) background. (D) Quantification of mRNA markers by RT-qPCR PCR. Cochlear gene expression of Slc26a5, Tbx18, Kcnq2 and Kcnq3 in the cochlea at 3-month-old and 7 months wild-type (white bars) and Slc7a8−/− (blue bars) C57BL6/J mice. Expression levels, normalized with Rplp0 gene expression, are represented as n-fold relative to control group. Values are presented as mean ±SEM of triplicates from pool samples of three mice per condition. Unpaired Student’s t-test statistical analysis, p-values: *p≤0.05; **p≤0.01; ***p≤0.001.
Correlations of the cell numbers and cell type biomarkers with HL phenotype.
(A) Pearson’s correlation (CI 95%) between ABR threshold and Spiral Ganglia (SG) nuclei number with a p-value of 0.001 is represented. (B–D) Individual mouse representation of SG nuclei number (B), Intensity of Kir4.1 marker (C) and number or fibrocytes in the spiral ligament (D) categorized by mouse phenotype: normal (open bars), mild (orange bars) and severe (red bars) hearing loss. Individual circles represent the average of the replicates for each analysis from wild-type (black bars), Slc7a8+/− (green bars) and Slc7a8−/− (blue bars) adult mice (4- to 7-month-old); either C57BL6/J-129Sv (open) or C57BL6/J (filled) backgrounds. Paired Student’s t-test statistical analysis, p-value: *,≤0.05 and **,≤0.01.
Immunofluorescence of cochlear markers in the Slc7a8−/− mouse.
(A) Representative photomicrographs of cryosections (10 μm) from the basal turn of the cochlea from wild type (1 and 4), Slc7a8+/− (2 and 5) and Slc7a8−/− (3 and 6) mice labeled for Kir4.1 (green), phalloidin (red) and DAPI (blue) (1 to 3), or for s100 (red), phalloidin (cyan) and DAPI (blue) (4 to 6). Scale bar, 100 µm. (B, C and D) Graph representing the quantification of Kir4.1, s100 and phalloidin (Pha) labeling intensity in the basal turn of the cochlea. Means ± SEM, normalized per mm2 of 4 wild type (black bars), 3 Slc7a8+/− (green bars) and 4 Slc7a8−/− (blue bars) young (4- to 7-month-old) mice are represented. Individual circles represent the average of the quadruplicate analysis of sections from each mice of either C57BL6/J-129Sv (open) or C57BL6/J (filled) backgrounds. Unpaired Student’s t-test statistical analysis, p-value: *,≤0.05.
Quantification of the intensity of cell type biomarkers in apical and middle cochlear regions.
Quantification of immunofluorescence labeling normalized per mm2 of Kir4.1 (A), s100 (B), phalloidin (Pha) (C) and IBA1 (D) in apical, middle and basal turns cryosections of the cochlea. Mean ±SEM data were compiled from 3 to 4 wild type (black bars), 3 Slc7a8+/− (green bars) and 4 Slc7a8−/− (blue bars) adult (4- to 7-month-old) mice. Individual circles represent the average of the quadruplicate analysis of sections from mice of either C57BL6/J-129Sv (open) or C57BL6/J (filled) backgrounds. Unpaired Student’s t-test statistical analysis, p-value: *,≤0.05.Less densely packed cells in the spiral ligament were observed in Slc7a8−/− than in wild-type mice (Figure 3A). Reinforcing this observation, the expression of Kir4.1, a potassium channel highly expressed in stria vascularis cells (Ando and Takeuchi, 1999), was also dramatically reduced by 50% in Slc7a8−/− (Figure 4B and Figure 4—figure supplement 1A). Likewise, decreased expression of Kir4.1 marker correlates with HL phenotype (Figure 3—figure supplement 1C). Phalloidin labeling of actin fibers in the basal cells of the stria vascularis was also decreased 50% in the base of the cochlea (Figure 4C and Figure 4—figure supplement 1).SLC7A8 is abundantly expressed in fibrocytes of the spiral ligament and limbus (Figure 2), accordingly the number of fibrocytes in the spiral ligament decreased by 2/3 and 1/3 in the null and Slc7a8+/− mice, respectively (Figure 3C). Moreover, mice with severe HL phenotype showed 30% less number of fibrocytes in the spiral ligament (Figure 3—figure supplement 1D). The expression of the transcription factor Tbx18, essential for fibrocytes development and differentiation, was 50% less in Slc7a8−/− than in wild-type mouse cochleae (Figure 3D). In contrast, the expression of s100, fibrocyte types I and II marker, did not show significant differences (Figure 4D and Figure 4—figure supplement 1C).
Mutations in SLC7A8 are associated with ARHL
Once we associated mouseSLC7A8 transporter with deafness and identified it as a potential ARHL gene, screening for mutations in human populations was initiated. Whole genome sequencing (WGS) and audiogram test data obtained from 147 individuals from isolated villages in Italy were included in the study. The inclusion criteria were people 50 years old or older with an audiogram test done at high frequencies (Pure-tone audiometric PTA-H, 4 and 8 kHz). Individuals with pure-tone average for high frequencies (PTA-H) greater than or equal to 40 decibels hearing level (dB HL) were considered ARHL cases, whilst people with PTA-H less than 25 dB were considered as controls. A total of 66 cases suffering ARHL and 81 controls were selected. The gene-targeted studies conducted in this isolated cohort succeeded in detecting seven heterozygous missense variants (Table 1). Four of the variants: p.Val460Glu (V460E), p.Thr402Met (T402M), p.Val302Ile (V302I) and p.Arg418His (R418C) belong to ARHL cases (see Audiogram in Figure 5—figure supplement 1A) and other three: p.Arg8Pro (R8P), p.Ala94Thr (A94T) and p.Arg185Gln (R185L) to the control group (see Audiogram in Audiogram in Figure 5—figure supplement 1B).
Table 1.
SLC7A8 Humans mutations found in ARHL and controls individuals.
Phenotype
Age
Sex
Chr. 14
Variant
Consequence
Code
Frequency
Esp6500siv2
1000 g
Campion
ExAC
Studied cohort
ARHL
75
Female
23597290
14:23597290 A / T
p.Val460Glu
V460E
NA
NA
0.0013
0.00002475
0.015
ARHL
57
Male
23598917
14:23598917 G / A
p.Thr402Met
T402M
NA
NA
0.0047
0.00002471
0.015
ARHL
75
Male
23608641
14:23608641 C / T (rs142951280)
p.Val302Ile
V302I
0.0005
NA
0.0047
0.0004613
0.015
ARHL
86
Female
23598870
14:23598870 G / A (rs146946494)
p.Arg418Cys
R418C
0.0005
NA
0.002
0.00002477
0.015
control
50
Male
23652101
14:23652101 C / G (rs141772308)
p.Arg8Pro
R8P
0.0008
NA
0.0013
0.0008156
0.012
control
50
Male
23635621
14:23635621 C / T (rs139927895)
p.Ala94Thr
A94T
0.0012
0.002
0.0013
0.00202
0.012
control
90
Female
23612368
14:23612368 C / A (rs149245114)
p.Arg185Gln
R185L
NA
NA
0.002
0.00002471
0.012
ARHL (age-related hearing loss). The age (years) of the subject when the Audiogram was performed is indicated. Variant [CHR: position reference/alternate (dbSNP135rsID)]. Consequence [HGUS annotation (protein change)]. Code [short description of the alternate variant]. Frequency of the mutations: Esp6500siv2 (NHLBI Exome Sequencing Project), 1000 g (1000 Genomes Project), Campion (The Allele Frequency Net Database) and ExAC (The Exome Aggregation Consortium).
Figure 5—figure supplement 1.
Audiogram of patients with ARHL and localization of the mutations in SLC7A8 protein.
(A and B) Graphs representing the pure-tone audiometry performed using standard audiometers in ARHL patients and controls carrying SLC7A8 mutations. The analysis of hearing functions was performed by determining the pure tone average of air conduction (PTA) at different frequencies: lower (0.125, 0.25 and 0.5 kHz), medium (1 and 2 kHz), and high (4, 8 kHz). Audiometry of the best hearing ear is shown for each individual. Salmon box indicates the inclusion criteria considered for ARHL phenotype. (A) ARHL cases (threshold >40 dB at PTA-H) and (B) Controls (threshold <25 dB at PTA-H). (C–D) Cartoon representation of the actual structural model of SLC7A8/CD98hc heterodimer. (C) The ectodomain of human CD98hc (gray) and human SLC7A8 (pale-green) in an outward-facing conformation are shown. The transmembrane (TM) domain of CD98hc is not shown because there is no structural information about its localization. Residues involved in sequence variants identified in patients with ARHL are highlighted (atoms represented by spheres). Atoms are colored according to: O (red), N (blue) and C-atoms depending on the residue (V302, pale-pink; T402, magenta; R418, gray and V460, slate-blue). The pale-yellow band is shown to visualize the insertion of SLC7A8 in the membrane. Residue R418 is located in the intracellular loop between TM domains 10 and 11, and residue V460 is located at the end of the TM domain 12, just before the intracellular C-terminus that is not depicted. (D) Top view close-up from outside the cell showing the localization of residues V302 and T402, respectively. To facilitate the view, the extracellular domain of CD98hc has been deleted. Unwound segments of TM domains 1 and 6 that interact with the α-amino-carboxyl end of the amino acid substrates are colored in blue and red respectively. Residue V302 is located in the extracellular loop 4 (EL4) (orange), which contains a double α helix structure that closes the substrate binding cavity in the inward-facing conformations. Residue T402 is located in TM domain 10 facing the substrate binding cavity.
ARHL (age-related hearing loss). The age (years) of the subject when the Audiogram was performed is indicated. Variant [CHR: position reference/alternate (dbSNP135rsID)]. Consequence [HGUS annotation (protein change)]. Code [short description of the alternate variant]. Frequency of the mutations: Esp6500siv2 (NHLBI Exome Sequencing Project), 1000 g (1000 Genomes Project), Campion (The Allele Frequency Net Database) and ExAC (The Exome Aggregation Consortium).All the mutations found in SLC7A8 cases and controls from isolated villages of Friuli Venezia Giulia exhibited different frequencies in comparison to public data bases, such as ExAC among others (see Table 1). According to ExAC database’s constrain metrics (Lek et al., 2016), the gene shows evidence of tolerance of both loss of function (pLi = 0) and missense variation (missense Z score = −0.14).
Functional studies of SLC7A8 mutations
A structural model of humanSLC7A8 protein built using the homologous protein AdiC (Kowalczyk et al., 2011) in the outward-facing conformation (Rosell et al., 2014) (Figure 5—figure supplement 1C and D) was used to localize all the mutations identified here. Interestingly, three of the four mutations found in ARHL patients were located in very striking places: (i) V302 is a conserved amino acid located in the extracellular loop four which corresponds to the external lid that closes the substrate binding site when the transporter is open to the cytosol, (ii) T402 is located in transmembrane (TM) domain 10 facing to the substrate binding site, and (iii) V460 is located at the very end of TM domain 12, with potential interaction with the plasma membrane. In contrast, R418 is in the intracellular loop 5, between TM domain 10 and TM domain 11 and with no functional role described in transporters with the LeuT-fold (Krishnamurthy and Gouaux, 2012). Thus, three of these mutations were promising candidates to affect the transporter function due to their crucial location.In vitro functional characterization of variants present in patients with ARHL and controls was performed by measuring amino acid uptake in HeLa cells co-transfected with the heavy subunit CD98hc and Strep tagged-SLC7A8 wild type and variants (Figure 5). Co-expression of the light (SLC7A8) and the heavy (CD98hc) subunits in the same cell increases the plasma membrane localization of the transporter (Rosell et al., 2014). All tested variants showed expression levels comparable to those of wild type, except for V460E that showed only 20% expression of wild -ype protein (Figure 5—source data 1), being the only variant that did not reach the plasma membrane as indicated by the lack of co-localization with wheat germ agglutinin staining (Figure 5A). Amino acid transport induced by SLC7A8 was analyzed for wild type and the identified variants (Figure 5B). All variants present in controls (R8P, R186L and A94T) conserved more than 80% of alanine transport compared with wild-type protein. Three variants found in patients with ARHL showed diminished alanine transport activity: T402M and V460E presented little residual transport activity (14.6 ± 2.6% and 3.6 ± 0.3% of wild-type activity, respectively) and R418C showed 50.7 ± 5.4% of wild-type alanine transport. Surprisingly, V302I presented similar alanine transport levels to wild type SLC7A8. Location of residue V302 within EL4 (within the external substrate lid (Figure 5—figure supplement 1D) led us to additionally measure a larger size SLC7A8 substrate, whose transport could potentially be more compromised than that of a small substrate (e.g. alanine). Interestingly, V302I transport activity of tyrosine was found to be only 40.0 ± 1.6% of wild-type SLC7A8. Because the V302I mutation showed a substrate-dependent impact, tyrosine transport in the other variants was also tested (Figure 5B). Other SLC7A8 variants found in patients with ARHL and controls showed similar decreased transport activity for alanine and tyrosine. Thus, the SLC7A8-induced tyrosine transport was clearly defective in the four variants found in patients with ARHL, whereas it was barely affected (>85% of wild-type transport activity) in the variants found in controls.
Figure 5.
In vitro characterization of SLC7A8 mutants.
(A) Panel showing representative images of immunofluorescence of wild type and the indicated SLC7A8 mutants overexpressed in HeLa cells. Overlay of SLC7A8 (green), wheat germ agglutinin (WGA, membrane marker) (red) and the nuclear marker DAPI (blue) labeling. All SLC7A8 variants, except V460E, reached the plasma membrane. (B) Alanine (Ala) and tyrosine (Tyr) transport activity of human SLC7A8 wild type (WT) and mutants in transfected HeLa cells. SLC7A8 transport activity, corrected by SLC7A8-GFP expression, is presented as percentage of wild-type SLC7A8 transport activity. Data (mean ±SEM) corresponds to three independent experiments with quadruplicates. Mutants activity comparing with its, respectively, wild-type transport unpaired Student’s t-test statistical analysis is represented, p-values: *,≤0.05; **,≤0.01 and ***,≤0.001.
Percentage of overexpressed mutated protein compared to the wild type (% Prot.).
(A and B) Graphs representing the pure-tone audiometry performed using standard audiometers in ARHL patients and controls carrying SLC7A8 mutations. The analysis of hearing functions was performed by determining the pure tone average of air conduction (PTA) at different frequencies: lower (0.125, 0.25 and 0.5 kHz), medium (1 and 2 kHz), and high (4, 8 kHz). Audiometry of the best hearing ear is shown for each individual. Salmon box indicates the inclusion criteria considered for ARHL phenotype. (A) ARHL cases (threshold >40 dB at PTA-H) and (B) Controls (threshold <25 dB at PTA-H). (C–D) Cartoon representation of the actual structural model of SLC7A8/CD98hc heterodimer. (C) The ectodomain of human CD98hc (gray) and human SLC7A8 (pale-green) in an outward-facing conformation are shown. The transmembrane (TM) domain of CD98hc is not shown because there is no structural information about its localization. Residues involved in sequence variants identified in patients with ARHL are highlighted (atoms represented by spheres). Atoms are colored according to: O (red), N (blue) and C-atoms depending on the residue (V302, pale-pink; T402, magenta; R418, gray and V460, slate-blue). The pale-yellow band is shown to visualize the insertion of SLC7A8 in the membrane. Residue R418 is located in the intracellular loop between TM domains 10 and 11, and residue V460 is located at the end of the TM domain 12, just before the intracellular C-terminus that is not depicted. (D) Top view close-up from outside the cell showing the localization of residues V302 and T402, respectively. To facilitate the view, the extracellular domain of CD98hc has been deleted. Unwound segments of TM domains 1 and 6 that interact with the α-amino-carboxyl end of the amino acid substrates are colored in blue and red respectively. Residue V302 is located in the extracellular loop 4 (EL4) (orange), which contains a double α helix structure that closes the substrate binding cavity in the inward-facing conformations. Residue T402 is located in TM domain 10 facing the substrate binding cavity.
In vitro characterization of SLC7A8 mutants.
(A) Panel showing representative images of immunofluorescence of wild type and the indicated SLC7A8 mutants overexpressed in HeLa cells. Overlay of SLC7A8 (green), wheat germ agglutinin (WGA, membrane marker) (red) and the nuclear marker DAPI (blue) labeling. All SLC7A8 variants, except V460E, reached the plasma membrane. (B) Alanine (Ala) and tyrosine (Tyr) transport activity of humanSLC7A8 wild type (WT) and mutants in transfected HeLa cells. SLC7A8 transport activity, corrected by SLC7A8-GFP expression, is presented as percentage of wild-type SLC7A8 transport activity. Data (mean ±SEM) corresponds to three independent experiments with quadruplicates. Mutants activity comparing with its, respectively, wild-type transport unpaired Student’s t-test statistical analysis is represented, p-values: *,≤0.05; **,≤0.01 and ***,≤0.001.
Mutants expression and oligonucleotides for Site-Directed Mutagenesis (5’-3’).
Percentage of overexpressed mutated protein compared to the wild type (% Prot.).
Audiogram of patients with ARHL and localization of the mutations in SLC7A8 protein.
(A and B) Graphs representing the pure-tone audiometry performed using standard audiometers in ARHL patients and controls carrying SLC7A8 mutations. The analysis of hearing functions was performed by determining the pure tone average of air conduction (PTA) at different frequencies: lower (0.125, 0.25 and 0.5 kHz), medium (1 and 2 kHz), and high (4, 8 kHz). Audiometry of the best hearing ear is shown for each individual. Salmon box indicates the inclusion criteria considered for ARHL phenotype. (A) ARHL cases (threshold >40 dB at PTA-H) and (B) Controls (threshold <25 dB at PTA-H). (C–D) Cartoon representation of the actual structural model of SLC7A8/CD98hc heterodimer. (C) The ectodomain of humanCD98hc (gray) and humanSLC7A8 (pale-green) in an outward-facing conformation are shown. The transmembrane (TM) domain of CD98hc is not shown because there is no structural information about its localization. Residues involved in sequence variants identified in patients with ARHL are highlighted (atoms represented by spheres). Atoms are colored according to: O (red), N (blue) and C-atoms depending on the residue (V302, pale-pink; T402, magenta; R418, gray and V460, slate-blue). The pale-yellow band is shown to visualize the insertion of SLC7A8 in the membrane. Residue R418 is located in the intracellular loop between TM domains 10 and 11, and residue V460 is located at the end of the TM domain 12, just before the intracellular C-terminus that is not depicted. (D) Top view close-up from outside the cell showing the localization of residues V302 and T402, respectively. To facilitate the view, the extracellular domain of CD98hc has been deleted. Unwound segments of TM domains 1 and 6 that interact with the α-amino-carboxyl end of the amino acid substrates are colored in blue and red respectively. Residue V302 is located in the extracellular loop 4 (EL4) (orange), which contains a double α helix structure that closes the substrate binding cavity in the inward-facing conformations. Residue T402 is located in TM domain 10 facing the substrate binding cavity.
Discussion
Here, we show that loss of function of the amino acid transporter SLC7A8 is associated with ARHL in both humans and mice. Full ablation of SLC7A8 transporter in mice produced a hearing loss defect with incomplete penetrance affecting mainly high-frequency sounds, a characteristic of ARHL (Figures 1C–F, S5 and S6). Interestingly, hearing loss severity increases with age in Slc7a8mice (Figures 1C–F and S6). Similarly, Slc7a8 heterozygous mice showed increased hearing loss penetrance with age, as indicated by the late onset of the phenotype (starting from 7 months onwards) (Figures 1E, S5 and S6). In addition, SLC7A8 expression in wild type cochlea rises during ageing (Figure 2D and S7A). In patients with ARHL we identified four SLC7A8 variants that showed loss of function of transport of tyrosine (Figure 5B). Altogether, these results indicate that full SLC7A8 function is needed to keep an optimal hearing function throughout life, with half a dose of SLC7A8 being enough to accelerate ARHL phenotype in mice and humans.The hearing loss (HL) phenotype in the Slc7a8mice has been confirmed on two genetic backgrounds (mixed C57BL6/J-129Sv; Figure 1, and inbred C57BL6/J; Figure 1—figure supplement 5). Interestingly, onset and penetrance, but not severity, was increased in the hearing loss trait of Slc7a8mice in the pure C57BL6/J background (Figure 1—figure supplement 5). It is well-known that the C57BL6/J background carry a mutation in the Cdh23 gene causing early onset of ARHL (Noben-Trauth et al., 2003; Mazelová et al., 2003). It is also worthwhile to mention that all the inbred C57BL6/J mice used to perform the experiments in this research were positive for the ARHL susceptibility allele A/A in Cadh23 (data not shown). Genetic linkage between both genes could be disregarded because both are located in different chromosomes (Slc7a8 in Chr:14 and Cdh23 in Chr:8). Therefore, non-additive severity of the hearing loss phenotype of Slc7a8 ablation and Cdh23 susceptibility allele suggests that both genes may share similar mechanisms of pathogenicity.In line with the results observed in the mouse model, the four human mutations found in heterozygosis in ARHL patients showed a reduced SLC7A8 transporter activity meanwhile the mutations found in control group did not affect the transporter activity (Figure 5B). The predisposition of SLC7A8 to host deleterious variants, as shown by the in silico-patterns of missense and loss-of-function tolerance, could be explained because its aberration affects age-related hearing function, but its ablation is neither vital nor affects the reproduction of the mice (Slc7a8−/− showed same frequency of siblings as expected, data not shown). Furthermore, the presence of mutations in both ARHL cases and controls in our cohort with higher frequencies in respect to public databases could be explained as a result of isolation and inbreeding in our individuals; as isolation in a population could lead to an enrichment of deleterious variants due to relaxation of purifying selection (Xue et al., 2017). We also noted that in ExAC the mutations found in controls have a mean frequency that is seven times higher than the ones found in our cases, and we speculate that this could be an indirect hint of the higher deleteriousness of the variations found in our cases in respect to the controls. Thus, the present work points to SLC7A8 as a strong candidate gene involved in ARHL induction and the presented data suggest that a significant proportion (~3%) of ARHL cases could be explained by SLC7A8 mutations making it one of the major players so far described.SLC7A8 was localized in key cochlear structures: the spiral ligament, spiral limbus and spiral ganglion (Figure 2A and S2B) likewise the three main pathological changes described in the ARHL were observed in the absence of SLC7A8: the hair cells of organ of Corti (sensory), the spiral ganglia (neural), and the spiral ligament and the stria vascularis (metabolic) (Figure 3).The spiral ligament contributes to cochlear homeostasis and is crucial for normal hearing. Degradation of the spiral ligament can result in either one form of hereditary deafness through POU3F4 mutations at locus DFN3 (41) or in the loss of endocochlear potential (EP) in presbycusis mouse models (Wu and Marcus, 2003). In the spiral ligament, SLC7A8 expression was detected in fibrocytes, mostly in type I, close to the stria vascularis (Figure 2). In addition, a reduced number of total cells was observed in both Slc7a8−/− and Slc7a8+/− mice (Figure 3C). Type I fibrocytes are interconnected with the adjacent types II and V cells forming a gap junction-dependent cell system with a relevant role in ion homeostasis [for a review, see (Kikuchi et al., 2000)]. Deafness due to fibrocyte alterations has been described, which indicates the importance of their integrity for appropriate hearing (Minowa et al., 1999; Teubner et al., 2003; Boettger et al., 2003; Delprat et al., 2005; Trowe et al., 2008). Nonetheless, s100 expression (Figure 4C) appeared to be unaffected in the absence of SLC7A8. Interestingly, mutations in genes expressed in spiral ligament fibrocytes could affect stria vascularis function causing deafness, such as the ablation of the fibrocyte transcription factor POU3F4 that causes loss of fibrocytes IV and V in the spiral ligament, decreased cellular density in the stria vascularis and decreased expression of Kir4.1 (48). As the stria vascularis regulates nutrient transport and ion fluxes is responsible for the maintenance of the EP (Peter and Santi, 2001), which is the driving force required for neurotransmission after acoustic stimulus (Wangemann, 2006; Couloigner et al., 2006). We observed alterations in the stria vascularis, decreased expression of Kir4.1 and the basal cell marker phalloidin all correlating with HL phenotype in Slc7a8−/−, and similar traits in Slc7a8+/− mice (Figures 3A and 4B–C and S9). Moreover, is described that the ablation of the T-box transcription factor gene Tbx18, expressed in the spiral ligament, compromises fibrocytes differentiation (Trowe et al., 2008) and concomitant disruption of the architecture of the stria vascularis with almost complete absence of the basal cell layer, and down-regulation of Kir4.1 (52). Likewise, deletion of Pendrin (SLC26A4, PDS) (Cl-/I-/HCO3- anion exchanger expressed in mouse fibrocytes) showed pronounced signs of vestibular disease attributed to an altered EP (Everett et al., 2001). Concomitant with reported data, transcript levels of both Tbx18 and Slc26a4 are down-regulated in the Slc7a8−/− mouse (Figure 3D). Therefore, if we assume a defect in ion homeostasis in the absence of SLC7A8, we could expect an EP impairment that should also trigger vestibular damage. In line with this assumption, we observed impaired balance during gradual acceleration in rotarod test performance of Slc7a8−/− mouse (Figure 1—figure supplement 3G). Altogether, the data presented suggests that the absence of SLC7A8 in fibrocytes might contribute a metabolic component to the progression of hearing loss.The reduction in the number of cells of the spiral ganglia in Slc7a8−/− mice to half of those in wild type (Figure 3A and B) and its correlation with ABR threshold at high frequencies (Figure 3—figure supplement 1) could be considered causative of neuronal hearing loss (Camarero et al., 2001), and the lack of expression of SLC7A8 in SG might directly contributed to this neurodegeneration (Figure 1—figure supplement 2B). SG axons are part of the auditory nerve and transmit signals from the organ of Corti to the brain. In addition, it has been described that SG degeneration may result in hair cells and sensory hearing loss (Stankovic et al., 2004; Sugawara et al., 2007; Zilberstein et al., 2012). SLC7A8 is expressed in the SG but not in the organ of Corti. However, Slc7a8−/− mice also showed loss of hair cells (Figure 3A) suggesting a potential negative feedback from the damaged SG similar to those described (Stankovic et al., 2004; Sugawara et al., 2007; Zilberstein et al., 2012).SLC7A8/SLC3A2 exchanges all neutral amino acids except for proline (Pineda et al., 1999), and therefore either SLC7A8 ablation in mice or SLC7A8 loss-of-function mutations in humans can alter availability or concentration of a specific set of neutral amino acids in cells (especially fibrocytes and neurons) of the spiral ligament, spiral limbus and spiral ganglion. Three of the four ARHL mutations (T402M, R418C and V460E) showed similarly compromised transport of the amino acids tested (alanine and tyrosine), whereas V302I selectively showed a defect for the large amino acid tyrosine (Figure 5B). Mutation V302I, located within the external lid in the extracellular loop 4, might result in a steric hindrance with bulky substrates when closing the substrate cavity in the inward-facing conformation of the transporter. SLC7A8 loss-of-function might render alterations in the cell content of bulky neutral amino acids like branched chain amino acids or glutamine, which affect proteostasis and renewal of cell structures causing cell stress (Efeyan et al., 2015; Someya and Prolla, 2010). Caloric restriction, that involves both an increased branched amino content and protein degradation, showed an effective delay of age-related cochlear neuron degeneration (Someya et al., 2010; Bao and Ohlemiller, 2010). In any case, Slc7a8−/− cochlea presents signs of unresolved chronic inflammation with up-regulation of Il1b and Il6 mRNA (Figure 2—figure supplement 1C) and reduced activation of macrophages (down-regulation of Iba1 protein) (Suppl. Figure S8D). As SLC7A8 is also expressed in macrophages (BioGPS [Internet]. 2001), the role of the immune response in the hearing loss associated with Slc7a8−/− mice deserves further attention.SLC7A8 also transports thyroid hormones (TH) (Zevenbergen et al., 2015; Hinz et al., 2017) as well as the dopamine precursor L-DOPA (Gomes and Soares-da-Silva, 2002; Pinho et al., 2004). Even though hypothyroidism causes hearing loss characterized by alterations in cochlear development (Peeters et al., 2015) and L-DOPA showed a protective role for cochlea during aging (Murillo-Cuesta et al., 2010), Slc7a8−/− mice showed neither hypothyroidism (Braun et al., 2011) nor alterations in L-DOPA plasma levels (data not shown). The lack of SLC7A8 might be compensated by other transporters like the main TH transporter MCT8 (Núñez et al., 2014). Moreover, we cannot disregard a local impact of a shortage of L-DOPA in the cochlea, which could influence its maintenance, altering the protective role of this metabolite. Therefore, in the absence of SLC7A8, three elements could play a role in the hearing loss phenotype: neutral amino acids, thyroid hormones and/or L-DOPA. Characterization of new SLC7A8 mutations with substrate-dependent transport activity will be necessary to draw a definitive conclusion as to the molecular mechanism of the SLC7A8 substrates involved in ARHL.
Conclusion
The present work provides evidence that the amino acid transporter SLC7A8/SLC3A2 has a direct role in age-related hearing-loss (ARHL). The ablation of SLC7A8 in a mouse model causes deafness with ARHL characteristics, defective audition at high-frequencies with early onset in homozygotes and progressive worsening in heterozygotes with age. Identification of rare variants in SLC7A8 gene together with amino acid transport loss-of-function in ARHL patients supports the concept that this gene has a role in the auditory system in association with other genetic and/or environmental factors.This study highlights amino acid transporters as new targets to study in largely uncharacterized hearing disorders. The description of SLC7A8 as a novel gene involved in a complex trait such as ARHL demonstrates the importance of amino acid homeostasis in preserving auditory function and suggests that genetic screening should be extended to consider other amino acid transporters as potential new genes involved in cochlear dysfunction. Our results may enable the identification of individuals susceptible to developing ARHL, allowing for early treatment or prevention of the disease.
Materials and methods
All key research resources described in this section are summarized in Table 2.
Table 2.
Key resources table.
Reagent type (species) or resource
Designation
Source or reference
Identifiers
Additional information
Antibody
SLC7A8 antibody
Custom made
NA
Anti-Rabbit peptide sequence: PIFKPTPVKDPDSEEQP WB: 1:1000, IHC: 1/5000 and IF:1/200
s100
Sigma-Aldrich
Ref: S2532
IF: 1/1000
Kir4.1
Merck Millipore
Ref: AB5818
IF: 1/200
BA1
Abcam
Ref: ab5076
IF: 1/200
Phalloidin
Thermo Fisher Scientific
Ref: A22287
IF: 1/100
Donkey anti-Goat Alexa Fluor 546
Thermo Fisher Scientific
Ref: A-11056
IF: 1/300
Donkey anti-Rabbit Alexa Fluor 488
Thermo Fisher Scientific
Ref: A-21206
IF: 1/300
Goat anti-Mouse Alexa Fluor 546
Thermo Fisher Scientific
Ref: A-11030
IF: 1/300
Goat anti-Rabbit Alexa Fluor 488
Thermo Fisher Scientific
Ref: A-11034
IF: 1/300
WGA
Thermo Fisher Scientific
Ref: W21405
labeled with Texas-Red IF: 1 mg/mL
Anti-Strep Tag GT517
Abcam
Ref: ab184224
IF: 1/100
Goat-anti-mouse-FITC
Abcam
Ref: ab6785
IF: 1/300
Behavior
Rotarod
Panlab
Ref:LE8500
Treadmill
Panlab
E8710MTS
Morris water maze
Panlab
SMART camera
circular tank (150 cm diameter, 100 cm high)
PPI
Panlab
LE116
Restrain stressor
Lab Research
Ref:G05
ABR
Tucker Davis Technologies TDT
System 3 Evoked
Mouse
C57BL6/J wild type
Harlam
Ref: 057
C57BL/6JOlaHsd
C57BL6/J wild type
Jackson laboratory
Ref: 000664/Black
Slc7a8-/- chimera
Genoway
Customized Model Development
Strategy Figure 1—figure supplement 1
Cell Line
HeLa
Sigma Aldrich
Ref: 93021013
Chemical compound, drug
DTT dithiothreitol
SigmaAldrich
Ref:D9779
L- [3H]-labeled alanine
Perkin Elmer
Ref: NET348250UC
1 μCi/ml
[3 hr]-tyrosine
Perkin Elmer
Ref: NET127250UC
1 μCi/ml
Commercial assay or kit
Pierce BCA Protein Assay Kit
Thermo Scientific
Ref:23225
ECL
GE Healthcare
Ref:RPN2232
Corticosterone EIA kit
Enzo
Ref:ADI900097
A + B conjugate
Vectastain
Ref: ABC kit
Rneasy
Qiagen
Ref: 74104
High-capacity cDNA Reverse Transcription Kit
Applied Biosystems
Ref: 4368813
TaqMan Gene Expression Assay
Applied Biosystems
potassium voltage-gated channel subfamily Q member 2 (Kcnq2) Mm00440080_m1; potassium voltage-gated channel subfamily Q member 3 (Kcnq3) Mm00548884_m1; potassium voltage-gated channel subfamily Q member 5 (Kcnq5) Mm01226041_m1; prestin (Slc26a5) Mm00446145_m1; T-box transcription factor TBX18 (Tbx18) Mm00470177_m1; interleukin one beta (Il1b) Mm00434228m1; interleukin 6 (Il6) Mm00446190m1; solute carrier family 7 (cationic amino acid transporter, y + system), member 8 (Slc7a8) Mm01318971m1
Animal experimentation complied with the ARRIVE guidelines and was conducted in accordance with Spanish (RD 53/2013) and European (Directive 2010/63/EU) legislations. All protocols used in this study were reviewed and approved by the Institutional Animal Care and Use Committee at IDIBELL in a facility accredited by the Association for the Assessment and Accreditation of Laboratory Animal Care International (AAELAC accredited facility, B900010). Mice procedures were done according with scientific, humane, and ethical principles. The studied mouse model did not show phenotype differences comparing male and female. Thus, to ensure that our research represents both genders, the studies describes in this work were performed using both sexes equitably. The number of biological and experimental replicates is detailed in the legend of each figure.
Mouse model
Generation of the null Slc7a8 (Slc7a8−/−) was done by gene disruption. A coding region that includes exon 1 of the Slc7a8 gene was replaced for a neomycin resistance cassette by homologous recombination using a pBlueScript vector with two homologous arms (right: 6.1 kb and left: 2.3 kb) and two resistances (neomycin and thymidine kinase) in 5’ region of the gene (Figure 1—figure supplement 1A). ES cells transfection and microinjection experiments were done by GenOway (Lyon-France). Chimera mouse was outcrossed with a wild‐type C57BL6/J mouse to obtain first generation (F1) of Slc7a8 heterozygous (Slc7a8+/−) in a mixed C57BL6/J‐129Sv background. Intercross of F1 resulted in the analyzed F2 generation, which contemplates the three genotypes: wild type, Slc7a8+/− and Slc7a8−/− knockout mice. The pure inbred genetic background was generated backcrossing Slc7a8−/− F1 mice in the mixed C57BL6/J‐129Sv strain for 10 generations with pure C57BL6/J wild-type mice alternating male and females to avoid a genetic drift in the X and Y chromosomes.
Genotyping
Mice genotype was confirmed by triplex-PCR using DNA from the tail. Primers used were forward: 5’GGAGCGATCTGCGGAGTGA3’; reverse: 5’ACAGAGTGCGCTCCTACCCT3’ and reverse KO-specific: 5’CGGTGGGCTCTATGGGTCTA3’, and Standard DNA polymerase (Biotools Ref:10.002). The PCR products are 458 bp (wild type allele) and 180 bp (Slc7a8−/− allele) fragment.
Protein analysis
Protein analysis was done by western blotting using total membrane samples. Frozen tissues (50–100 mg) were homogenized in 5 mL of membrane buffer (25 mM HEPES – 4 mM EDTA – 250 mM sucrose – and protease inhibitors) and centrifuged at 10,000 rpm for 10 min at 4°C. Supernatant was centrifuged at 200,000xg for 1 hr at 4°C. The pellet was resuspended in 150 μL of membrane buffer using a 25G syringe. Pierce BCA Protein Assay Kit (Thermo Scientific Ref:23225) was used for protein quantification. Polyclonal rabbit antibody against mouseSLC7A8 protein was generated using an antigen against the C‐terminal region (peptide sequence: PIFKPTPVKDPDSEEQP) (Figure 1—figure supplement 1B). Serum extracts from inoculated rabbits were purified with protein G and used as primary antibody. Detection was by chemiluminescent reaction using ECL (GE Healthcare Ref:RPN2232) and autoradiography (Amersham Hyperfilm Ref:28906839). For specific SLC7A8 light subunit detection, samples were run in the presence of 100 mM of dithiothreitol (SigmaAldrich Ref:D9779).
Behavior tests
Rotarod (Panlab Ref:LE8500). The experimental design consisted of two training trials (TR) at the minimum speed (4 rpm) followed of two different tasks: (a) motor coordination and balance were assessed by measuring the latency to fall off the rod in consecutive trials with increasing fixed rotational speeds (FRS 4, 10, 14, 19, 24, and 34 rpm). The animals were allowed to stay on the rod for a maximum period of 1 min per trial and a resting period of 5 min was left between trials. (b) In the accelerating rod test, the rotation speed was increased from 4 to 40 rpm during two sessions of 1 min. For each trial, the elapsed time until the mouse fell off the rod was recorded. Treadmill (Panlab Ref:LE8710MTS): During two training trials (TR), the inclination of the treadmill was increased from 0° to 20° from the horizontal plane at different speeds (5, 10, 20, 30, 40 and 50 cm/s). Whenever an animal fell off the belt, foot shocks were applied for a maximal duration of 1 s. After the shock, mice were retrieved and placed back. Morris water maze (MWM): Mice were tested over 4 days (four trials/session, 10 min inter-trial intervals). The Morris Water Maze test consists of a circular tank (150 cm diameter, 100 cm high) filled with opaque water (with non-toxic white paint) and maintained at 21 ± 2°C. A removable circular platform (8 cm diameter) was located in a fixed position (NE quadrant) inside the pool. The pool was surrounded by white curtains, with cues affixed. The test was performed under low non-aversive lighting conditions (50 lux). An overhead camera connected to video-tracking software (SMART, Panlab SL., Spain) will be used to monitor the animal’s behavior. Latency to reach the platform, total distance travelled, speed and time in zones will be recorded for posterior data analysis. The maze was surrounded by white curtains with black patterns affixed, to provide an arrangement of spatial cues. A pre-training session was performed in which the platform was visible in the center (day 1), followed by five acquisition sessions during which the platform was submerged 2 cm below the water (days 2–6). In each trial, mice were introduced in the pool from one of the random starting locations. Mice failing to find the platform within 60 s. were placed on it for 10 s. At the end of every trial the mice were dried for 15 min in a heater. Escape latencies, length of the swimming paths and swimming speed for each animal and trial were monitored and computed by a tracking system connected to a video camera placed above the pool. Pre-pulse inhibition of acoustic startle response (PPI) (Panlab Ref:LE116): Training was 5 min of habituation time to the apparatus with a background noise level of 70 dB and then exposed to six blocks of 7 trial types in pseudo-random order with 15 s. inter-trial intervals. The trials: 1 s of a 120 dB, 8000 kHz sound preceded 100 ms. by a 40 ms pre-pulse (PP) sound of 74, 78, 82, 86 or 90 dB. The startle response was recorded for 65 ms, measuring every 1 ms. from the onset of the startle stimulus. Restrain stressor (LabResearch Ref:G05): Mice were habituated for 3 days prior the experiment collecting 10–15 μL of blood from tail. All sets were carried in the same room at the same time to minimize environmental variations and corticosterone fluctuations as a result of circadian rhythms. Mice were placed for 15 min in the conditioning unit and 75 μL of tail’s blood was collected. For recovery mice were placed into a clean cage for 90 min. Blood corticosterone were determined by Corticosterone EIA kit (Enzo Ref:ADI900097).
Auditory brainstem response test (ABR)
Hearing was evaluated by recording the auditory brainstem responses (ABR) with a System 3 TDT Evoked Potential Workstation (Tucker Davis Technologies TDT, Alachua, FL, USA) as previously described (Cediel et al., 2006; Riquelme et al., 2010). Briefly, mice were anesthetized with intraperitoneal injection of ketamine (100 mg/kg) and xylazine (10 mg/kg), and placed inside a sound chamber. Broadband click (0.1 ms) and tone bursts (5 ms) at 8, 16, 20, 28 and 40 kHz were delivered with an open field speaker (MF1, TDT) at an intensity range from 90 to 10 dB sound pressure level (SPL) in 5–10 dB SPL steps. The electrical responses were amplified and averaged and the ANABR recordings analyzed with BioSig software (TDT) to determine hearing thresholds in response to each stimulus, peak and interpeak latencies and peak amplitudes. Animals were kept thermostatized and monitored during both anesthesia and the following recovery period.
Histology and immunohistochemistry
Mice were perfused through vascular system with 4% PFA and inner ear and brain samples were collected. The cochlea was dissected, post-fixed and decalcified in 0.3 M EDTA pH 6.5 (Sigma-Aldrich Ref:E1644) for seven days. Decalcified cochleae were embedded in OCT or paraffin as reported (Murillo-Cuesta et al., 2012). Deparaffinized cochlear sections were stained with hematoxylin and eosin for general cytoarchitecture evaluation. Immunohistochemistry: Floating brain tissue sections were incubated with 3% H2O2 in 10% methanol in PBS for 10 min. Blocking buffer with: 0.2% gelatine, 0.2% Triton x-100% and 10% FBS for 30 min. Primary antibody: anti-SLC7A8 1/500 in blocking buffer ON at 4°C with agitation. Secondary antibody: 1/200 biotinylated anti rabbit in blocking buffer for 1 hr at RT. Third antibody: 1/100 of A + B conjugate (Vectastain, Ref:ABC kit) in blocking buffer for 1 hr at RT. Develop staining: 0.03%DAB in PBS for 5 min. Reaction: incubate 0.03%DAB +1/10.000 H2O2 for 2–7 min with agitation. Reaction was stopped by rinsing with PBS. Sections were dried and dehydrated before mounting. Detection was using a bright-light microscope. Immunofluorescence: OCT tissue sections were permeabilized by incubating for 10 min with 0.1% Triton X-100 and incubated as reported (Sanchez-Calderon et al., 2010; de Iriarte Rodríguez et al., 2015b) with the following primary antibodies: anti-SLC7A8 (1/200), -s100 (1/1000, Sigma-Aldrich Ref:S2532), -Kir4.1 (1/200, Merck Millipore Ref:AB5818), -IBA1 (1/100, Abcam Ref:ab5076), or with Phalloidin (1/100, Thermo Fisher Scientific Ref:A22287), ON at 4°C. Sections were then incubated with secondary antibodies: (1:300, Thermo Fisher Scientific Ref:A-11034 Goat anti-RabbitAlexa Fluor 488, Ref:A-11030 Goat anti-MouseAlexa Fluor 546, Ref:A-21206 Donkey anti-RabbitAlexa Fluor 488, Ref:A-11056 Donkey anti-GoatAlexa Fluor 546) for 2 hr at RT. Detection by confocal microscopy (Leica, Ref:LSM 780 Zeiss).
Fluorescence quantification
Four sections of apex, middle and basal turns of the cochlea were quantified using the same settings, including argon laser voltage, for the quantification. Using Fiji software, the sum of the intensity of all stacks (2.6 μm in the z axis along the 10 μm section) from the spiral ligaments + stria vascularis area was extracted. Data were analyzed with Prism 7 statistic software package (Graph Pad Software, Inc.). Statistical significance was determined by Student’s t test for unpaired samples. The number of biological and experimental replicates are detailed in the legend of each figure.
Quantitative RT-PCR
RNA was isolated using RNeasy (Qiagen) from 1 to 2 cochleae; its integrity and concentration were assessed using an Agilent Bioanalyzer 2100 (Agilent Technologies). At least, three mice per condition were used. cDNA was then generated by reverse transcription (High Capacity cDNA Reverse Transcription Kit; Applied Biosystems) and gene expression analyzed in triplicate by qPCR using TaqMan Gene Expression Assay kits (Applied Biosystems). The following probes were used: potassium voltage-gated channel subfamily Q member 2 (Kcnq2) Mm00440080_m1; potassium voltage-gated channel subfamily Q member 3 (Kcnq3) Mm00548884_m1; potassium voltage-gated channel subfamily Q member 5 (Kcnq5) Mm01226041_m1; prestin (Slc26a5) Mm00446145_m1; T-box transcription factor TBX18 (Tbx18) Mm00470177_m1; interleukin 1 beta (Il1b) Mm00434228m1; interleukin 6 (Il6) Mm00446190m1; solute carrier family 7 (cationic amino acid transporter, y + system), member 8 (Slc7a8) Mm01318971m1. PCR was performed on an Applied Biosystems 7900HT Real-Time PCR System using Hprt1 or RPLP0 as the endogenous housekeeping gene. Relative quantification values were calculated using the 2-ΔΔCt method. All procedures have been already reported (de Iriarte Rodríguez et al., 2015a).
ARHL cohort recruitment and clinical assessment
A total of 147 Subjects were recruited in North-Eastern Italy isolated villages (FVG Genetic Park) (Esko et al., 2013) and from one isolated village from Southern Italy (Carlantino). Subjects underwent a clinical evaluation to exclude any syndromic form of hearing loss or other systemic illnesses linked with sensorineural hearing loss. Audiometric tests using standard audiometers were carried out for each subject. Measurements have been obtained after any acoustically obstructing wax was removed. Thresholds for six different frequencies (0.25, 0.5, 1, 2, 4, 8 kHz) were measured and then a pure-tone average for high frequencies (P-TAH) was computed by taking the average of 4 and 8 kHz. To avoid non-genetic variations in the hearing phenotype (e.g. monolateral hearing loss), the best hearing ear was considered for each individual. Cases were defined as people older than 50 years old having PTAH ≥40, while controls were subjects more than 50 years old with PTAH ≤25.All studies were approved by the Institutional Review Board of IRCCS Burlo Garofolo, Trieste, Italy and consent forms for clinical and genetic studies have been signed by each participant. All research was conducted according to the ethical standards as defined by the Helsinki Declaration.
Whole genome sequencing and mutation screening
Blood samples were collected and used to extract DNA using standard protocols. Low coverage whole genome sequence was generated using Illumina technology (Genome Analyzer and HiSeq 2000) at the Welcome Trust Sanger Institute and Beijing Genomics Institute. Data coverage was ranging from 4 to 10X. A multi-sample genotype calling was performed and standard quality filters were applied. The detailed pipeline has already been described elsewhere (Timpson et al., 2014). Variants belonging to SLC7A8 gene were extracted using bcftools [http://samtools.github.io/bcftools/] and annotated with ANNOVAR (Wang et al., 2010). Only the exonic variants were further considered. Finally, variants of interest were confirmed by direct Sanger sequencing on a 3500 Dx Genetic Analyzer (Life Technologies, CA), using ABI PRISM 3.1 Big Dye terminator chemistry (Life Technologies) per manufacturer’s instructions. Mutation frequencies were compared with public databases such as Esp6500siv2 (NHLBI Exome Sequencing Project), 1000 g (1000 Genomes Project), Campion (The Allele Frequency Net Database) and ExAC (The Exome Aggregation Consortium). For SLC7A8 we collected several statistics including the probability of loss of function intolerance (pLI), where the closer pLI value is to 1, the more LoF intolerant the gene could be considered. We also collected the missense Z score, a positive score indicates intolerance to missense variation whereas a negative Z score indicates that the gene had more missense variants than expected.
Site-directed mutagenesis
The QuikChange site-directed mutagenesis kit (Stratagene) was used to introduce point mutations in SLC7A8 sequence, according to the manufacturer's protocol. The pcDNA3.1-StrepTag fused SLC7A8 construct was used as template (Costa et al., 2013). Amino acid substitutions were introduced into SLC7A8 sequence using a compatible reverse primer and forward primers (Figure 5—source data 1). All primers annealed to the coding sequence, and the position of the mutated codon was underlined. All constructs were verified by DNA sequencing and then used for transient transfection.
Cell culture and transfection
HeLa cells (Sigma Aldrich, Ref: 93021013) were maintained at 37°C/5% CO2 in Dulbecco's modified Eagle's medium (Life Technologies) supplemented with 10% (v/v) fetal bovine serum, 50 units/ml penicillin, 50 μg/ml streptomycin, and 2 mM l-glutamine. HeLa cells were transiently transfected with plasmid constructions mentioned above with the use of Lipofectamine 2000 (Invitrogen) following the manufacturer's protocol. Amino acid transport and fluorescence microscopy analyses were carried out 48 hr after transfection.
Visualization of Strep-tagged amino acid transporters by fluorescence microscopy
To analyze the effect of the mutations on SLC7A8 protein expression and plasma membrane localization, fluorescence microscopy of Strep-tagged wild type and mutant transporters was performed on a semiconfluent monolayer of transfected HeLa cells cultured on glass coverslips. Glass coverslip-grown cells were incubated with 1 mg/ml wheat germ agglutinin (WGA) labeled with Texas-Red (Thermo Fisher Scientific) at 37°C for 10 min, rinsed three times with phosphate-buffered saline-Ca2+-Mg2+ and fixed for 15 min in 4% paraformaldehyde. Fixed cells were blocked in blocking buffer (10% FBS and 0.1% saponin in PBS) for 1 hr and then incubated for 1 hr with primary antibody (anti-Strep Tag GT517, 1/100; Abcam). Secondary goat-anti-mouse-FITC antibody (Life Technologies) was incubated for 2 hr protected from light and rinsed three times with phosphate-buffered saline. Nuclear staining was performed by incubating 1 µg/ml Hoechst (Thermo Fisher Scientific) for 10 min, rinsed three times with phosphate-buffered saline and then mounted with aqua-poly/mount coverslipping medium (Polysciences Inc.). Images were taken using a Nikon E1000 upright epifluorescence microscope. All images were captured during 200 ms except for those corresponding to V460E that were overexposed to 2 s to reveal the subcellular localization of this very low expressing variant. To quantify SLC7A8 wild type and mutated transporters expression levels in cells, a single in-focus plane was acquired. Using ImageJ (v1.48, NIH), an outline was drawn around each cell and area and mean fluorescence measured, along with several adjacent background readings. The total corrected cellular fluorescence (TCCF) = integrated density – (area of selected cell × mean fluorescence of background readings), was calculated.
Amino acid transport assay
Amino acid uptake was measured by exposing replicate cultures at room temperature to L- [3H]-labeled alanine or [3H]-tyrosine (1 μCi/ml; Perkin Elmer) in sodium-free transport buffer (137 mM choline chloride, 5 mM KCl, 2 mM CaCl2, 1 mM MgSO4, and 10 mM HEPES, pH 7.4). Initial rates of transport were determined using an incubation period of 1 min and 50 µM of cold alanine or tyrosine. Assays were terminated by washing with an excess volume of chilled transport buffer. Cells were lysed using 0.1% SDS and 100 mM NaOH and radioactivity measured in a scintillation counter. Uptake values were corrected by their total corrected cellular fluorescence (TCCF) for all transporters except for V460E mutant, which does not reach the plasmatic membrane.
Statistical analysis
Behavior and ABR experiments using mice were not performed blind to genotype and treatment conditions, but as data acquisition was automated this will not affect data processing and analysis. The sample size was chosen according to the standard sample sizes used in the field and without applying any statistical method. The general criteria of exclusion were pre-established: (1) samples with a value that differed by more/less than two standard deviations from the mean value were excluded from the study. The statistical tests used in each experiment were appropriate to the type of groups, data and samples. Unpaired Student t-test was used for experiments with only two independent groups. Repeated measures two-way ANOVA was applied when we had to compare two independent groups (genotype as the between subjects factor) where repeated measurements of the dependent variable were obtained (Rotarod and PPI).Data were analyzed with IBM SPSS 23.0 statistic software package (Chicago, IL). Statistical significance was determined by one-way analysis of variance (ANOVA) and Levene's F test to assess the equality of variances. When significant differences were obtained, post hoc comparisons were performed using Bonferroni or Tamhane tests to compare the three genotypes. Normal distribution of data and homogeneity of variances was assessed using Shapiro-Wilk and Levene tests, respectively. In most of the datasets these two assumptions were achieved. However, when not achieved and because we use comparable sample sizes and ANOVA is robust to normality violations, our results are still valid. Sphericity assumption was assessed using Mauchly’s test and when not achieved Greenhouse correction was taken. Posthoc tests were performed using Bonferroni correction for individual comparisons. Bonferroni p<0.05 was assumed as critical value for significance throughout the study. Statistical analyses were performed using SPSS package.In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.Thank you for submitting your manuscript "Mutations in LAT2 amino acid transporter support SLC7A8 as a novel gene involved in Age-Related Hearing Loss" to eLife. The manuscript has been reviewed by three expert reviewers, and their assessments together with my own, forms the basis of this letter. I am also including the three reviews in their original form at the end of this letter, as there are many specific and useful suggestions in them that will not be repeated in the summary here.We would like to encourage you to resubmit a revised manuscript that addresses the specific issues raised in the reviews. We appreciate that the reviewers' comments cover a broad range of suggestions for improving the manuscript. As you know from our earlier correspondence, the nomenclature confusion needs to be clearly addressed at the start of the manuscript. Please use the proper nomenclature for the mouse and human genes: Slc7a8 and SLC7A8, respectively. You can mention the history of the nomenclature confusion in one sentence and then delete LAT2/Lat2 in the title and in all other locations in the manuscript. The HUGO Gene Nomenclature Committee allows for only one human official gene name and that is SLC7A8 (italicized). See https://www.genenames.org/cgi-bin/search?search_type=all&search=Slc7a8&submit=Submit.In addition to the various specific comments, there was a general consensus among the reviewers that a more complete assessment of the human phenotype would substantially strengthen this work. Also, correlating the inner ear histology of mice with phenotypes of varying severity would strengthen this work.Reviewer #1This is a well-documented study showing that loss of the amino acid transporter Lat2 produces an age-dependent hearing deficit. The knockout clearly impairs hearing as documented by behavioral and clinical electrophysiological tests. Surprisingly, the penetrance is far from complete, but the authors extend the analysis to an inbred strain that already exhibits some age-dependent hearing loss, and show that the penetrance increases. However, it is also clear that the loss of Lat2 has little additional effect on hearing at the earlier time point (4-6 months) and no effect at the later (7-13 months) (Figure S4C,D). The text describes this somewhat misleadingly as increased penetrance, but this seems only due to the underlying defect in this inbred strain, not any increased effect of the Lat2 KO. The reduced penetrance is of concern, and it is good that the authors attempt to address this, but the use of this inbred strain does not seem to provide much relevant information, other than that the two manipulations (Lat2 KO and strain) seem to involve the same process since there is no additive effect.The analysis of sequence variation in affected individuals and the control population provides strong evidence that the changes in Lat2 are pathogenic. The effects on transport activity are clear and interesting, although a little difficult to correlate with the structure.The only area in which the work falls short is the understanding of mechanism. The authors do document the effects of Lat2 loss on cochlear morphology, and the analysis of gene expression as well as histology is thoughtful and convincing. However, it still remains unclear how mutations in Lat2 might lead to this phenotype. The authors consider a number of reasonable possibilities, but hair cell recordings, even from younger animals, might be extremely informative. Even without knowing the precise mechanism, and even though it remains unclear where the defect arises, the hair cells appear severely affected and any evidence for a physiological effect in the mice would greatly increase the impact of this work.Reviewer #2In the process of reading and critiquing the manuscript (Gaurch et al., 2017), I first provided comments below about the phenotyping of the Lat2 mutant mouse and made some suggestions (numbered 1-11) for improving the manuscript. I then read the Results and Discussions section about variants of human "LAT2/SLC7A8". Here, there is a mistake that seems so basic I doubted myself. In the Discussion and in the heading of Table 1, as examples, the authors assume that LAT2 and SLC7A8 are the same gene. In the first paragraph of the Discussion section, there are the following three sentences. "Here, we show that loss-of-function of the amino acid transporter LAT2 is associated with ARHL in both humans and mice..………….. In patients with ARHL we identified four LAT2 variants that showed loss-of-function of transport of tyrosine (Figure 5B). Altogether, these results indicate that full LAT2 function is needed to keep an optimal hearing function throughout life, with half a dose of LAT2 being enough to accelerate ARHL phenotype in mice and humans." Also, consider the title of Table 1, which is "LAT2 (SLC7A8) humans mutations found in ARHL and controls individuals" [note typos]. The authors make the explicit assumption that LAT2 and SLC7A8 are one in the same gene. Additionally, Figure 5 is titled "in vitro characterization of LAT2 mutants". The authors listed some of the variants of LAT2 such as V302I, T402M, R418, and V460E despite the fact that the longest isoform of humanLAT2 only encodes 243 residues ().As one reads the entire manuscript, the authors assume incorrectly that LAT2/Lat2 and SLC7A8/Slc7a8 are the same gene. But, that can't be true both for mouse and for human. The mouseLat2 gene is on chromosome 5 and encodes a protein of 203 residues, while the mouseSlc7a8 is located on chromosome 14. The humanLAT2 gene is located on chromosome 7. The humanSLC7A8 gene encodes a protein of 535 amino acid residues and resides on chromosome 14. Clearly different genes. What this means is that the knockout mouse model of Lat2 and its phenotype does not inform us about the putative pathogenicity of the heterozygous variants of humanSLC7A8. The authors have merged two distinct stories as a result of a very basic error.All of the comments below were written before this reviewer noticed the above mentioned fatal flaw.1) In Figure 1 add a simple schematic diagraming the nature of the Lat2 mutation and how the variant results in a "knockout". Reference 26 is in Spanish. The reviewer understands that in the lanes with protein from a homozygous knockout mouse, no LAT2 protein is detected. However, there is no indication in the legend where the epitope is located for the antibody that was used against LAT2. In subsection “Genotyping”, the authors state that a peptide was used to generate polyclonal antisera and the peptide is located near the C-terminus. This is important information needs to be provided in a simple diagram in Figure 1 of the Lat2 gene and LAT2 protein so that data can be easily interpreted without hunting around.2) In the Materials and methods section, the authors state that exon 1 of Lat2 was replaced with a neomycin cassette. Is there any evidence for an alternative translation start codon downstream of exon 1 that is used in the absence of exon 1. As shown in the UCSC Browser (), Lat2 has two different first exons. One exon 1 is entirely noncoding and the other exon 1 includes a 5' UTR and some protein coding sequence. Which exon 1 was deleted? Provide an accession number for your gene structure of Lat2 and a diagram in Figure 1 so that it is clear what was deleted in your mutant mouse.3) Subsection “Localization and quantification of LAT2 in the inner ear”. Provide a reference for "the previous study" and state where the previous study showed localization of LAT2 that you think may be mislocalization. I know you are being courteous here but more information would be helpful. Also considering that there are at least two alternative splice protein coding isoforms of LAT2 (with and without exon 6 of 12), might there be another explanation for the discrepancy? Where was the epitope of LAT2 located in the other study?4) Results section, the authors state that there is a significant reduction in latency in the rotorod acceleration test. Latency of what? Similarly (Results section), explain why an "increased exposure to shock on the treadmill" is important and what it means biologically. Just stating it represents "motor coordination performance" and PPI may be useful information for those in the field but to others it is jargon/lingo.5) Figure 1, panel A, there are no loading controls in the lanes of the Western blot. In the legend it is noted that 50ug of protein was loaded in each lane. That is helpful information but insufficient.6) Figure 1, panel B and Results section, the authors need to explain what is "Pre-Pulse inhibition of the acoustic startle response (PPI)" and what is being measured.7) Figure 1, panels C and F, on the Y-axis, indicate that click thresholds are ABR thresholds.8) Figure 1D, The Y-axis is without a metric/description.9) Figure 2 also needs a diagram to help orient a reader to the structures and cell types of the inner ear. Were the immunofluorescent images acquired and evaluated with the investigator blinded to genotype? Panel B is nice but not sufficient. In panel C, add a key in the figure panel for the three bar types.10) Figure 2, panel D, and subsection “Localization and quantification of LAT2 in the inner ear”, which states that there is a progressive increase in LAT2 expression. After P1, the up and down levels of expression seem more like experimental noise and not a progressive increase. How many independent determinations of 3 mice per group of pooled samples were evaluated? Are the error bars for technical replicates?11) Figure 5, legend, it is not clear what is meant by "[…]unless V60E that[…]" and "[…]is represented the uptake[…]"Reviewer #3This is an interesting and novel paper describing the pathogenicity of a novel gene LAT2 in age-related hearing loss in both mice and humans. The authors first examined LAT2-deficient mice and found an incomplete penetrance of the homozygous animals showing age-related threshold shifts, although these results were obtained in mouse strains that suffer from age-related hearing loss (C57Bl6) rather than CBA or FVB strains. Interestingly some heterozygous animals also demonstrate elevated hearing thresholds thus suggesting a dosage effect. LAT2 expression was found in several locations within the cochlea including the stria vascularis, spiral ligament and SGN. Cell loss concomitant with decreased in specific genes in LAT2+ areas were found. Mechanistically, in vitro data in HeLA cells indicate that amino acid transport is disrupted in mutated LAT2, which agrees with a more generalized metabolic derangement in the cochlea though this was not demonstrated in vivo. Next, the authors identified a cohort of patients with age-related hearing loss and found that mutations leading to amino acid transport dysfunction in vitro were indeed ones associated with age-related hearing loss in patients.Overall, the manuscript is well written, contains potentially exciting yet somewhat incomplete dataset. I recommend a major revision.1) Hearing tests in families of patients with LAT2 mutations. It seems prudent to test both the genetics and hearing of family members to determine the genotype-phenotype relationship to ascertain if LAT2 mutations are necessarily pathogenic, and a dosage effect can also be supportive of such a conclusion. Also, LAT2 qPCR expression should be assessed in heterozygotes if a dosage effect is proposed.2) Does histology correlate with hearing loss in mice? The incomplete penetrance and use of C57bl6 to examine an age-related hearing loss candidate gene is problematic. But a correlation between the degree of cell loss and hearing loss can be supportive evidence yet this is lacking. Also for some of the cell markers, assessing the intensity of immunostaining seems odd. One should instead quantify the number of immunostained cells. Lastly, the qPCR results of several genes on the LAT2 were missing.Reviewer #1This is a well-documented study showing that loss of the amino acid transporter Lat2 produces an age-dependent hearing deficit. The knockout clearly impairs hearing as documented by behavioral and clinical electrophysiological tests. Surprisingly, the penetrance is far from complete, but the authors extend the analysis to an inbred strain that already exhibits some age-dependent hearing loss, and show that the penetrance increases. However, it is also clear that the loss of Lat2 has little additional effect on hearing at the earlier time point (4-6 months) and no effect at the later (7-13 months) (Figure S4C,D). The text describes this somewhat misleadingly as increased penetrance, but this seems only due to the underlying defect in this inbred strain, not any increased effect of the Lat2 KO. The reduced penetrance is of concern, and it is good that the authors attempt to address this, but the use of this inbred strain does not seem to provide much relevant information, other than that the two manipulations (Lat2 KO and strain) seem to involve the same process since there is no additive effect.We have now finalized the longitudinal study of the onset of hearing loss up to 5 months of age in the inbred strain C57BL6/J (new Figure 2—figure supplement 2). At early age (<2.5 and 3.5 month-old) homozygous Slc7a8-/- mice showed increased ABR thresholds and hearing loss penetrance when compared with either wild type or heterozygous Slc7a8+/- mice. These differences are less marked at the age of 5 months. In this pure genetic background, heterozygous Slc7a8+/- and wild type mice showed no evident no differences in ABR thresholds and hearing loss penetrance. In one hand, these new data confirm data presented in Figure 1—figure supplement 5 with different groups of mice studied at different ages and shows clearly that ablation of LAT2 anticipates the onset of hearing loss in C57Bl6/J mice. Moreover, Lat2 knockout, Slc7a8-/-, mice showed higher penetrance but not more severity on the hearing loss phenotype when compared with the mixed genetic background strain (Figure 1C and E).Text was corrected (subsection “Slc7a8 ablation causes ARHL”) to: Additionally, longitudinal study of Slc7a8-/- mice into the inbred C57BL6/J genetic background showed higher penetrance than the mixed background throughout the ages studied (Figure 2—figure supplement 2).The analysis of sequence variation in affected individuals and the control population provides strong evidence that the changes in Lat2 are pathogenic. The effects on transport activity are clear and interesting, although a little difficult to correlate with the structure.The only area in which the work falls short is the understanding of mechanism. The authors do document the effects of Lat2 loss on cochlear morphology, and the analysis of gene expression as well as histology is thoughtful and convincing. However, it still remains unclear how mutations in Lat2 might lead to this phenotype. The authors consider a number of reasonable possibilities, but hair cell recordings, even from younger animals, might be extremely informative. Even without knowing the precise mechanism, and even though it remains unclear where the defect arises, the hair cells appear severely affected and any evidence for a physiological effect in the mice would greatly increase the impact of this work.The reviewer suggestion is right; indeed, these measurements will complement the data shown here. Hair cell recording is a highly specialized and challenging technique that is not set up in our labs. However, we have considered the reviewers’ point and now the correlation between hearing loss phenotype and cochlear damage is shown (Figure 3—figure supplement 1).Text was corrected (subsection “Lack of Slc7a8 induced damage in the organ of Corti, spiral ganglion and stria vascularis”) to: Slc7a8-/- mice 4- to 7-month old presented ~50% of cell loss in the spiral ganglion compared with wild type mice (Figure 3B). Decreased number of cells in the ganglia significantly correlated with ABR threshold and HL phenotype (Figure 3—figure supplement 1A and B).Text was corrected (subsection “Lack of Slc7a8 induced damage in the organ of Corti, spiral ganglion and stria vascularis”) to: Reinforcing this observation, the expression of Kir4.1, a potassium channel highly expressed in stria vascularis cells (33), was also dramatically reduced by 50% in Slc7a8-/- mice (Figure 4B and Figure 4—figure supplement 1A). Likewise, decreased expression of Kir4.1 marker correlates with HL phenotype (Figure 3—figure supplement 1C).Text was corrected (subsection “Lack of Slc7a8 induced damage in the organ of Corti, spiral ganglion and stria vascularis”) to: Moreover, mice with severe HL phenotype showed 30% less number of fibrocytes in the spiral ligament (Figure 3—figure supplement 1D).Reviewer #2In the process of reading and critiquing the manuscript (Gaurch et al., 2017), I first provided comments below about the phenotyping of the Lat2 mutant mouse and made some suggestions (numbered 1-11) for improving the manuscript. I then read the Results and Discussions section about variants of human "LAT2/SLC7A8". Here, there is a mistake that seems so basic I doubted myself. In the Discussion and in the heading of Table 1, as examples, the authors assume that LAT2 and SLC7A8 are the same gene. In the first paragraph of the Discussion section, there are the following three sentences. "Here, we show that loss-of-function of the amino acid transporter LAT2 is associated with ARHL in both humans and mice..………….. In patients with ARHL we identified four LAT2 variants that showed loss-of-function of transport of tyrosine (Figure 5B). Altogether, these results indicate that full LAT2 function is needed to keep an optimal hearing function throughout life, with half a dose of LAT2 being enough to accelerate ARHL phenotype in mice and humans." Also, consider the title of Table 1, which is "LAT2 (SLC7A8) humans mutations found in ARHL and controls individuals" [note typos]. The authors make the explicit assumption that LAT2 and SLC7A8 are one in the same gene. Additionally, Figure 5 is titled "in vitro characterization of LAT2 mutants". The authors listed some of the variants of LAT2 such as V302I, T402M, R418, and V460E despite the fact that the longest isoform of humanLAT2 only encodes 243 residues ().As one reads the entire manuscript, the authors assume incorrectly that LAT2/Lat2 and SLC7A8/Slc7a8 are the same gene. But, that can't be true both for mouse and for human. The mouseLat2 gene is on chromosome 5 and encodes a protein of 203 residues, while the mouseSlc7a8 is located on chromosome 14. The humanLAT2 gene is located on chromosome 7. The humanSLC7A8 gene encodes a protein of 535 amino acid residues and resides on chromosome 14. Clearly different genes. What this means is that the knockout mouse model of Lat2 and its phenotype does not inform us about the putative pathogenicity of the heterozygous variants of humanSLC7A8. The authors have merged two distinct stories as a result of a very basic error.All of the comments below were written before this reviewer noticed the above mentioned fatal flaw.In our study, we certainly knocked out the Slc7a8 gene to generate the mouse model studied, which is the amino acid transporter SLC7A8 in both mouse and humans. LAT2 is the standard abbreviation for 2 genes, the one coding for L-type Amino Acid Transporter-2 or SLC7A8and the Linker for Activation of T-Cells Family Member 2 (see table below), a fact that has possibly mislead this reviewer.As we mentioned previously, to avoid potential confusions to the readers, the SLC7A8 nomenclature is now used throughout the manuscript, and we clarify this point in the Introduction and include the gene reference in the key resources Table 2.We have also modified the title of the manuscript to: Mutations in L-type amino acid transporter-2 support SLC7A8 as a novel gene involved in Age-Related Hearing Loss.1) In Figure 1 add a simple schematic diagraming the nature of the Lat2 mutation and how the variant results in a "knockout". Reference 26 is in Spanish. The reviewer understands that in the lanes with protein from a homozygous knockout mouse, no LAT2 protein is detected. However, there is no indication in the legend where the epitope is located for the antibody that was used against LAT2. In subsection “Genotyping”, the authors state that a peptide was used to generate polyclonal antisera and the peptide is located near the C-terminus. This is important information needs to be provided in a simple diagram in Figure 1 of the Lat2 gene and LAT2 protein so that data can be easily interpreted without hunting around.We have included the knockout strategy diagram and the information of the antibody epitope location (Figure 1—figure supplement 1) to further facilitate the non-Spanish readers the information described in the Published Thesis referenced in (Science AIfB. Allen Mouse Brain Atlas San Diego, USA2004 [Available from: 770 http://www.brain-map.org/.). Indeed, all details are in the Materials and methods section.2) In the Materials and methods section, the authors state that exon 1 of Lat2 was replaced with a neomycin cassette. Is there any evidence for an alternative translation start codon downstream of exon 1 that is used in the absence of exon 1. As shown in the UCSC Browser (), Lat2 has two different first exons. One exon 1 is entirely noncoding and the other exon 1 includes a 5' UTR and some protein coding sequence. Which exon 1 was deleted? Provide an accession number for your gene structure of Lat2 and a diagram in Figure 1 so that it is clear what was deleted in your mutant mouse.The reviewer #2 referenced LAT-2 in Chr:5, the wrong gene. LAT2 or SLC7A8 transporter is coded by LAT2 that is a gene located in Chr:14, in both, mouse (Slc7a8) and human (SLC7A8), and neither have alternative translation start codon nor other protein coding in the same locus. For more details please see [].3) Subsection “Localization and quantification of LAT2 in the inner ear”. Provide a reference for "the previous study" and state where the previous study showed localization of LAT2 that you think may be mislocalization. I know you are being courteous here but more information would be helpful. Also considering that there are at least two alternative splice protein coding isoforms of LAT2 (with and without exon 6 of 12), might there be another explanation for the discrepancy? Where was the epitope of LAT2 located in the other study?As aforementioned, there are not alternative splice protein coding isoforms in the LAT2 (SLC7A8) protein. The most probable explanation is the accuracy of the methodology and equipment used in this manuscript. LAT2 levels are very high in the area surrounding the stria vascularis, what might have led to an erroneous conclusion. Still, the text has been corrected (subsection “Localization and quantification of SLC7A8 in the inner ear”) to: “We observed an intense expression of SLC7A8 in the spiral ligament surrounding the stria indicating that the SLC7A8 epitope (Figure 1—figure supplement 1B) is either hidden or absent in the stria vascularis”.4) Results section, the authors state that there is a significant reduction in latency in the rotorod acceleration test. Latency of what? Similarly (Results section), explain why an "increased exposure to shock on the treadmill" is important and what it means biologically. Just stating it represents "motor coordination performance" and PPI may be useful information for those in the field but to others it is jargon/lingo.The biological meaning of the behavior test is detailed in Materials and methods section Behavior Test. In addition, in the main results the meaning of the test are described.Results section: “In contrast, a significant reduction in latency was observed in the rotarod acceleration test indicating impairment in motor coordination in Slc7a8-/- mice (Figure 1—figure supplement 3G). Reaffirming poorer motor coordination performance in Slc7a8-/- mice, an increased exposure to shock on the treadmill was also observed (Figure 1—figure supplement 3B). Interestingly, a marked impairment was observed in the pre-pulse inhibition of acoustic startle response (PPI), which assesses the response to a high intensity acoustic stimulus (pulse) and its inhibition by a weaker pre-pulse”.5) Figure 1, panel A, there are no loading controls in the lanes of the Western blot. In the legend it is noted that 50ug of protein was loaded in each lane. That is helpful information but insufficient.We have included the bactin blots to demonstrate the loading in the western blots of Figure 1A. In addition, below we show the original films with anti-SLC7A8 and the stripped membrane with anti- bActin used (Author response image 1 and Author response image 2) to build Figure 1A. The red frames indicate the part of the gels represented in Figure 1. Image 1: On the left side, the western blots of LAT2 are shown, the upper blot in reducing (+DTT) and the bottom one in non-reducing conditions (Ø DTT). On the right side the Western blots of bActin in reducing conditions (up) and non-reducing conditions (bottom) are shown. Author response image 2: On the left side, the western blots of LAT2 in reducing conditions (+DTT) and on the right side the corresponding bActin. Therefore, the lack of expression of LAT2 in the tissues from the Slc7a8 knockout mice is not due to a deficient loading of the lanes in the gels.
Author response image 1.
Author response image 2.
6) Figure 1, panel B and Results section, the authors need to explain what is "Pre-Pulse inhibition of the acoustic startle response (PPI)" and what is being measured.See answer in point 4.7) Figure 1, panels C and F, on the Y-axis, indicate that click thresholds are ABR thresholds.Data represented are the Auditory Brainstem Response (ABR) threshold in response to click as indicated in the Figure 1 caption. Y-axis of Figure 1C-F was corrected to: ABR threshold (dB SPL).8) Figure 1D, The Y-axis is without a metric/description.Graph was amended including the metrics of Y axis.9) Figure 2 also needs a diagram to help orient a reader to the structures and cell types of the inner ear.The new sketch in the right panel of Figure 2B shows the main structures of the inner ear in the same perspective as the immunofluorescence image of the left panel of Figure 2B for its localization and as an orientation for the readers.Were the immunofluorescent images acquired and evaluated with the investigator blinded to genotype? Panel B is nice but not sufficient. In panel C, add a key in the figure panel for the three bar types.Immunofluorescent image capture was carried out using the same laser intensity, time and z-axis thickness for all samples independently of the genotype as described in Materials and methods. In addition, quantification was done using Fiji software macros, a semi-automatized system, being the quantification blinded.10) Figure 2, panel D, and subsection “Localization and quantification of LAT2 in the inner ear”, which states that there is a progressive increase in LAT2 expression. After P1, the up and down levels of expression seem more like experimental noise and not a progressive increase. How many independent determinations of 3 mice per group of pooled samples were evaluated? Are the error bars for technical replicates?As described in the Figure 2 caption, mean ± SEM corresponds to a technical triplicate from a pooled sample of 3 independent mouse per group. Reinforcing the results of RNA progressive increase, protein expression in young adult and old wild type mice showed the same pattern (see Figure 2D, where LAT2 levels were quantified in four cochlear sections from 3 mice per group, thus biological variability corresponds to 3 different mice per group). To clarify the message, the plot showing the progressive increase in Slc7a8 mRNA expression with age (former Figure 2E) is now shown in Figure 2—figure supplement 1A.11) Figure 5, legend, it is not clear what is meant by "[…]unless V60E that[…]" and "[…]is represented the uptake[…]"Because when V460E mutant was overexpressed in HeLa cells does not reach the plasma membrane. Text was corrected (Figure 5 legend) to: All SLC7A8 variants, except V460E, reached the plasma membrane.Reviewer #31) Hearing tests in families of patients with LAT2 mutations. It seems prudent to test both the genetics and hearing of family members to determine the genotype-phenotype relationship to ascertain if LAT2 mutations are necessarily pathogenic, and a dosage effect can also be supportive of such a conclusion.The phenotype we are dealing with is an age-related trait in which inclusion criteria define a threshold of people aged 50 or more (the vast majority of them are in between 60 and 75). This situation implies the following aspects: (1) parents usually are dead, (2) siblings are younger than 50 years-old and thus cannot be included in the study because they won’t be properly classified for the genotype-phenotype relationship leading to a misinterpretation of the results, (3) only few relatives (brothers and sisters) are alive. This is the typical situation of a late onset complex trait in which the absence of a clear pattern of inheritance (i.e. monogenic diseases) and the late onset (i.e. inclusion criteria further limiting the overall number of subjects) making almost impossible to define “families or large familial aggregations”. Nevertheless, being the work carried out on isolated inbred populations, the controls are in some way “related to the patients”. In the same line, the absence of loss-of-function LAT2 mutations in the controls is somehow what the reviewer is asking for.Also, LAT2 qPCR expression should be assessed in heterozygotes if a dosage effect is proposed.LAT2 (SLC7A8) protein expression had been evaluated quantifying the levels of the transporter in the cochlea of wild type, heterozygous and knockout mice (see Figure 2C). We observed half a dose of the transporter in heterozygous mice.2) Does histology correlate with hearing loss in mice? The incomplete penetrance and use of C57bl6 to examine an age-related hearing loss candidate gene is problematic. But a correlation between the degree of cell loss and hearing loss can be supportive evidence yet this is lacking. Also for some of the cell markers, assessing the intensity of immunostaining seems odd. One should instead quantify the number of immunostained cells. Lastly, the qPCR results of several genes on the LAT2 were missing.We address this point in the last answer reviewer #1. There is a good correlation between the hearing loss status and cochlear damage. This is now specified in the text of the manuscript and is shown in (Figure 3—figure supplement 1).
Authors: G Camarero; C Avendano; C Fernandez-Moreno; A Villar; J Contreras; F de Pablo; J G Pichel; I Varela-Nieto Journal: J Neurosci Date: 2001-10-01 Impact factor: 6.167
Authors: Hortensia Sanchez-Calderon; Lourdes Rodriguez-de la Rosa; Marta Milo; Jose G Pichel; Matthew Holley; Isabel Varela-Nieto Journal: PLoS One Date: 2010-01-25 Impact factor: 3.240
Authors: Yue Yang; Min Dai; Teresa M Wilson; Irina Omelchenko; John E Klimek; Phillip A Wilmarth; Larry L David; Alfred L Nuttall; Peter G Gillespie; Xiaorui Shi Journal: PLoS One Date: 2011-01-31 Impact factor: 3.240
Authors: Nicholas J Timpson; Klaudia Walter; Josine L Min; Ioanna Tachmazidou; Giovanni Malerba; So-Youn Shin; Lu Chen; Marta Futema; Lorraine Southam; Valentina Iotchkova; Massimiliano Cocca; Jie Huang; Yasin Memari; Shane McCarthy; Petr Danecek; Dawn Muddyman; Massimo Mangino; Cristina Menni; John R B Perry; Susan M Ring; Amadou Gaye; George Dedoussis; Aliki-Eleni Farmaki; Paul Burton; Philippa J Talmud; Giovanni Gambaro; Tim D Spector; George Davey Smith; Richard Durbin; J Brent Richards; Steve E Humphries; Eleftheria Zeggini; Nicole Soranzo Journal: Nat Commun Date: 2014-09-16 Impact factor: 14.919
Authors: Carlos F Rodriguez; Paloma Escudero-Bravo; Lucía Díaz; Paola Bartoccioni; Carmen García-Martín; Joan G Gilabert; Jasminka Boskovic; Víctor Guallar; Ekaitz Errasti-Murugarren; Oscar Llorca; Manuel Palacín Journal: Proc Natl Acad Sci U S A Date: 2021-12-07 Impact factor: 12.779
Authors: Clara Vilches; Emilia Boiadjieva-Knöpfel; Susanna Bodoy; Simone Camargo; Miguel López de Heredia; Esther Prat; Aida Ormazabal; Rafael Artuch; Antonio Zorzano; François Verrey; Virginia Nunes; Manuel Palacín Journal: J Am Soc Nephrol Date: 2018-04-02 Impact factor: 10.121