Literature DB >> 29330509

Transcriptome analysis reveals carbohydrate-mediated liver immune responses in Epinephelus akaara.

Yunxia Yang1, Tao Han1, Jia Xiao2, Xinyu Li1, Jiteng Wang3.   

Abstract

As the cheapest energy source, carbohydrates are used in fish feeds to improve physical quality and reduce catabolism of proteins and lipids. The liver is the primary organ for metabolism and is also an important site of immune regulation. Here, we investigated the effect of different dietary carbohydrate levels on growth and health by evaluating the liver transcriptome of Epinephelus akaara. In this study, E. akaara juveniles were fed diets containing few (0% corn starch), moderate (18% corn starch), and high (30% corn starch) levels of dietary carbohydrate. After an 8-week feeding trial, E. akaara fed 30% dietary carbohydrates exhibited poor growth performance compared with those fed 0% and 18% dietary carbohydrates (P > 0.05). Genes related to the immune system, including IL8, TLR9, CXCR4, CCL4, and NFκB inhibitor alpha, were over-expressed in E. akaara fed the highest level of carbohydrate (30%). This general over-expression could indicate activation of inflammatory processes in the liver. The liver transcriptome data of E. akaara reported here indicate that high carbohydrate level of diet can lead to poor growth and inflammatory immune response in E. akaara.

Entities:  

Mesh:

Substances:

Year:  2018        PMID: 29330509      PMCID: PMC5766613          DOI: 10.1038/s41598-017-18990-8

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


Introduction

Carbohydrates are the cheapest energy sources and the major compounds that make up organisms. Some studies have indicated that certain levels of carbohydrates can improve feed utilization and protein retention in rainbow trout (Oncorhynchus mykiss), Atlantic salmon (Salmo salar), European eel (Anguilla anguilla), Atlantic cod (Gadus morhua), and different carp species (Catla catla, Labeo rohita, Cirrhinus mrigala)[1-7]. If sufficient carbohydrate content is not provided in the diet, other nutrients such as proteins and lipid can be used for energy[8]; This could lead to an increase in cost and nutritional imbalances. In addition, post-prandial prolonged hyperglycemia occurs when a high level of carbohydrates is consumed[9-14]. An imbalance carbohydrates in the diet may make the fish under metabolic stress[15] and have negative effects on nutrient retention, growth, metabolism, and health[16]. Thus, it is important to supply an appropriate level of carbohydrates in aqua-feeds. The liver is the primary target organ for metabolism. Nutrients are absorbed into the body through the small intestine and then delivered to liver. The critical metabolic functions of the liver often eclipse its role as an important organ for immune regulation[17], as the liver serves as a physical barrier responsible for filtering potentially harmful antigens, which may reach the body via the gastrointestinal tract. Castro et al.[18] reported that the liver modulates the immune response following hemorrhagic septicemia virus (VHSV) infection in rainbow trout. Similarly, when inappropriate feed supplied, the liver also can function as an immunocompetent organ[19-22]. A growing body of research has focused on the relationship between carbohydrate supplementation and immune function. For example, carbohydrates can regulate the production of proinflammatory cytokines to enhance the endurance performance and attenuated stress hormone response[23]. Carbohydrate utilization differs among fish species[16,24-26]. Herbivorous and omnivorous fish can utilize as much as 45% carbohydrate content in diet[27-29], but carnivorous fish show significantly poorer growth when fed diets with 30% carbohydrate levels compared to those fed moderate carbohydrate levels (in general, ≤20%), such as Atlantic salmon[5] and cobia (Rachycentron canadum)[30]. Epinephelus akaara (Temminck and Schlegel, 1842) is an important marine carnivorous fish with a high market value in Asia, To date, few nutrient requirements have been investigated in E. akaara, except for appropriate level of proteins[31] and lipids[32]. To obtain the appropriate formulation of fish feed, it is an essential pre-requisite to understand the capacity of fish to utilize carbohydrates[8]. High-throughput sequencing can provide an unprecedented view of global gene expression and detailed molecular information on responses to nutrition metabolism. Therefore, we here focused on the liver transcriptome of E. akaara fed diets containing few (0%), moderate (18%), and high (30%) levels of carbohydrates using high-throughput sequencing to identify genes responsible for growth and immune system alterations.

Results

Growth performance and growth-related gene expression in the liver

The growth performance of E. akaara was measured by percentage weight gain (PWG). In this study, the final body weight (g/fish) in each group was 29.30 ± 3.32, 28.54 ± 2.87, and 24.02 ± 0.92, respectively; the PWG (%) were 276.16 ± 41.99, 266.26 ± 28.33, and 208.69 ± 12.68 in the C1, C2, and C3 groups, respectively. PWG generally decreased with increasing dietary carbohydrate (P > 0.05), and fish fed 30% carbohydrates exhibited the lowest PWG. We evaluated genes belonging to the GH/IGF-system to show the relationship between growth and gene expression. Several components of the GH/IGF axis in each group exhibited different expression levels. The expression of GHR, IGF1, IGF2, IGFBP2, IGFBP3 (P < 0.05), IGFBP4, and IGFBP6 (P > 0.05) were decreased in the C2 and C3 groups compared to the C1 group, whereas IGFBP1 (P < 0.05), IGFBP5, and IGFBP7 (P > 0.05) were upregulated in the C3 group to levels comparable to the C1 and C2 groups (Table 1).
Table 1

The expression of growth-related genes in three groups.

Gene IDnameC1C2C3
c56634_g3GHR11.82338.47246.9467
c49944_g2IGFBP11.69924.351384.0755
c46871_g1IGFBP2A12.465711.89595.4010
c59085_g2IGFBP2B102.999097.385065.5878
c33486_g1IGFBP40.99670.75710.7533
c44323_g3IGFBP516.837620.690224.5923
c69225_g1IGFBP60.62240.30810.1927
c49986_g1IGFBP72.69873.80874.8402
c60956_g7IGF178.629329.172117.9944
c59327_g1IGF249.49546.990310.1116
The expression of growth-related genes in three groups.

De novo assembly

There were 5,5912,920, 63,532,872, and 78,789,902 raw reads in the C1, C2, and C3 groups, respectively, generated by high-throughput sequencing of the cDNA library of the E. akaara liver. We cleaned the low-quality reads; the sequence of high quality rates were 87.13% (clean reads number: 48,717,774), 88.10% (55,971,730), 85.33% (67,230,310) in C1, C2, and C3 groups, respectively. There were 94% sequences up to the quality score of Q30, which describes quality score logarithmically linked to error probabilities (i.e., Q30 = 99.9%, chance correct base called). The sequencing results showed that these data were appropriate for analysis (Table 2). The ORF predictions came from the contigs assembled using Trinity. The contigs in each group were 83,451, 84,162, and 94,733, respectively. Subsequently, to annotate the sequences, blastp and blastx alignments (E-value < 10−5) with the NT, NR, gene, and string were used, and 27,327, 27,851, 31,234 contigs in each group featured a corresponding annotation (Table 2).
Table 2

Sequencing information of the E. akaara liver.

SamplesC1C2C3
Raw Reads Number55,912,92063,532,87278,789,902
Clean Reads Number48,717,77455,971,73067,230,310
Clean Reads Rate(%)87.1388.1085.33
Low-quality Reads Number4,827,7785,897,5027,384,488
Low-quality Reads Rate(%)8.639.289.37
Ns Reads Number3,9104,4225,330
Ns Reads Rate(%)0.010.010.01
Adapter Polluted Reads Number2,363,4581,659,2184,169,774
Adapter Polluted Reads Rate(%)4.232.615.29
Raw Q30 Bases Rate(%)89.9390.0488.98
Clean Q30 Bases Rate(%)94.8494.8694.67
ORF counts273272785131234
ORF N50 (bp)101110981074
Sequencing information of the E. akaara liver.

Functional annotation and analysis of differentially-expressed genes

GO terms for the transcriptome were analyzed using Blast2GO, which provides information on “Biological Processes”, “Cellular Components” and “Molecular Function” for each contig (Fig. 1). In the “biological processes” categories, which features 23 subtypes, most corresponding genes were involved in cellular processes, single-organism processes, metabolic processes, and biological regulation. In addition, 22 subtypes were annotated with “cellular components”; most corresponding genes were involved in the cell, organelles, and parts of the membrane. In the “molecular function” category, which featured 22 subtypes, most corresponding genes were involved with binding and catalytic activity.
Figure 1

GO classification of assembled genes in the E. akaara liver transcriptome.

GO classification of assembled genes in the E. akaara liver transcriptome. The KEGG database was used to obtain more information to predict the unigene functions; 38,938 genes ware classified into 113 KEGG pathways. The KEGG pathway analysis was also used to identify genes observed to be differentially expressed in the C1-C2, C2-C3, and C1-C3 pair groups fed few (C1), moderate (C2), or high (C3) levels of carbohydrates. The numbers of differentially-expressed genes in each group (C1-C2, C2-C3, and C1-C3) were 20,499, 35,984, and 37,203, respectively (Fig. 2). There were 20,499 genes differentially expressed in the C2 group relative to the C1 group, 35,984 genes differently expressed in the C3 group relative to the C2 group, and 37,203 genes differently expressed in the C3 group relative to the C2 group. Compared with C1 and C2 group, the number of up-regulated gene in C3 group is no significant difference (P > 0.05).
Figure 2

Differentially-expressed gene distribution. For example, 16,998 genes are differentially-expressed in C3 group compared with C1 and C2 groups.

Differentially-expressed gene distribution. For example, 16,998 genes are differentially-expressed in C3 group compared with C1 and C2 groups. We also chose categories including “Carbohydrate Metabolism”, “Energy Metabolism”, “Lipid Metabolism”, “Amino Acid Metabolism”, ‘Metabolism of Other Amino Acids”, “Glycan Biosynthesis and Metabolism”, “Immune System” and “Digestive System” (Table 3) to evaluate metabolic stress information among the three groups. There were 15 pathways related to the immune system, and most genes were over-expressed in the C3 group compared to the C1 and C2 groups (Table 3). In the chemokine signaling pathway, there were 153 and 144 genes up-regulated in the C3 group compared with the C1 and C2 groups. In addition, we chose 20 genes which belonged to immune system to further confirm the results of differentially-expressed analysis using RT-qPCR (Fig. 3).
Table 3

The number of genes whose expression changed in the metabolism pathway between two groups.

Pathwayc1-c2 upc1-c2 downc1-c3 upc1-c3 downc3-c2 upc3-c2 down
Carbohydrate metabolism
00562Inositol phosphate metabolism3294511536
00010Glycolysis/Gluconeogenesis178527328
00500Starch and sucrose metabolism10617191819
00520Amino sugar and nucleotide sugar metabolism1523141811
00620Pyruvate metabolism2532531815
00051Fructose and mannose metabolism173373218
00052Galactose metabolism114297187
00640Propanoate metabolism19041313
00020Citrate cycle(TCA cycle)64163132
00040Pentose and glucuronate interconversions114876
00030Pentose phosphate pathway87207115
00053Ascorbate and aldarate metabolism220846
00630Glyoxylate and dicarboxylate metabolism020222
00650Butanoate metabolism224142
Energy metabolism
00190Oxidative phosphorylation419254460
00680Methane metabolism14822795
00710Carbon fixation in photosynthetic organisms1510784
00720Carbon fixation pathways in prokaryotes203021
00195Photosynthesis000010
00920Sulfur metabolism203020
00910Nitrogen metabolism412023
Lipid metabolism
00564Glycerophospholipid metabolism152335323315
00561Glycerolipid metabolism131725262312
00600Sphingolipid metabolism72136142
00071Fatty acid degradation136879
00590Arachidonic acid metabolism7617241712
00565Ether lipid metabolism54179163
00140Steroid hormone biosynthesis411618512
0062Fatty acid elongation15129125
00100Steroid biosynthesis1425168234
01040Biosynthesis of unsaturated fatty acids1951063
00591Linoleic acid metabolism2481867
00120Primary bile acid biosynthesis253915
00592alpha-Linolenic acid metabolism056983
00061Fatty acid biosynthesis1701001
00072Synthesis and degradation of ketone bodies010030
00073Cutin, suberine and wax biosynthesis505031
Amino acid metabolism
00310Lysine degradation72019182311
00330Arginine and proline metabolism86167157
00270Cysteine and methionine metabolism071112109
00280Valine, leucine and isoleucine degradation013272
00260Glycine, serine and threonine metabolism71114874
00380Tryptophan metabolism446172
00250Alanine, aspartate and glutamate metabolism046254
00340Histidine metabolism153372
00350Tyrosine metabolism067370
00360Phenylalanine metabolism156371
00300Lysine biosynthesis010200
00290Valine, leucine and isoleucine biosynthesis001101
Immune system
04062Chemokine signaling pathway2613153121447
04670Leukocyte transendothelial migration25161201811010
04650Natural killer cell mediated cytotoxicity25111049887
04660T cell receptor signaling pathway271710313888
04666Fc gamma R-mediated phagocytosis181910114929
04662B cell receptor signaling pathway2379310778
04620Toll-like receptor signaling pathway1710768617
04640Hematopoietic cell lineage2346774812
04664Fc epsilon RI signaling pathway10156317586
04621NOD-like receptor signaling pathway104443396
04622RIG-I-like receptor signaling pathway77417323
04672Intestinal immune network for IgA production60250180
04612Antigen processing and presentation33236227
04610Complement and coagulation cascades6219102014
04623Cytosolic DNA-sensing pathway42152152
Digestive system
04972Pancreatic secretion1125654636
04971Gastric acid secretion89504413
04970Salivary secretion911426385
04974Protein digestion and absorption1420955915
04976Bile secretion9143116289
04973Carbohydrate digestion and absorption54259277
04975Fat digestion and absorption88825416
04977Vitamin digestion and absorption3612516
04978Mineral absorption636521

The data in table indicate genes involved in carbohydrate metabolism, energy metabolism, lipid metabolism, amino acid metabolism, immune system function, and digestive system function that were up-regulated and downregulated across groups.

Figure 3

RT-qPCR confirmation of genes expressed at different carbohydrate level in C1, C2 and C3 groups. Bars represent mean ± standard error of three fish. Aasterisks indicate significant (P < 0.01) differences. The genes chosen for immune system were: APT2: Antigen peptide transporter 2; CCL4: C-C motif chemokine 4; CD3: T-cell surface glycoprotein CD3 delta chain; CIITA: MHC class II transactivator; CXCL10: C-X-C motif chemokine 10; CXCR4: C-X-C chemokine receptor type 4; FOS: Proto-oncogene c-Fos; IKK1: Inhibitor of nuclear factor kappa-B kinase subunit alpha; IL12: Interleukin-12 subunit beta; IL8: Interleukin-8; IRF3: Interferon regulatory factor 3; LCP2: Lymphocyte cytosolic protein 2; NCF1: Neutrophil cytosol factor 1; NFATC: Nuclear factor of activated T-cells; NFKBIA: NF-kappa-B inhibitor alpha; TLR21: Toll-like receptor 2 type-1; TLR9: Toll-like receptor 9; TNF12: Tumor necrosis factor 12; TNFR11: Tumor necrosis factor receptor superfamily member 11.

The number of genes whose expression changed in the metabolism pathway between two groups. The data in table indicate genes involved in carbohydrate metabolism, energy metabolism, lipid metabolism, amino acid metabolism, immune system function, and digestive system function that were up-regulated and downregulated across groups. RT-qPCR confirmation of genes expressed at different carbohydrate level in C1, C2 and C3 groups. Bars represent mean ± standard error of three fish. Aasterisks indicate significant (P < 0.01) differences. The genes chosen for immune system were: APT2: Antigen peptide transporter 2; CCL4: C-C motif chemokine 4; CD3: T-cell surface glycoprotein CD3 delta chain; CIITA: MHC class II transactivator; CXCL10: C-X-C motif chemokine 10; CXCR4: C-X-C chemokine receptor type 4; FOS: Proto-oncogene c-Fos; IKK1: Inhibitor of nuclear factor kappa-B kinase subunit alpha; IL12: Interleukin-12 subunit beta; IL8: Interleukin-8; IRF3: Interferon regulatory factor 3; LCP2: Lymphocyte cytosolic protein 2; NCF1: Neutrophil cytosol factor 1; NFATC: Nuclear factor of activated T-cells; NFKBIA: NF-kappa-B inhibitor alpha; TLR21: Toll-like receptor 2 type-1; TLR9: Toll-like receptor 9; TNF12: Tumor necrosis factor 12; TNFR11: Tumor necrosis factor receptor superfamily member 11.

Discussion

As the cheapest energy sources, carbohydrates are used in fish feeds to improve physical quality and reduce catabolism of proteins and lipids[33]. However, carnivorous fish have a poor ability to utilize high level of carbohydrate. Thus, we investigated the effect of different dietary carbohydrate levels (0%, 18%, and 30%) on growth and health by evaluating the liver transcriptome in E. akaara. In the present study, E. akaara fed a diet with 30% carbohydrate content exhibited poor growth performance (PWG = 208.69%) compared with those fed 0% (PWG = 276.16%) and 18% (PWG = 266.26%) carbohydrate content. These results indicated that PWG decreased with an increase in dietary carbohydrate levels. Various mechanisms could account for growth, including endocrine system change[34]. As in mammals, there are two major molecular targets, growth hormone (GH) and insulin-like growth factor (IGF), in the potential endocrine regulation of growth in the teleost[35-38]. They both belong to the GH/IGF-system, which also consists of multiple subtypes of GH receptors (GHRs) and insulin-like growth factor binding protein (IGFBP)[39]. Several studies have confirmed that IGF and GHR gene expression which is closely related to growth performance can be modulated by the feed component[40-45]. Studies of coho salmon, gilthead sea bream (Sparus aurata), and tilapia have indicated that the levels of hepatic GHR and IGF mRNA are positively correlated with body growth rate[46-50]. In accord with these findings, E. akaara fed high levels of carbohydrates had the lowest PWG value and the lowest expression of IGF1 and GHR genes (Table 1). In addition to IGF and GHR, IGFBPs are the main members of the GH/IGF-system. These IGFBPs are traditionally thought to function as carrier proteins and regulate circulating IGF turnover, transport, and distribution. And some studies have shown that IGFBPs are ubiquitously expressed across numerous tissues with autocrine or paracrine effects in salmonids and modulate IGF activities in target tissues[44,51-53]. Except for IGFBP-1, which is predominantly expressed in liver, all other IGFBPs are expressed in many peripheral tissues[45]. In our study, we found that the IGFBP 1, 5, 7 genes were up-regulated in fish fed high levels of carbohydrate diet (C3 group) compared to the other two groups. Elsewise, expression of the IGFBP 2, 3, 4, and 6 genes was reduced in the C3 group, The expression of multiple IGFBPs genes is regulated by different levels of carbohydrate, but little is known about their function in liver. And the mechanism is still not clear. These findings may reinforce the need for additional research about the relationship between IGFBPs gene expression and growth performance in fish. The liver is an important organ for metabolism and immune function. Significant numbers of natural killer receptor-positive (NKR+) cells and macrophages reside in the healthy liver, which can detect foreign substances and produce inflammatory mediators. In the present study, most genes involved in innate and adaptive immune system were up-regulated following increased dietary carbohydrate levels, suggesting that high levels of carbohydrates can invoke an immune response. There are many immune system pathways in organism, such as T-cell receptor signaling pathway, B cell receptor signaling pathway, chemokine signaling pathway, Toll-like receptor signaling pathway, RIG-I-like receptor signaling pathway, and NOD-like receptor signaling pathway. In our study, most genes which belongs to immune system pathways were up-regulated in C3 group which fed high carbohydrate level dietary compared with C1 and C2 groups which were fed with lower carbohydrate levels in diet (Table 3). We evaluated 20 genes using RT-qPCR, which belong to 15 pathways in the immune system, and found differential expression across the three groups (Fig. 3). Interleukin 8 (IL8) is a member of the CXC chemokine family and is one of the major mediators of the inflammatory response[54,55], and, if the harmful antigens are present in the liver, it causes inflammatory-related genes to be over-expressed immediately. In our study, IL8 was more highly expressed in the group fed high levels of carbohydrates compared to the C1 and C2 groups, which had a low constitutive expression (Fig. 3). C-C motif chemokine 4 (CCL4), C-X-C motif chemokine 10 (CXCL10), and C-X-C chemokine receptor type 4 (CXCR4) genes also belong to the chemokine signaling pathway and are chemotactic factors which can active granulocytes, nature kill cells, and monocytes to product interleukin and interferon. In this study, these genes were significantly over-expressed in the group fed high levels of carbohydrates (Fig. 3), indicating the inflammation response in fish[56]. In the T-cell receptor immune pathway, cluster of differentiation 3 (CD3) induces the T-cell receptor (TCR) to generate an activation signal in T lymphocytes[57]. This high specificity, combined with the presence of CD3 at all stages of T-cell development, makes it a useful immunohistochemical marker for T-cells in tissue sections. T- cells have largely diversified receptors to recognize different antigens, and the MHC class II plays a central role in determining T-cell-mediated adaptive immunity against various pathogens. In this study, MHC class II and CD3 genes had the highest expression in the group fed high levels of carbohydrates compared to the groups fed few and moderate levels. These results indicate that high levels of carbohydrates induced an adaptive immunity response. Toll-like receptors (TLRs), inhibitor of nuclear factor kappa-B kinase subunit alpha (IKKA), caspase-8, proto-oncogene c-Fos (Fos), interferon regulatory factor 3 (IRF3), tumor necrosis factor (TNF), and tumor necrosis factor receptor (TNFR) belong to Toll-like receptor signaling pathway, NOD-like receptor signaling pathway, and RIG-I-like receptor signaling pathway. These three pathways are cytoplasmic pattern recognition receptors (PRRs), which are involved in the recognition of viruses by the innate immune system[58]. PRRs responded to many exogenous pathogens and/or endogenous serious signals, by recognizing highly conserved structures, such as pathogen associated molecular patterns (PAMPs) and danger/damage associated molecular patterns (DAMPs). Following recognition by PRRs, downstream signaling pathways induce expression of genes of inflammatory molecules that can activate the cytokine signaling pathway to regulate innate and adaptive immunity[59]. The genes belonging to these three pathways had significantly higher expression in the group fed high levels of carbohydrates, suggesting that an imbalance in carbohydrates signals the liver to produce immunocompetence through the innate and adaptive immune system. In Atlantic salmon, another sea carnivorous fish, numerous studies reported plant feedstuffs could lead to the changes of histomorphological and immune response related genes expression in intestine at least four weeks[60-65]. However, Sahlmann et al.[66] found that the gene expression changes could be detected in third day, which is earlier than signs of inflammation in histological evaluation. In this study, we got the liver transcriptome data of E. akaara after 8 weeks of rearing experiment and it showed that the fish consuming high level of carbohydrate may increase inflammation response. Then, we did a short feeding trial with C2 and C3 experimental diets to make up the defect of functional verification in original experiment. After 2 weeks, although there was no difference in histological section of liver tissue, the immune response related genes were higher expression in C3 group than C2 group by RT-qPCR. It suggested that the high level of carbohydrate had the tendency to give rise to immune reaction in E. akaara. On the other hand, we used 3 fishes of each replicating group per treatment as the RNA templet to confirmed the sequencing data with RT-qPCR. They were consistent with each other. These results all confirmed that our data and conclusion is credible.

Conclusion

The liver transcriptome data of E. akaara reported here indicate that high carbohydrate level of diet can lead to poor growth and inflammatory immune response in E. akaara. The up-regulation of a large number of genes in immune system pathway revealed the fish maybe experience inflammatory response which may be related with a decrease in growth rate. The prominent effects caused by diet composition on immune function parameters underline the importance of nutritional factors in the defense system of E. akaara.

Materials and Methods

Experimental design and sample preparation

This study was implemented at the Zhejiang province Key Lab of Mariculture and Enhancement in Zhoushan, China. Before the experiments, the juvenile fish were temporarily fed a commercial diet. At the beginning of the experiment, fish (initial weight 7.79 ± 0.01 g) were weighed and sorted into 9 cages (20 fish/cage). The experimental system consisted of 9 net cages (60 × 60 × 80 cm; L × W × H). All net cages were placed in one large concrete tank (13.0 × 4.0 × 1.5 m). A recirculating water system (including a sedimentation chamber, one drum filter, one fluidized sand filter, two biofilters, and two protein skimmers) was used during the experimental period. Three replicate groups of fish were used for each experiment diet. Three semi-purified isoproteic (48%) and isolipidic (9%) diets were formulated with different levels of corn starch (C1: 0%; C2: 18%; C3: 30%). All fish were fed to apparent satiation twice daily at 8:30 and 16:00, and the feeding trial lasted for 8 weeks. During the experimental period, dissolved oxygen (DO), salinity, and temperature were 6.2 ± 0.1 mg/L, 25.1 ± 0.9 g/L and 27.5 ± 2.3 °C, respectively. At the end of the feeding trial, three fish in each cage were dissected, livers were immediately frozen in liquid nitrogen, and then they were stored at −80 °C until RNA extraction for sequencing. The experiment was implemented at the Zhejiang province Key Lab of Mariculture and Enhancement of Zhejiang Ocean University (Zhoushan, China). All experimental procedures were approved by the Local Animal Care and Use Committee (Zhejiang, China), and the study was carried out in accordance with regulations for the administration of affairs concerning experimental animals of China (Promulgated by Decree No. 2 of the State Science and Technology Commission on November 14, 1988).

RNA extraction and sequencing

Total RNA was extracted from livers of each group by homogenization in 1 ml TRIZol (Invitrogen) following the manufacturer’s instructions. The concentration and quality of total RNA were determined by electrophoresis (Thermo Scientific Nano drop 2000, USA). And total RNA was used for paired-end RNA sequencing. Library construction and sequencing were performed on an Illumina HiSeq. 2000 sequencer according to manufacturer’s specifications.

De novo assembly and functional annotation

Raw reads were pre-processed by discarding reads with adaptors, with unknown sequence (N) proportion greater than 5%, and those of low quality (Phred quality score <30). Then, raw reads were assembled by Trinity software using default parameters[67]. Transcripts shorter than 200 bp were removed from the subsequent analysis[68]. The assembly sequencing results evaluated used bowtie-1.0.1[69], which mapped the raw reads to the assembled transcriptome. Transcripts from the previous step were translated in all six possible open reading frames (ORFs) with TransDecoder tool, which was used to predict the ORF of the RNA sequencing assembly sequence. Proper translation was defined as one that gave the longest amino acid sequence[70] according to the hidden Markov model (HMM). The functional annotations of predicted amino acid sequences were performed using Trinotate (http://trinotate.sourceforge.net/) through searching against the Uniprot Knowledgebase and Swiss-Prot. In addition, we ran HMMER, signalIP, and tmHMM in Trinotate to identify protein domains, predict signal peptides, and transmembrane regions, respectively. Gene Ontology (GO) annotations of transcripts were obtained by searching against the non-redundant (nr) database using the Blast2GO program[71] with an E-value cutoff of 10−5. GO functional classifications were performed using WEGO software[72]. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways were assigned to the assembled transcripts using the online KEGG Automatic Annotation Server (KAAS) (http://www.genome.jp/kegg/kaas/). The bi-directional best-hit (BBH) method was used to obtain KEGG orthology assignments.

Identification of differentially-expressed genes (DEGs) and RT-qPCR

DEGseq[73] was used to compare RNA-seq data and identify differentially expressed genes. And the input of DEGseq is uniquely mapped reads from RNA-seq data with a gene annotation of the corresponding transcript expression values provided by RPKM[74]. A set of 20 genes which were significantly affected by high carbohydrate food were quantified by RT-qPCR to validate sequencing performance. Primers were designed using Primer premier 6 software (Table 4). The β-actin as the reference gene was quantified. For RT-qPCR, 2 μg of total RNA per sample was reverse transcribed into cDNA using the PrimeScript™ II 1st Strand cDNA Synthesis Kit (Takara), following manufacturer’s instructions. Amplifications were carried out in triplicate in a final volume of 20 μl containing 2 μl cDNA (1/10 dilution), 0.5 μM of each primer and 10 μl SYBR Green Supermix (Takara). The RT-qPCR profiles contained an initial activation step at 95 °C for 10 min, followed by 40 cycles: 15 s at 95 °C, 15 s at the specific primer pair annealing temperature (Ta; Table 4) and 15 s at 72 °C. After the amplification phase, a melt curve of 0.5 °C increments from 75 °C to 90 °C was performed, enabling confirmation of the amplification of a single product in each reaction. The analysis was based on the Ct values of the PCR products. Results are shown as changes in relative expression normalized with β-actin using the 2−ΔΔCt method. Chi-square statistic was applied to detect significant differences in each group.
Table 4

Primers used for RT-qPCR analyses.

Gene namePrimer sequence (5′–3′)Fragment (bp)Ta (°C)
TAP2TGGTTCGCAGCACAGTCA26256
GCCTCGTTATACCTCCTCAGT
Caspase 10GCTACGGACAAGACATAC25755
GGTGGATGATGAGGAGAA
CCL4TCTCGCTCTGTCTGTGTT25156
CGTCCAGGTAGGTGATGA
CD3TTCCAGTACCACAAGACAG15953
CCAGGACTCAGAGGTGTA
CIITAGTCGGTTAGTCTGCTTGGT35955
TGTTCTGTCTGCTTCCTCTC
CXCL10TCTACCAAGCGACCATCT29054
GTGTCAGTGCTGTCAGTATA
CXCR4GACTCGGACTCTGTTGAC27354
CTGTGTTGGCATCTTCTTG
FOSGGAGGTTGAGGTGTAGGT21656
GCTAATCTGTTGAAGGAGAAG
IKK1TTAACTCTTCTGGAACCTCTC26355
GTGACCTGACCGTATGGA
IL12CCTCACCATCTACATACACAT19055
CACCTTGACCTGGAACTG
IL8CCATCTGAGGAGAAGAACTC38156
CTGTGTTATTGAGCCTGATTC
IRF3GGAGTCGGCTTGAAGATA24655
TCAGTGTGGAAGAGGAAC
LCP2AGTCTGTCTGGCTGTGAT15153
TCTCCTCCTTCTTGCTGAT
NCF1TGGTGGTTCTGTCAGTGT37658
CCTTGTTGTGGATGCTCTT
NFATCGTCTGCTTCATACTCGTCTAT13653
TGTCTGCCACTCTGTCAA
NFKBIATGTTGAGGAAGTCTGTGTT23056
GCTGAAGGAGGAGGAGTA
TLR2ACTCTGGAGGTGTTGGAT28056
CGTTGATGGCTGATTGGA
TLR9CCTACCTTGACATCTCTGAC28252
CCGCCTTACTGAAGAACAT
TNF12CTCGCCTCACATCTTCAG22052
TCCACAACAACTTCCACAA
TNFR11CAGTGCTGTCAGTCATCA12752
TGTATCCTCGTCCTCTTCA
β actinCGACCTCACAGACTACCT22156
AACGGAACCTCTCATTGC
Primers used for RT-qPCR analyses.

Growth performance calculations

Data on initial body weight were used to calculate percentage weight gain (PWG). PWG (%) = 100% × (final body weight − initial body weight)/initial body weight. All measured values were presented as the mean ± standard deviation (SD). All data were tested for homogeneity (Levene’s test) and normal distribution (Kolmogorov-Smirnov tests), and necessary data were transformed before analysis. When data did not present variance homogeneity and normal distribution, Spearman’s correlation was used to determine the relationship between the response data and dietary carbohydrate. Values were regarded as statistically significant at P < 0.05. Statistical analysis was used to rank the groups using SPSS 18.0 (IBM, Chicago, USA) for Windows.
  43 in total

Review 1.  Structure, function, and regulation of insulin-like growth factors in fish.

Authors:  P Y Le Bail; V Gentil; O Noel; J M Gomez; F Carre; P Le Goff; C Weil
Journal:  Ann N Y Acad Sci       Date:  1998-05-15       Impact factor: 5.691

2.  Response to soy: T-cell-like reactivity in the intestine of Atlantic salmon, Salmo salar L.

Authors:  A M Bakke-McKellep; M K Frøystad; E Lilleeng; F Dapra; S Refstie; A Krogdahl; T Landsverk
Journal:  J Fish Dis       Date:  2007-01       Impact factor: 2.767

3.  Glucose and amino acid-stimulated insulin release in vivo in the European silver eel (Anguilla anguilla L.).

Authors:  B W Ince; A Thorpe
Journal:  Gen Comp Endocrinol       Date:  1977-02       Impact factor: 2.822

Review 4.  Roles of insulin-like growth factor (IGF) binding proteins in regulating IGF actions.

Authors:  Cunming Duan; Qijin Xu
Journal:  Gen Comp Endocrinol       Date:  2005-02-05       Impact factor: 2.822

5.  Effects of diets containing soybean meal on trypsin mRNA expression and activity in Atlantic salmon (Salmo salar L).

Authors:  Einar Lilleeng; Marianne K Froystad; Gunn C Ostby; Elin C Valen; Ashild Krogdahl
Journal:  Comp Biochem Physiol A Mol Integr Physiol       Date:  2007-01-10       Impact factor: 2.320

6.  Identification of insulin-like growth factor-binding proteins in the circulation of four teleost fish species.

Authors:  K M Kelley; K Siharath; H A Bern
Journal:  J Exp Zool       Date:  1992-08-15

7.  Molecular cloning and characterization of gilthead sea bream (Sparus aurata) growth hormone receptor (GHR). Assessment of alternative splicing.

Authors:  Josep A Calduch-Giner; Mónica Mingarro; Silvia Vega-Rubín de Celis; Daniel Boujard; Jaume Pérez-Sánchez
Journal:  Comp Biochem Physiol B Biochem Mol Biol       Date:  2003-09       Impact factor: 2.231

8.  Ultrafast and memory-efficient alignment of short DNA sequences to the human genome.

Authors:  Ben Langmead; Cole Trapnell; Mihai Pop; Steven L Salzberg
Journal:  Genome Biol       Date:  2009-03-04       Impact factor: 13.583

9.  Effects of dietary soyabean meal, inulin and oxytetracycline on intestinal microbiota and epithelial cell stress, apoptosis and proliferation in the teleost Atlantic salmon (Salmo salar L.).

Authors:  Anne Marie Bakke-McKellep; Michael H Penn; Patricia Mora Salas; Ståle Refstie; Sigmund Sperstad; Thor Landsverk; Einar Ringø; Ashild Krogdahl
Journal:  Br J Nutr       Date:  2007-04       Impact factor: 3.718

10.  Early immune responses in rainbow trout liver upon viral hemorrhagic septicemia virus (VHSV) infection.

Authors:  Rosario Castro; Beatriz Abós; Jaime Pignatelli; Louise von Gersdorff Jørgensen; Aitor González Granja; Kurt Buchmann; Carolina Tafalla
Journal:  PLoS One       Date:  2014-10-22       Impact factor: 3.240

View more
  4 in total

1.  Benfotiamine, a Lipid-Soluble Analog of Vitamin B1, Improves the Mitochondrial Biogenesis and Function in Blunt Snout Bream (Megalobrama amblycephala) Fed High-Carbohydrate Diets by Promoting the AMPK/PGC-1β/NRF-1 Axis.

Authors:  Chao Xu; Wen-Bin Liu; Ding-Dong Zhang; Hua-Juan Shi; Li Zhang; Xiang-Fei Li
Journal:  Front Physiol       Date:  2018-09-03       Impact factor: 4.566

2.  Integrated analysis of immune parameters, miRNA-mRNA interaction, and immune genes expression in the liver of rainbow trout following infectious hematopoietic necrosis virus infection.

Authors:  Shenji Wu; Jinqiang Huang; Yongjuan Li; Mingquan Lei; Lu Zhao; Zhe Liu
Journal:  Front Immunol       Date:  2022-09-02       Impact factor: 8.786

3.  Enhanced Immune Response Improves Resistance to Cadmium Stress in Triploid Crucian Carp.

Authors:  Wen-Bin Liu; Min-Meng Wang; Liu-Ye Dai; Sheng-Hua Dong; Xiu-Dan Yuan; Shu-Li Yuan; Yi Tang; Jin-Hui Liu; Liang-Yue Peng; Ya-Mei Xiao
Journal:  Front Physiol       Date:  2021-06-04       Impact factor: 4.566

4.  Revealing Alteration in the Hepatic Glucose Metabolism of Genetically Improved Carp, Jayanti Rohu Labeo rohita Fed a High Carbohydrate Diet Using Transcriptome Sequencing.

Authors:  Kiran D Rasal; Mir Asif Iquebal; Sangita Dixit; Manohar Vasam; Mustafa Raza; Lakshman Sahoo; Sarika Jaiswal; Samiran Nandi; Kanta Das Mahapatra; Avinash Rasal; Uday Kumar Udit; Prem Kumar Meher; Khuntia Murmu; U B Angadi; Anil Rai; Dinesh Kumar; Jitendra Kumar Sundaray
Journal:  Int J Mol Sci       Date:  2020-10-31       Impact factor: 5.923

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.