Literature DB >> 29316252

Manganese-12 acetate suppresses the migration, invasion, and epithelial-mesenchymal transition by inhibiting Wnt/β-catenin and PI3K/AKT signaling pathways in breast cancer cells.

Hongping Ju1, Yongxia Li2, Xiqian Xing3, Xisong Miao1, Yunping Feng1, Yunhui Ren1, Jing Qin1, Dian Liu1, Zihao Chen4, Zhaoyu Yang1.   

Abstract

BACKGROUND: Breast cancer is the leading cause of cancer-related death in the world, and it is of great value to reveal the molecular mechanisms of breast cancer progression and develop new therapeutic targets.
METHODS: Transwell assay is used to analyze the migration and invasion of breast cancer cells. Real-time PCR and western blotting assay are applied to detect the expression levels of epithelial-mesenchymal transition markers and the key members of Wnt/β-catenin and PI3K/AKT signaling pathways.
RESULTS: Manganese-12 acetate (Mn12Ac) significantly inhibited the migration and invasion of MCF7 and MDA-MB-231 breast cancer cells. Western blotting assay further showed that Mn12Ac significantly upregulated E-cadherin, and downregulated N-cadherin and vimentin. We further found that Mn12Ac reduced the mRNA expressions of epithelial-mesenchymal transition-associated transcription factors snail, slug, twist1, and ZEB1 using real-time PCR assay. Importantly, we further found that Mn12Ac significantly reduced the Wnt1 and β-catenin protein expressions, and suppressed the phosphorylation of PI3K and AKT in MCF7 and MDA-MB-231 breast cancer cells. Very interestingly, we also showed that Mn12Ac decreased the mRNA and protein expressions of programmed cell death ligand 1.
CONCLUSION: Taken together, our results suggested that Mn12Ac inhibited the migration, invasion, and epithelial-mesenchymal transition by regulating Wnt/β-catenin and PI3K/AKT signaling pathways in breast cancer.
© 2018 The Authors. Thoracic Cancer published by China Lung Oncology Group and John Wiley & Sons Australia, Ltd.

Entities:  

Keywords:  Breast cancer; invasion; manganese-12 acetate; migration

Mesh:

Substances:

Year:  2018        PMID: 29316252      PMCID: PMC5832475          DOI: 10.1111/1759-7714.12584

Source DB:  PubMed          Journal:  Thorac Cancer        ISSN: 1759-7706            Impact factor:   3.500


Introduction

Breast cancer is one of the most frequent malignancies worldwide, and the second leading cause of cancer‐related mortality in the female population.1, 2 Despite advances being made in the management of breast cancer over the past several decades, approximately 20–25% of patients with early breast cancer relapse within five years of diagnosis.3 Because metastasis is the leading cause of cancer‐related death, revealing the mechanism of breast cancer metastasis is a matter of extreme urgency. Although many efforts have been made to show the mechanisms underlying both the emergence of drug resistance and the metastasis of breast cancer, these issues remain challenges to successful therapy. Epithelial–mesenchymal transition (EMT) is a significant procession, which is characterized as cells losing polarity and cell contact, and is activated in tumor metastasis and resistance to chemoradiotherapy.4, 5 Activation of EMT is associated with changed expression of many genes, including downregulation of epithelial markers, such as occluden‐1 and E‐cadherin, and upregulation of mesenchymal markers, including N‐cadherin and vimentin.6 Many studies have shown that EMT is a critical process in tumor invasion and metastasis in breast cancer.7, 8, 9 Manganese‐12 acetate (Mn12Ac) is a magnetically bistable molecule showing a combination of strong magnetic anisotropy and high spin properties.10, 11 However, there has been no report about the correlations between Mn12Ac and disease therapy, especially cancer. In the present study, we explored the biological function of Mn12Ac in breast cancer treatment.

Methods

Cell culture

The human breast cancer cell lines, MCF7 and MDA‐MB‐231, were cultured in RPMI‐1640 medium with 10% fetal bovine serum, 100 U/mL penicillin, and 100 g/mL streptomycin at 37°C in a humidified incubator containing 5% carbon dioxide. We used 100 nm Mn12Ac (dissolved in H2O) to treat the breast cancer cells for 48 hours, and then detections were carried out.

Total RNA extraction and real‐time PCR assay

Total RNA was isolated from cancer cells using the RNeasy Mini Kit, as described by the manufacturer (Qiagen, Hilden, Germany), and used for real‐time PCR assay. Real‐time PCR was used to detect the mRNA expressions of E‐cadherin, N‐cadherin, vimentin, snail, slug, twist1, ZEB1, and programmed cell death ligand 1 (PD‐L1). The PCR reactions were carried out in a total volume of 20 μL, including 10 μL of 2XPower SYBR Green PCR Master Mix (Applied Biosystems, Warrington, UK), 2 μL of cDNA (5 ng/μL) and 1 μL of primer mix (10 μm each). PCR amplification and detection were carried out in a LightCycler 480 II (Roche Applied Science, Penzberg, Germany) as follows: an initial denaturation at 95°C for 10 minutes; 40 cycles of 95°C for 15 seconds and 60°C for 1 minute. The relative gene expression was calculated using the comparative CT method. The gene expression of the target gene was normalized to an endogenous reference (glyceraldehyde 3‐phosphate dehydrogenase [GAPDH]), and relative to the calibrator were given by the formula 2−ΔΔCt. ΔCT was calculated by subtracting the average GAPDH CT from the average CT of the gene of interest. The ratio defines the level of relative expression of the target gene to that of GAPDH. The primers were as follows: E‐cadherin forward primer, 5′‐GAACGCATTGCCACATACAC‐3′; E‐cadherin reverse primer, 5′‐GAATTCGGGCTTGTTGTCAT‐3′; N‐cadherin forward primer, 5′‐GTGCCATTAGCCAAGGGAATTCAGC‐3′; N‐cadherin reverse primer, 5′‐GCGTTCCTGTTCCACTCATAGGAGG‐3′; vimentin forward primer, 5′‐TGAGTACCGGAGACAGGTCGAG‐3′; vimentin reverse primer, 5′‐TAGCAGCTTCAACGCAAAGTTC‐3′; snail forward primer, 5′‐ACCACTATGCCGCGCTCTT‐3′; snail reverse primer, 5′‐GGTCGTAGGGCTGCTGGAA‐3′; slug forward primer, 5′‐GCGCATGCTCCATTGTCTTAC‐3′; slug reverse primer, 5′‐AGGCACTTGGAAGGGGTATTG‐3′; twist1 forward primer, 5′‐AGAAGTCTGCGGGCTGTGGCG‐3′; twist1 reverse primer, 5′‐GAGGGCAGCGTGGGGATGATC‐3′; ZEB1 forward primer, 5′‐CTACTCAACTACGGTCAGCCC‐3′; ZEB1 reverse primer, 5′‐TTGGGCGGTGTAGAATCAGAG‐3′; PD‐L1 forward primer, 5′‐GAACTACCTCTGGCACATCCT‐3′; PD‐L1 reverse primer, 5′‐CACATCCATCATTCTCCCTTT‐3′; GAPDH forward primer, 5′‐AAATCCCATCACCATCTTCCAG‐3′; GAPDH reverse primer, 5′‐GAGTCCTTCCACGATACCAAAGTTG‐3′.

Western blotting assay

Cells were lysed in the lysis buffer (20 mm Tris, 2 mm ethylenediaminetetreaacetic acid, 50 mm 2‐mecaptoethanol, 10% glycerol, pH 7.4). The homogenates were placed on ice for 30 minutes and centrifuged at 12 000 g for 15 minutes at 4°C. Afterward, the protein concentrations of the lysates were determined using a Protein Assay Kit (Bio‐Rad, Richmond, CA, USA). Equal amounts of total proteins were loaded onto a 10% gradient polyacrylamide gel, electrophoretically transferred to polyvinylidene difluoride membrane, and then blocked with 10% non‐fat milk for two hours at room temperature. The membranes were incubated with specific primary antibodies overnight at 4°C and probed with corresponding secondary antibodies for one hour at room temperature. The protein bands were visualized using ECL Blotting Detection Reagents (Applygen, Beijing, China). The primary antibodies were as follows: E‐cadherin (1:1000; Santa Cruz Biotechnology, CA, USA), N‐cadherin (1:1000; Santa Cruz Biotechnology) Vimentin (1:1000; Santa Cruz Biotechnology), Wnt1 (1:1000; Santa Cruz Biotechnology), β‐catenin (1:1000; Santa Cruz Biotechnology), p‐PI3K (1:1000; Santa Cruz Biotechnology), PI3K (1:1000; Santa Cruz Biotechnology), p‐AKT (1:1000; Santa Cruz Biotechnology), AKT (1:1000; Santa Cruz Biotechnology), PD‐L1 (1:1000; Cell Signaling Technology, Danvers, MA, USA), and β‐actin (1:5000; Santa Cruz Biotechnology).

Cell proliferation assay

The tumor cell proliferation was analyzed by a Cell Counting Kit‐8 (Dojindo Laboratories, Kumamoto, Japan) based on the manufacturer's instructions. A total of 48 hours after Mn12Ac treatment, cells were seeded into 96‐well plates at a density of 8 × 103 cells per well with 100 μL medium, and continued to incubate at 37°C. At the indicated time‐points, 10°μL Cell Counting Kit‐8 solutions were added to each well. After incubation at 37°C for one hour, the absorbance was measured with a plate reader at 450 nm. The growth curves were shown to reveal the growth rates.

Transwell assay

For the transwell invasion assay, 60 μL of matrigel was diluted with precooled serum‐free medium in 1:4 ratios, and was added to the bottom of the transwell chamber and incubated for one hour at 37°C. Then, 2 × 105 cells were seeded into the upper chambers (24‐well insert; pore size 8 μm), while medium supplemented with 10% FBS (600 μL) was placed in the lower chamber. After incubation at 37°C for 24 hours, cells on the top side of the inserts were removed gently with a cotton swab. The inserts were then fixed by 4% methanol for 15 minutes and stained with 0.1% crystal violet for 15 minutes. The average migratory cells were counted by randomly choosing five fields each time under the microscope. The experiments were repeated three times. For the transwell migration assay, the remaining protocol was the same as the transwell invasion assay, except for the pre‐coat of the matrigel in the inserts.

Statistical analysis

All data were analyzed by Student's t‐test and one‐way analysis of variance using SPSS (SPSS, Chicago, IL, USA) and GraphPad Prism 5.0 (GraphPad, La Jolla, CA, USA). P < 0.05 was considered as a significant difference. *P < 0.05, **P < 0.01, ***P < 0.001 and ****P < 0.0001.

Results

Mn12Ac significantly inhibited the migration and invasion of MCF7 and MDA‐MB‐231 breast cancer cells

In order to study the anti‐tumor activity of Mn12Ac, we used the transwell migration and invasion assays to measure the effects of Mn12Ac on breast cancer cell metastasis, the results showed that Mn12Ac could significantly inhibit the migration and invasion of MCF7 and MDA‐MB‐231 breast cancer cells (Fig 1a,b). We also found that Mn12Ac had no effects on the proliferation of MCF7 and MDA‐MB‐231 breast cancer cells (Fig 1c,d).
Figure 1

Manganese‐12 acetate (Mn12Ac) inhibited the migration and invasion of MCF7 and MDA‐MB‐231 breast cancer cells. (a) Transwell assay analysis of the abilities on the tumor cell migration. (b) Transwell assay analysis of the abilities on the tumor cell invasion. (c,d) Cell Counting Kit‐8 assay analysis of the abilities on the tumor cell proliferation of (c) MCF7 and (d) MDA‐MB‐231. MCF7, MDA‐MB‐231, NC, Mn12Ac, Mn12Ac, negative control.

Manganese‐12 acetate (Mn12Ac) inhibited the migration and invasion of MCF7 and MDA‐MB‐231 breast cancer cells. (a) Transwell assay analysis of the abilities on the tumor cell migration. (b) Transwell assay analysis of the abilities on the tumor cell invasion. (c,d) Cell Counting Kit‐8 assay analysis of the abilities on the tumor cell proliferation of (c) MCF7 and (d) MDA‐MB‐231. MCF7, MDA‐MB‐231, NC, Mn12Ac, Mn12Ac, negative control.

Mn12Ac significantly inhibited the EMT of MCF7 and MDA‐MB‐231 breast cancer cells

EMT is activated and plays important roles in tumor metastasis; therefore, we explored whether Mn12Ac affected the EMT process of breast cancer cells. The results showed that Mn12Ac significantly upregulated the epithelial marker E‐cadherin, and downregulated the mesenchymal markers N‐cadherin and vimentin in MCF7 and MDA‐MB‐231 cells by real‐time PCR assay (Fig 2a–c). We further found that in protein level, Mn12Ac also significantly upregulated E‐cadherin, and reduced the expressions of N‐cadherin and Vimentin by western blotting assay (Fig 2d).
Figure 2

Manganese‐12 acetate (Mn12Ac) inhibited the epithelial–mesenchymal transition. (a–c). mRNA expressions of epithelial–mesenchymal transition markers using Real‐time PCR assay. (d). Protein expressions of epithelial–mesenchymal transition markers using Western blotting assay. MCF7, MDA‐MB‐231. GAPDH, glyceraldehyde 3‐phosphate dehydrogenase; NC, negative control.

Manganese‐12 acetate (Mn12Ac) inhibited the epithelial–mesenchymal transition. (a–c). mRNA expressions of epithelial–mesenchymal transition markers using Real‐time PCR assay. (d). Protein expressions of epithelial–mesenchymal transition markers using Western blotting assay. MCF7, MDA‐MB‐231. GAPDH, glyceraldehyde 3‐phosphate dehydrogenase; NC, negative control.

Mn12Ac significantly inhibited the EMT‐associated transcription factors in MCF7 and MDA‐MB‐231 breast cancer cells

Snail, slug, twist1, and ZEB1 are the EMT‐associated transcription factors in cancer.12, 13, 14 Therefore, we want to know whether Mn12Ac regulated the EMT by affecting these transcription factors. Using real‐time PCR, we revealed that Mn12Ac significantly decreased the mRNA expressions of snail, slug, twist1, and ZEB1 in MCF7 and MDA‐MB‐231 cancer cells (Fig 3a–d). These results suggested that Mn12Ac inhibited the EMT of breast cancer cells by downregulating EMT‐inducing transcription factors.
Figure 3

Manganese‐12 acetate (Mn12Ac) reduced the epithelial–mesenchymal transition associated transcription factors. MCF7, MDA‐MB‐231. GAPDH, glyceraldehyde 3‐phosphate dehydrogenase; NC, negative control.

Manganese‐12 acetate (Mn12Ac) reduced the epithelial–mesenchymal transition associated transcription factors. MCF7, MDA‐MB‐231. GAPDH, glyceraldehyde 3‐phosphate dehydrogenase; NC, negative control.

Mn12Ac significantly inhibited the Wnt/β‐catenin and PI3K/AKT signaling pathways

Wnt/β‐catenin and PI3K/AKT signaling pathways play important roles in the regulation of EMT,15, 16, 17 and we predicted that Mn12Ac might inhibit the EMT of breast cancer cells through regulating these two pathways. Using western blotting assay, we found that Mn12Ac significantly reduced the expressions of Wnt1 and β‐catenin (Fig 4a). Mn12Ac could also inhibit the phosphorylation of PI3K and AKT in MCF7 and MDA‐MB‐231 breast cancer cells (Fig 4b).
Figure 4

Manganese‐12 acetate (Mn12Ac) inhibited the Wnt/β‐catenin and PI3K/AKT signaling pathways, and decreased the programmed cell death ligand 1 (PD‐L1) expression. (a) Protein expressions of Wnt1 and β‐catenin were accessed by western blotting analysis. (b) Phosphorylation of PI3K and AKT were accessed by western blotting analysis. (c) Protein expression of PD‐L1 was accessed by western blotting assay. (d) mRNA expression of PD‐L1 was accessed by real‐time PCR assay. MCF7, MDA‐MB‐231. NC, negative control.

Manganese‐12 acetate (Mn12Ac) inhibited the Wnt/β‐catenin and PI3K/AKT signaling pathways, and decreased the programmed cell death ligand 1 (PD‐L1) expression. (a) Protein expressions of Wnt1 and β‐catenin were accessed by western blotting analysis. (b) Phosphorylation of PI3K and AKT were accessed by western blotting analysis. (c) Protein expression of PD‐L1 was accessed by western blotting assay. (d) mRNA expression of PD‐L1 was accessed by real‐time PCR assay. MCF7, MDA‐MB‐231. NC, negative control.

Mn12Ac decreased the expression of PD‐L1 both in mRNA and protein levels

PD‐1/PD‐L1‐targeted immunotherapy has emerged as a promising therapeutic strategy for breast cancer, and PD‐L1 expression was associated with EMT transition in breast cancer.18 Therefore, we explored whether Mn12Ac affected the PD‐L1 in breast cancer. Very interestingly, the results showed that Mn12Ac could reduce the mRNA and protein expression levels of PD‐L1 in MCF7 and MDA‐MB‐231 breast cancer cells by real‐time PCR and western blotting assay (Fig 4c,d).

Discussion

Breast cancer is the most common malignancy and the leading cause of cancer‐related death among women worldwide.19 Women aged from 20 to 59 years are most likely to be afflicted by breast cancer, and the age of onset has reduced in recent years and has been a public health problem.20 Cancer cell migration and invasion is a necessary step for metastatic dissemination that leads to rapid relapse and a poor prognosis in breast cancer patients. Development of a novel and effective treatment method to inhibit tumor metastasis is urgently required. Wnt/β‐catenin and PI3K/AKT signaling pathways play important roles in regulating the EMT process in the carcinogenesis. In the present study, we found that Mn12Ac could reduce the protein expressions of Wnt1 and β‐catenin, and inhibit the phosphorylation of PI3K and AKT in MCF7 and MDA‐MB‐231 breast cancer cells. Lu et al. reported that L1, L5, and VLDL could promote breast cancer progression and metastasis through Akt‐induced EMT.21 Leptin was reported to promote the breast cancer cells EMT by activating the PI3K/AKT signaling pathway.22 miR‐564 could directly target the AKT2 and inhibit the PI3K/AKT pathway, and further inhibit the EMT process, proliferation, and invasion of breast cancer.23 Xie et al. found that FYN was transcriptionally regulated by FOXO1, and mediated FGF2‐induced EMT through both the PI3K/AKT and ERK signaling pathways.24 Harper et al. found that Her2+ disseminated cancer cells could activate the Wnt‐dependent EMT‐like dissemination program, but without complete loss of the epithelial phenotype, and this effect could be reversed by Her2 or Wnt inhibition.25 Overexpression of DACT2 induced breast cancer cell apoptosis, and further inhibited breast tumor cell proliferation, migration, and EMT, by suppressing the Wnt/β‐catenin signaling pathway.26 The present results further suggested that Mn12Ac might develop as a therapeutic drug in breast cancer treatment. Mechanically, in our results, the phosphorylation of PI3K and AKT was inhibited by Mn12Ac. Previous studies reported that BRD4, FTO, and MACC1 could positively regulate the phosphorylation of PI3K and AKT, and miR‐200a and miR‐200b could negatively regulate the levels of p‐PI3K and p‐AKT.27, 28, 29, 30 Whether Mn12Ac inhibited the phosphorylation of PI3K and AKT by regulating the above genes or other downstream genes should be the subject of future studies. Programmed death‐1 (PD‐1)/programmed cell death ligand 1 (PD‐L1) were identified as negative immunoregulatory molecules that promoted immune evasion of tumor cells.31 The interaction of PD‐1 and PD‐L1 inhibited the function of T cells while increasing the function of immunosuppressive regulatory T cells. Very interestingly, the present results found that Mn12Ac could significantly reduce the expression of PD‐L1 both in mRNA and protein expression levels in breast cancer cells. Taken together, our results showed that Mn12Ac could significantly inhibit the migration, invasion, and EMT of breast cancer cells by suppressing the Wnt/β‐catenin and PI3K/AKT signaling pathways, and Mn12Ac could also reduce the expression of PD‐L1. However, the direct target of Mn12Ac is still unknown. In future studies, we will further explore the mechanism underlying the suppression of Mn12Ac on the migration, invasion, and EMT of breast cancer cells, and further identify the target of Mn12Ac.

Disclosure

No authors report any conflict of interest.
  29 in total

1.  Epithelial-mesenchymal transition: Untangling EMT's functions.

Authors:  Sarah Seton-Rogers
Journal:  Nat Rev Cancer       Date:  2015-11-27       Impact factor: 60.716

2.  Nuclear spin dynamics in the quantum regime of a single-molecule magnet.

Authors:  A Morello; O N Bakharev; H B Brom; R Sessoli; L J de Jongh
Journal:  Phys Rev Lett       Date:  2004-11-04       Impact factor: 9.161

3.  European cancer mortality predictions for the year 2015: does lung cancer have the highest death rate in EU women?

Authors:  M Malvezzi; P Bertuccio; T Rosso; M Rota; F Levi; C La Vecchia; E Negri
Journal:  Ann Oncol       Date:  2015-01-26       Impact factor: 32.976

4.  MiR-200a and miR-200b target PTEN to regulate the endometrial cancer cell growth in vitro.

Authors:  Qiang Wu; Ren-Lian Lu; Jing-Xiang Li; Li-Jun Rong
Journal:  Asian Pac J Trop Med       Date:  2017-05-17       Impact factor: 1.226

5.  Cancer incidence and mortality patterns in Europe: estimates for 40 countries in 2012.

Authors:  J Ferlay; E Steliarova-Foucher; J Lortet-Tieulent; S Rosso; J W W Coebergh; H Comber; D Forman; F Bray
Journal:  Eur J Cancer       Date:  2013-02-26       Impact factor: 9.162

6.  TRAP1 downregulation in human ovarian cancer enhances invasion and epithelial-mesenchymal transition.

Authors:  Maria R Amoroso; Danilo S Matassa; Ilenia Agliarulo; Rosario Avolio; Haonan Lu; Lorenza Sisinni; Giacomo Lettini; Hani Gabra; Matteo Landriscina; Franca Esposito
Journal:  Cell Death Dis       Date:  2016-12-15       Impact factor: 8.469

7.  DACT2 silencing by promoter CpG methylation disrupts its regulation of epithelial-to-mesenchymal transition and cytoskeleton reorganization in breast cancer cells.

Authors:  Tingxiu Xiang; Yichao Fan; Chunhong Li; Lili Li; Ying Ying; Junhao Mu; Weiyan Peng; Yixiao Feng; Michael Oberst; Kathleen Kelly; Guosheng Ren; Qian Tao
Journal:  Oncotarget       Date:  2016-10-25

8.  Combination of Endothelial-Monocyte-Activating Polypeptide-II with Temozolomide Suppress Malignant Biological Behaviors of Human Glioblastoma Stem Cells via miR-590-3p/MACC1 Inhibiting PI3K/AKT/mTOR Signal Pathway.

Authors:  Wei Zhou; Libo Liu; Yixue Xue; Jian Zheng; Xiaobai Liu; Jun Ma; Zhen Li; Yunhui Liu
Journal:  Front Mol Neurosci       Date:  2017-03-13       Impact factor: 5.639

9.  Splicing factor ratio as an index of epithelial-mesenchymal transition and tumor aggressiveness in breast cancer.

Authors:  Pietro Fici; Giulia Gallerani; Anne-Pierre Morel; Laura Mercatali; Toni Ibrahim; Emanuela Scarpi; Dino Amadori; Alain Puisieux; Michel Rigaud; Francesco Fabbri
Journal:  Oncotarget       Date:  2017-01-10

10.  Downregulation of BRD4 inhibits gallbladder cancer proliferation and metastasis and induces apoptosis via PI3K/AKT pathway.

Authors:  Jiaqi Hao; Ziyi Yang; Lei Wang; Yijian Zhang; Yijun Shu; Lin Jiang; Yunping Hu; Wenjie Lv; Ping Dong; Yingbin Liu
Journal:  Int J Oncol       Date:  2017-07-27       Impact factor: 5.650

View more
  3 in total

1.  Wnt/β-Catenin Participates in the Repair of Acute Respiratory Distress Syndrome-Associated Early Pulmonary Fibrosis via Mesenchymal Stem Cell Microvesicles.

Authors:  Xingcai Zhang; Lifang Ye; Wan Tang; Yiqin Ji; Li Zheng; Yijun Chen; Qidong Ge; Changshun Huang
Journal:  Drug Des Devel Ther       Date:  2022-01-19       Impact factor: 4.162

2.  microRNA-877-5p exerts tumor-suppressive functions in prostate cancer through repressing transcription of forkhead box M1.

Authors:  Bin Yang; Huifeng Diao; Pu Wang; Fengju Guan; Hechen Liu
Journal:  Bioengineered       Date:  2021-12       Impact factor: 3.269

3.  KIF18B promotes tumor progression through activating the Wnt/β-catenin pathway in cervical cancer.

Authors:  Yaqin Wu; Anpeng Wang; Biqing Zhu; Jian Huang; Emei Lu; Hanzi Xu; Wenjie Xia; Gaochao Dong; Feng Jiang; Lin Xu
Journal:  Onco Targets Ther       Date:  2018-03-28       Impact factor: 4.147

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.