Probiotic Lactobacillus sp. inhibit growth, biofilm formation and gene expression of caries-inducing Streptococcus mutans.

Streptococcus mutans contributes significantly to dental caries, which arises from homoeostasic imbalance between host and microbiota. We hypothesized that Lactobacillus sp. inhibits growth, biofilm formation and gene expression of Streptococcus mutans. Antibacterial (agar diffusion method) and antibiofilm (crystal violet assay) characteristics of probiotic Lactobacillus sp. against Streptococcus mutans (ATCC 25175) were evaluated. We investigated whether Lactobacillus casei (ATCC 393), Lactobacillus reuteri (ATCC 23272), Lactobacillus plantarum (ATCC 14917) or Lactobacillus salivarius (ATCC 11741) inhibit expression of Streptococcus mutans genes involved in biofilm formation, quorum sensing or stress survival using quantitative real-time polymerase chain reaction (qPCR). Growth changes (OD600) in the presence of pH-neutralized, catalase-treated or trypsin-treated Lactobacillus sp. supernatants were assessed to identify roles of organic acids, peroxides and bacteriocin. Susceptibility testing indicated antibacterial (pH-dependent) and antibiofilm activities of Lactobacillus sp. against Streptococcus mutans. Scanning electron microscopy revealed reduction in microcolony formation and exopolysaccharide structural changes. Of the oral normal flora, L. salivarius exhibited the highest antibiofilm and peroxide-dependent antimicrobial activities. All biofilm-forming cells treated with Lactobacillus sp. supernatants showed reduced expression of genes involved in exopolysaccharide production, acid tolerance and quorum sensing. Thus, Lactobacillus sp. can inhibit tooth decay by limiting growth and virulence properties of Streptococcus mutans.

Introduction

Dental caries is a common chronic oral disease that can affect the health of adults and children 1. A number of studies demonstrated correlations between poor oral health and heart diseases 2, 3. Dental caries is an endogenous disease that results from homoeostatic imbalance between the host and microbiota 4. The shift of non‐pathogenic micro‐organism from commensalism to parasitism resulted from changes in the oral environment due to poor hygiene, smoking, systemic diseases and decrease in saliva flow 1, 5. Streptococcus mutans has been identified as a main contributor to dental caries 6.

The oral cariogenic biofilm formation occurs through phases that start by early colonization of pellicle by non‐mutans Streptococci. This phase creates a favourable area for the growth of Streptococcus mutans and initial biofilm formation 7. Streptococcus mutans possesses virulence factors that contribute to caries formation such as:

Production of acid that damages dental hard tissues 8;

An agmatine deiminase system and F‐ATPase encoded by the aguBDAC operon 9 and atpD gene 10, which are major components in acid‐adaptive response that contribute to the aciduric characteristics.

The ability to synthesize exopolysaccharides (EPS) from sucrose by the action of multiple glucosyltransferases (Gtfs) encoded by the genes gtfb, gtfc, gtfd, in addition to fructosyltransferase encoded by sacB (ftf) gene. The glucosyltransferase and fructosyltransferase enzymes catalyse the synthesis of extracellular glucan and fructan polymers from sucrose, respectively 11. The EPS formed is thought to play dual roles in promoting microbial adherence to surface in addition to protecting embedded bacteria 12. These virulence factors work under the control of quorum‐sensing systems. The two‐component signal transduction systems (TCSTS), including comCDE and vicRKX, are among the regulatory networks that regulate gene expression in response to stimuli from the surrounding environment and are thus essential for bacterial survival and virulence modulation 13, 14.

Caries management strategies include the use of conventional physical removal of plaque and the reduction of bacterial population by chlorhexidine. Other interventions include maintaining the oral ecosystem by probiotics 15. Probiotic bacteria are live micro‐organisms that can confer health benefits to the host when administered in sufficient amounts 16. Most probiotics are Gram‐positive bacteria that belong to the genera Lactobacillus or Bifidobacterium 17.

Lactobacilli (LB) constitute part of the oral microbiota and can be linked to the oral health status of the individual 18. They comprise about 1% of the cultivable oral microbiota. The most common LB strains isolated from oral microbiota include L. casei, L. paracasei, L. plantarum, L. rhamnosus, L. fermentum, L. acidophilus and L. salivarius 19. Isolated LB strains from subjects without dental caries have a significantly increased capacity to inhibit the growth of Streptococcus mutans compared with the strains isolated from subjects with active caries. Thus, probiotic LB does have a therapeutic anticaries potential 20, 21, 22. Stamatova and Meurman 23.

There could be universal mechanisms by which probiotics impact oral pathogens. Generally, probiotics are believed to compete with pathogens for space and nutrients but have mostly unknown mechanisms of action. These may include impacts on the production of lactic acid, peroxide or bacteriocin in addition to possible immunomodulatory activities 24. We hypothesized that Lactobacillus sp. inhibits the growth, biofilm formation and gene expression of Streptococcus mutans. We then studied the mechanisms by which the probiotic Lactobacillus sp. antagonizes Streptococcus mutans.

Materials and methods

Bacterial strains, media and growth conditions

Four Lactobacillus sp. namely: Lactobacillus casei subspecies casei (ATCC 393), Lactobacillus reuteri (ATCC 23272), Lactobacillus plantarum subspecies plantarum (ATCC 14917) and Lactobacillus salivarius (ATCC 11741) were selected to study their effect on Streptococcus mutans (ATCC 25175) isolated from carious dentine. Lactobacillus sp. and Streptococcus mutans were cultured in deMan, Rogosa and Sharpe (MRS) and brain–heart infusion (BHI) media (Oxoid, Hampshire, Thermo Fisher Scientific, UK), respectively, at 37°C under anaerobic conditions using Oxoid Anaerogen® sachets (Thermo Fisher Scientific, UK).

Preparation of spent culture supernatant (SCS)

The spent culture supernatant (SCS) for each Lactobacillus sp. strain was prepared according to Lin et al. 25, and then the supernatant was filtered using 0.45‐μm filters (Millipore, Bedford, MA, USA). The supernatant was divided into four portions. One portion was left untreated, and the other three portions were treated to eliminate the effect of organic acids, hydrogen peroxide and bacteriocin. The effect of organic acid was neutralized by adjusting the pH of SCS to 6.5 with 1 N NaOH. The other two portions were treated with 1 mg/ml trypsin (Sigma‐Aldrich, USA) and 0.5 mg/ml catalase (Sigma‐Aldrich, C1345, USA) to eliminate the effect of bacteriocin and hydrogen peroxide, respectively 26. Treated and untreated supernatants were stored at −20°C.

The agar diffusion method for antimicrobial screening of Lactobacillus sp

The antibacterial activity of Lactobacillus sp. on Streptococcus mutans was assessed using an agar diffusion method adapted from the one used by Cadirci and Citak 27. Streptococcus mutans was incubated in Brain–Heart Infusion (BHI) at 37°C for 24 hrs. Melted BHI agar medium held at 45°C was inoculated with Streptococcus mutans at a concentration equivalent to McFarland 0.5 standard (1.5 × 108 CFU/ml). Wells of 7 mm diameter were filled by 100 μl of SCS. Inhibition zones were measured in millimetres after incubating the plates anaerobically at 37°C for 24 hrs. The same test was performed using Lactobacillus sp. whole bacterial culture (WBC) instead of SCS, with a turbidity equivalent to McFarland 0.5.

Antibacterial testing of treated and untreated SCS

To determine the antibacterial activity of the SCS, Streptococcus mutans was grown overnight at 37°C in BHI broth. The Streptococcus mutans culture was diluted with BHI broth medium to a turbidity equivalent to McFarland 0.5 (1.5 × 108 cells/ml). Then, 100 μl of the Streptococcus mutans suspension and 100 μl of untreated supernatants were added to the wells of 96‐well microtitre plate in eight replicates for each Lactobacillus SCS (Greiner Bio‐One, KremsmÜnster, Austria). The plates were then incubated anaerobically at 37°C for 24 hrs. In control wells, the SCS was replaced by sterile MRS broth. The OD600 nm was recorded after incubation using microplate reader (Stat Fax®2100) 28. The same steps were repeated with treated supernatants to determine the change in antimicrobial activity after removing the effect of acidic pH, peroxides and bacteriocin.

The effect of Lactobacillus sp. SCS on Streptococcus mutans adherence

This test was performed in a similar manner as the antimicrobial test using BHI medium supplemented with 0.2% sucrose. After incubation, supernatants were removed, plates were stained, and reduction in biofilm formation was evaluated by crystal violet assay as previously described 29.

The effect of Lactobacillus sp. SCS on Streptococcus mutans preformed biofilm

An overnight culture of Streptococcus mutans was diluted to McFarland 0.5 in BHI supplemented with 0.2% sucrose. This culture was distributed in the 96‐well microtitre plate by the volume of 100 μl and incubated at 37°C for 24 hrs. Culture supernatant was removed, and wells were washed with sterile saline. A volume of 100 μl of untreated supernatant was added in each well and incubated at 37°C for 24 hrs. Reduction in biofilm formation was determined as previously described 29.

Scanning electron microscopy (SEM) observation of dual‐Streptococcus mutans–Lactobacillus sp. biofilm

Streptococcus mutans and Lactobacillus sp. were cocultured overnight at 37°C in BHI and MRS broth respectively followed by dilution to a concentration equivalent to McFarland 0.5. A clean sterile cover slide was added to the wells of the six‐well plate (Greiner Bio‐One, KremsmÜnster, Austria). In each well, 250 μl of the Streptococcus mutans suspension and 250 μl of one of the Lactobacillus sp. suspension were added to 1.5 ml of BHI broth (supplemented with 0.2% sucrose) and incubated anaerobically at 37°C for 24 hrs.

A monospecies culture of Streptococcus mutans biofilm was similarly prepared except that we replaced the Lactobacillus sp. culture with uncultured MRS medium. Cover slides were gently washed with phosphate‐buffered saline (PBS) once, fixed and prepared for SEM observation (JSM‐7600F, JEOL) according to a previously published protocol 30.

Extraction of total bacterial RNA

We studied the effect of Lactobacillus sp. filtered supernatant on Streptococcus mutans in the planktonic form and the biofilm form. Streptococcus mutans was grown overnight at 37°C in BHI broth and was diluted to McFarland 0.5. A volume of 250 μl Streptococcus mutans suspension and 250 μl of the SCS were added to 1.5 ml of BHI broth and were incubated anaerobically at 37°C for 24 hrs. In control wells, the Lactobacillus sp. supernatant was replaced by MRS broth 25. After incubation, culture suspension was removed from wells for RNA extraction from planktonic bacteria. Cells adhering to the plate wells were washed twice by sterile saline and then dislodged and suspended in saline by scraping into a centrifuge tube. The total RNA was isolated from Streptococcus mutans planktonic and adherent cells using Direct‐Zol RNA MiniPrep kit (Zymo Research, CA, USA) according to the manufacturer's instructions. The remaining DNA in RNA samples was treated by RNase‐free DNase I (New England Biolab, MA, USA) to eliminate DNA contamination. Agarose gel electrophoresis of RNA samples verified its integrity. RNA concentration and purity were determined by the ND‐1000 spectrophotometer (NanoDrop Technology; Wilmington, DE, USA). Finally, the SensiFast™ cDNA synthesis kit (Bioline, MA, USA) was used to reverse transcribe 1 μg of total RNA sample into cDNA.

Quantitative real‐time polymerase chain reaction (qRT‐PCR) and data analysis

Using qPCR, we examined the effect of Lactobacillus sp. spent supernatant on the expression levels of ten target genes [gtfb, gtfc, gtfd, sacB, comC, comD, vick, vicR, aguD and atpD] involved in glucan production, fructan production, quorum sensing and acid tolerance in Streptococcus mutans. The primers used for amplification of comC, comD and sacB (ftf) genes were designed using the complete genome sequence of Streptococcus mutans ATCC 25175 obtained from the NCBI database (GenBank accession no. PRJNA179256) and used as the base for primer design. Primers for the qPCR used in the current study (Table 1) were synthesized by Invitrogen (Massachusetts, USA). Quantitative real‐time reverse transcription polymerase chain reaction (qRT‐PCR) was performed by Applied Biosystems StepOne™ Instrument using SensiFast™ SYBR Hi‐Rox Master (Bioline, Massachusetts. USA). All reactions (20 μl) were performed using three technical replicates. Each reaction mixture contained 100 ng cDNA and 400 nM primers per reaction. The RT‐PCR cycling conditions were as follows: one cycle with 95°C for 2 min.; then 40 cycles of denaturation at 95°C for 5 sec., annealing at 52–62°C (depending on primers used) for 10 sec., and extension and fluorescent data collection at 72°C for 20 sec. A dissociation curve was generated at the end of each reaction. In all qPCR runs, negative controls without template were run in parallel. The 16s rRNA gene (housekeeping gene) was selected as the internal control based on the results of BestKeeper® software tool 31. The relative mRNA levels of genes of interest were determined and normalized to the expression of the housekeeping gene using the ∆∆CT value analysis 32. The qPCR data were expressed as the fold change in expression levels of genes in Streptococcus mutans ATCC 25175 cells exposed to SCS of the four tested Lactobacillus sp. as compared to their levels in the untreated cells (calibrators). The changes in gene expression were tested in the Streptococcus mutans cells in the planktonic form and the biofilm‐forming state.

Table 1

List of oligonucleotide sequences, their annealing temperature and amplicon size

Target genea	Oligonucleotide sequence 5′–3′	Ta (°C)	Amplicon size (bp)	References
gtfb	For. ACGAACTTTGCCGTTATTGTCA Rev. AGCAATGCAGCCAATCTACAA	52	96	74
gtfc	For. CTCAACCAACCGCCACTGTT Rev. GGTTTAACGTCAAAATTAGCTGTATTAG	52	136	74
gtfd	For. TGTCTTGGTGGCCAGATAAAC Rev. GAACGGTTTGTGCAGCAAGG	62	132	74
sacB (ftf)	For. CCTGCGACTTCATTACGATTGGTC Rev. ATTGGCGAACGGCGACTTACTC	62	103	This study
comC	For. TATCATTGGCGGAAGCGGAA Rev. TCCCCAAAGCTTGTGTAAAACT	56	74	This study
comD	For. CGCGATTGGAGCCTTTAG Rev. CCTGAAATTCAGTTAGCCTTT	52	133	This study
vicK	For. CACTTTACGCATTCGTTTTGCC Rev. CGTTCTTCTTTTTCCTGTTCGGTC	56	102	65
vicR	For. CGCAGTGGCTGAGGAAAATG Rev. ACCTGTGTGTGTCGCTAAGTGATG	56	157	65
aguD	For. ATCCCGTGAGTGATAGTATTTG Rev. CAAGCCACCAACAAGTAAGG	56	80	63
atpD	For. CGTGCTCTCTCGCCTGAAATAG Rev. ACTCACGATAACGCTGCAAGAC	62	85	63
16s rRNAb	For. CCTACGGGAGGCAGCAGTAG Rev. CAACAGAGCTTTACGATCCGAAA	52	101	75

Ta: annealing temperature.

gtfb, encoding glucosyltransferase I; gtfC, glucosyltransferase SI; gtfD, glucosyltransferase S; sacB(ftf), encoding levansucrase enzyme (fructosyltransferase); comC, competence stimulating peptide; comD, Putative histidine kinase of the competence regulon; vicK, Putative histidine kinase CovS VicK‐like protein; vicR, Putative response regulator CovR VicR‐like protein; aguD, Agmatine: putrescine antiporter; atpD, F‐ATPase beta‐subunit; 16s rRNA, 16s ribosomal RNA gene sequence.

16s gene was used as an internal control.

Immunomodulatory effect of probiotic Lactobacillus sp

Human peripheral blood mononuclear cells (hPBMCs) from healthy volunteers were treated with SCS of Lactobacillus sp. as previously described by Wu et al. 30. The concentrations of IFN‐γ and IL‐10 were determined using enzyme‐linked immunosorbent assay (ELISA) according to the manufacturer's instructions (CUSABIO, BIOTECH CO, USA). A written consent was obtained from each subject. The protocol was approved by the Ethics Committee of the Faculty of Pharmacy, October University for Modern Sciences and Arts.

Statistics

Experimental results were analysed for statistical significance using GraphPad Prism (GraphPad, San Diego, CA, USA). A one‐way analysis of variance (ANOVA) was performed. Data comparisons were performed using either Dunnett's multiple comparison test or Tukey's multiple comparison test.

Results

Agar diffusion assay

The zone of inhibition produced by whole bacterial culture (WBC) (concentration 1.5 × 108 cells/ml) was larger than that produced by spent culture supernatant (SCS) produced by equivalent concentration of cells. This indicates the higher antimicrobial effect of WBC as compared to the cell‐free filtered supernatant. According to the zone of inhibition diameter, the highest antimicrobial activities of Lactobacillus sp. were observed with L. casei and L. reuteri, whereas the lowest antimicrobial activities were observed with L. plantarum and L. salivarius (Table 2).

Table 2

Antimicrobial effect of Lactobacillus sp. whole bacterial culture and filtered supernatant on the growth of Streptococcus mutans

Strain	Zone of inhibitiona (mm)
	Whole bacterial culture (WBC)b	Spent culture supernatant (SCS)b
Lactobacillus casei	23 ± 1	18 ± 1
Lactobacillus reuteri	23 ± 3	18 ± 2
Lactobacillus plantarum	19 ± 1	14 ± 1
Lactobacillus salivarius	19 ± 2	14 ± 1

The values are arithmetic means ± S.D. of inhibition zones (mm).

All results were significantly different from control (P < 0.01).

Antimicrobial effect of treated and untreated Lactobacillus sp. supernatant against Streptococcus mutans

The untreated supernatants of the four Lactobacillus sp. showed strong significant inhibitory effect (Fig. 1) on the growth of Streptococcus mutans (P < 0.01). There was no significant difference in the potency of the inhibitory effect between the four samples (P > 0.05). After neutralizing the supernatant acidity, the antimicrobial effect was significantly reduced (P < 0.01) compared with untreated supernatant, yet still showing significant reduction (P < 0.05) in Streptococcus mutans growth (Fig. 2A, B, C and D). Lactobacillus salivarius was the only tested strain that showed significant reduction (P < 0.05) in its antimicrobial effect on Streptococcus mutans after addition of catalase (Fig. 2D) indicating that peroxides contribute in its antimicrobial effect against Streptococcus mutans.

Figure 1

Streptococcus mutans growth in the presence of untreated Lactobacillus sp. supernatant. Optical density (OD) of Streptococcus mutans growth in the presence of untreated Lactobacillus sp. supernatants (L. casei, L. reuteri, L. plantarum and L. salivarius). Control: Streptococcus mutans growth in BHI broth. Untreated: spent culture supernatant (SCS). Data are expressed as the mean ± S.D., ***P < 0.01 compared with Streptococcus mutans growth in BHI broth as control (Dunnett's multiple comparison test).

Figure 2

Streptococcus mutans growth in the presence of treated and untreated Lactobacillus sp. supernatant. Optical density (OD) of Streptococcus mutans growth in the presence of treated and untreated Lactobacillus sp. supernatants (L. casei, L. reuteri, L. plantarum and L. salivarius). Control: Streptococcus mutans grown in BHI broth. Untreated: Spent Culture Supernatant (SCS) of each strain supernatant, pH treated: supernatant with adjusted pH 6.5, catalase treated: supernatant after addition of 0.5 mg/ml catalase enzyme and trypsin treated: supernatant after addition of 1 mg/ml trypsin enzyme. Data are expressed as the mean ± S.D., **P < 0.05 and ***P < 0.01 compared with Streptococcus mutans grown in BHI broth as control (Tukey's multiple comparison test).

Effect of Lactobacillus sp. filtered supernatants on Streptococcus mutans adherence and preformed biofilm

Lactobacillus salivarius supernatant caused significant reduction (P < 0.01) in Streptococcus mutans adherence and preformed biofilm. Reduction percentages were 87% and 47%, respectively. The effect of L. casei supernatant was the least among tested supernatants on adherence as it showed no significant effect on the preformed biofilm. The L. plantarum and L. reuteri supernatant caused reduction in adherence with percentages of 81.7–80.5% and reduction in preformed biofilm with percentage of 26.5–24.7% (Fig. 3).

Figure 3

Effect of untreated supernatant on Streptococcus mutans (A) Effect of untreated supernatant on Streptococcus mutans adherence. (B) Effect of untreated supernatant on Streptococcus mutans preformed biofilm Optical density (OD 545 nm) of Streptococcus mutans biofilm in the presence of untreated Lactobacillus sp. supernatants (L. casei, L. reuteri, L. plantarum and L. salivarius). Control: Streptococcus mutans grown in BHI broth. Data are expressed as the mean ± S.D. **P < 0.05, ***P < 0.01 compared with control (Dunnett's multiple comparison test).

Scanning electron microscope

As shown in Figure 4, the Streptococcus mutans appeared to form a compact, island‐like biofilm covered by large amounts of slime or network‐like structures. Changes in exopolysaccharides (EPS) matrix structure and quantity were observed in biofilm formed by coculture of Streptococcus mutans and different Lactobacillus sp. strains. Moreover, we observed fewer bacteria and smaller microcolonies attached to the surface.

Figure 4

Scanning electron microscopy (SEM) of the biofilms. Streptococcus mutans was cocultured with Lactobacillus sp. as compared to Streptococcus mutans monoculture. The resulting biofilms were observed by SEM at 12,000× magnification.

Analysis of qPCR results

We used qPCR to evaluate and compare the impact on Streptococcus mutans ATCC 25175 cells after exposure to four Lactobacillus sp. SCS (diluted 1:8 in BHI) overnight. The levels of expression of ten genes, that have been previously shown to be involved in virulence of the S. mutans in the planktonic and biofilm‐forming cells, were compared to the control untreated cells prepared under the same conditions without tested SCS. The selected genes included four genes involved in the two‐component signal transduction systems (TCSTS) [comC, comD, vicK, vicR], four genes involved in EPS formation [three of which are involved in glucan formation (gtfB, gtfC and gtfD), one gene is involved in fructan formation (sacB (ftf))], and two genes associated with stress survival (aguD, and atpD).

As revealed by the one‐way ANOVA, there was an overall significant reduction (P < 0.01) in the expression of most of the tested genes among the different groups, in both planktonic forms and biofilm‐forming cells. Dunnett's multiple comparison test was used to assess the significance of the difference between gene expression levels in target genes of exposed and control groups. As shown in Figure 5, few genes showed no significant difference (P > 0.01) in expression as compared to the control under certain conditions. These genes are comC and gtfD in planktonic cells exposed to L. plantarum SCS, gtfC gene in planktonic cells exposed to L. salivarius SCS, and comC gene in the biofilm‐forming cells exposed to L. reuteri SCS.

Figure 5

Alterations in gene expression profiles associated with exposure of Streptococcus mutans (ATCC 25175), in (A) planktonic form and (B) biofilm‐forming state, to the tested Spent culture supernatant (SCS) of Lactobacillus casei (ATCC 393), Lactobacillus reuteri (ATCC 23272), Lactobacillus plantarum (ATCC 14917) and Lactobacillus salivarius (ATCC 11741) as determined by qPCR. In each panel, fold change refers to the mean levels of gene expression across replicates, calculated using the ΔΔCt method relative to untreated control. Fold change = 2−ΔΔCt. Fold change (>1) indicates up‐regulation, (<1) indicates down‐regulation and fold change (~1) means insignificant change. Asterisks indicate statistically significant differences in the expression of each gene between treated samples and control, as analysed using the one‐way ANOVA with Dunnett's post‐testing for multiple testing (*P ≤ 0.01; ns, no significant difference). Error bars indicate standard deviation

The effect of SCS of different Lactobacillus sp. was variable on all tested TCSTS system genes. L. salivarius supernatant caused up‐regulation of the vicK gene by threefold to 21‐fold, in the planktonic and adherent cell forms, respectively. In planktonic cells, the expression of the comC gene, coding for competence‐stimulating peptide, was up‐regulated in the presence of L. salivarius supernatant only. Up‐regulation of the same gene was observed in biofilm‐forming cells treated with L. casei, L. plantarum and L. salivarius. The comD gene, coding for cognate histidine kinase receptor, was up‐regulated in the planktonic cells exposed to SCS of tested Lactobacillus sp. except for L. casei. On the other hand, it was down‐regulated in biofilm‐forming cells except those exposed to L. salivarius supernatant.

Significant reduction in gene expression of glucan (gtfB, gtfC, gtfD) and fructan (sacB) forming genes was observed in the adherent Streptococcus mutans cells in the presence of all tested SCS. The effects of the same supernatants were variable on the planktonic cells, as they showed significant up‐regulation (P < 0.01) in gtfB and gtfC genes in the following cases: high up‐regulation in gene expression levels in presence of the supernatants of L. casei (30‐fold change in gtfB gene expression), and L. plantarum (20‐fold and 17‐fold change in gtfB and gtfC gene expression, respectively); moderate up‐regulation in gene expression of gtfB and gtfC genes in the presence of L. reuteri (2.5‐fold) supernatant. Significant up‐regulation (P < 0.01) of the gtfD gene was observed in the presence of L. salivarius supernatant (15‐fold). Similarly, significant up‐regulation of the sacB (ftf) gene (2.5‐fold) was observed in the presence of L. reuteri supernatant.

Stress response genes (atpD and aguD) were down‐regulated in biofilm‐forming cells in the presence of all tested SCS. In planktonic forms, these two genes showed significant reduction (P < 0.01) in expression except in two cases: The first is the atpD gene in the presence of L. plantarum and L. salivarius supernatants, and second is the aguD gene in the presence of Lactobacillus casei.

Immunomodulatory activities of Lactobacillus sp

The SCS of Lactobacillus sp. was incubated with hPBMCs isolated from healthy volunteers for 48 hrs. The production levels of the immunostimulatory IFN‐γ and immunoregulatory IL‐10 cytokines were measured by ELISA. All Lactobacillus sp. standard strains stimulated hPBMCs to produce IFN‐γ higher than untreated controls. In contrast, IL‐10 concentrations were reduced after treating hPBMC with Lactobacillus sp. supernatants (Table 3).

Table 3

Effect of filtered Lactobacillus supernatant on interferon‐γ (IFN‐γ) production and interleukin‐10 (IL‐10) production in human peripheral blood mononuclear cells (hPBMCs) using enzyme‐linked immunosorbent assay (ELISA)

Sample	Cytokine concentration (pg/ml)a
	IFN‐γ Mean ± S.D.	IL‐10 Mean ± S.D.
Control	15 ± 1	78 ± 1
L. casei	23.1 ± 0.5	63.5 ± 0.4
L. reuteri	31.2 ± 0.3	51.4 ± 0.5
L. plantarum	54.2 ± 0.5	27.3 ± 0.64
L. salivarius	49.3 ± 0.4	38.7 ± 0.6

All results showed significant difference from control (P < 0.01).

Discussion

Dental caries is one of the most common diseases worldwide. The oral microbiota is composed of over 700 bacterial taxa 33. Under certain conditions, bacteria like Streptococcus mutans can be pathogenic and cause dental caries. Streptococcus mutans is a major contributor to dental caries development due to its virulence factors including the ability to synthesize extracellular polysaccharide and the ability to produce acidic metabolites 8.

Lactobacillus sp. constitute a main constituent of the microbiota in our oral cavity 34. Lactobacillus sp. probiotics have been proven to be efficient in treating certain gastrointestinal disorders 35. Lactobacillus sp. probiotics could possibly control dental caries using similar mechanisms that can play against Streptococcus mutans invasion strategies 8. This is because Lactobacillus sp. were shown to be able to produce organic acids, hydrogen peroxide, bacteriocins and adhesion inhibitors 36.

The Lactobacillus sp. used in this study were L. casei subspecies casei (ATCC 393), L. reuteri (ATCC 23272), L. plantarum subsp. Plantarum (ATCC 14917) and L. salivarius (ATCC 11741). These strains were chosen because they caused reduction in dental caries in previous studies including: Lactobacillus casei 37, 38, Lactobacillus reuteri 39, 40, 41, Lactobacillus plantarum 42 and Lactobacillus salivarius 43, 44. The precise mechanisms by which this happens are still unclear. Thus, the aim of the study was to assess mechanisms by which Lactobacillus sp. can control dental caries. We tested the effect of these four Lactobacillus sp. on the growth, adherence, biofilm formation and gene expression of Streptococcus mutans (ATCC 25175), in addition to the immunomodulatory effect.

The antimicrobial screening of the four tested strains of Lactobacillus using the agar diffusion method revealed differences in antimicrobial activity between different strains as determined by the size of the zone of inhibition. The highest effect was detected by L. casei, and L. reuteri, followed by L. salivarius and L. plantarum. Lactobacillus WBC caused higher antimicrobial effect on Streptococcus mutans than their corresponding SCS of the same Lactobacillus species. The difference in zone of inhibition caused by WBC compared to SCS may suggest that the presence of living metabolically active Lactobacillus sp. cells in WBC could result in the production of active antimicrobial agents in response to stimuli 45. The tested Lactobacillus sp. strains caused significant reduction in the microbial growth of Streptococcus mutans in BHI broth, as determined by the change in OD 600. At the same time, there was no significant difference between different Lactobacillus species regardless of their metabolic pattern. Strict homofermentative organisms such as Lactobacillus salivarius, facultative heterofermentative organisms such as Lactobactobacillus casei and Lactobacillus plantarum, and obligate heterofermentative organisms such as Lactobacillus reuteri showed similar antimicrobial effects.

To determine the effect of organic acids, hydrogen peroxide and bacteriocin produced by tested Lactobacillus sp., their effect was demolished by neutralization, catalase and trypsin addition, respectively. Neutralization of SCS to pH 6.5 significantly reduced the antimicrobial effect of the tested SCS. The low pH is an important factor for growth inhibition, and it is important for the production of bacteriocin 46. Streptococcus mutans is an acidogenic bacteria, that is produce organic acid as end product for sugar fermentation, and it is an aciduric bacteria, that is can tolerate acid in the plaque environment, hence, it can survive under acidic conditions 47. The acid tolerance genes, such as atpD and aguD genes, allow Streptococcus mutans to carry out metabolic processes at low‐pH values 48. The observed reduction in gene expression of atpD, aguD, in Streptococcus mutans, can decrease its acid tolerance, which can lead to bacteriostasis and eventual death 49. Anticaries agents such as the natural compounds α‐mangostin and catechin epigallocatechin gallate can down‐regulate the atpD and aguD genes 10, 50.

It was observed that neutralized SCS caused lower reduction in microbial growth than untreated SCS, but yet neutralized supernatant still showed significant reduction in Streptococcus mutans growth when compared to control. This suggests the influence of other antimicrobial agents such as hydrogen peroxide, bacteriocin, 51 and biosurfactant 52 that contribute with acid to growth inhibition.

Some Lactobacillus sp. have the ability to produce hydrogen peroxide, which can be toxic to organisms lacking hydrogen peroxide‐scavenging enzymes such as Streptococcus mutans 53. Adding catalase to Lactobacillus sp. supernatant caused reduction in the antimicrobial effect against Streptococcus mutans, but the significant reduction was observed only with Lactobacillus salivarius (ATCC 11741). This indicates that hydrogen peroxide contribution in antimicrobial activity of the tested Lactobacillus sp. is low except for L. salivarius supernatant.

Streptococcus mutans has been shown to initiate a response to various adverse environmental stressors, including oxidative stress, and acidic pH, by actively producing competence‐stimulating peptide (CSP) encoded by the comC gene 54. In our study, the expression of the comC was up‐regulated in biofilm‐forming cells compared with the untreated control. This was in contrast to comD which was down‐regulated in biofilm‐forming cells treated with L. casei, L. reuteri or L. plantarum. The antimicrobial testing of L. salivarius supernatant on Streptococcus mutans demonstrated the influence of supernatant pH and peroxide in the antimicrobial activity. Thus, the production of these stress factors by this strain might explain the significant up‐regulation in comC and comD genes in both the planktonic and biofilm‐forming Streptococcus mutans cells treated with this supernatant. Biofilm formed of Streptococcus mutans having single mutation in comC, comD and comE, or the triple mutation of comCDE showed different biofilm architecture in comparison with the wild‐type strain 55. This might explain the difference in biofilm formed by the coculture of Streptococcus mutans and Lactobacillus sp. as observed by SEM due to difference in comCDE expression.

Lactobacillus sp. can produce bacteriocin or bacteriocin‐like polypeptides that have a small molecular weight of <10 kD. In our study, trypsin‐treated supernatant showed no significant difference from the untreated SCS on Streptococcus mutans growth. This result indicates the low production of bacteriocin by Lactobacillus sp. This may not be the only explanation though because bacteriocin production by Lactobacillus sp. has been reported in several previous studies carried on L. casei 56, L. reuteri 57, L. plantarum 58 and L. salivarius 59.

Streptococcus mutans contributing to dental caries usually exists in the biofilm form inside the oral cavity. EPS of Streptococcus mutans contribute to dental caries by helping develop an oral biofilm in addition to forming a barrier against chemical agents. Therefore, therapeutic agents that target the biofilm can be the most suitable for dental caries prevention.

The cariogenic properties of Streptococcus mutans biofilms are regulated by various essential genes 60. Thus, the expression of representative biofilm‐associated genes was investigated. The genes studied included genes for sucrose‐dependent adhesion such as gtfb, gtfC 52 and sacB (ftf) 60. It also included two systems for controlling biofilms: (i) The vicRKX operon regulating the expression of virulence‐associated genes responsible for regulating the synthesis of polysaccharides, including gtfBCD, sacB, and polysaccharide‐binding sites as gbpB 61, (ii) comCDE quorum‐sensing system 48. In addition, it included genes for synthesis of insoluble glucan (gtfB, gtfC), soluble glucan (gtfD) 62 and fructan polymers (sacB) 61. Finally, it included genes responsible for acid tolerance (aguD and atpD) 63, 64.

The SCS of the four tested Lactobacillus sp. caused reduction in Streptococcus mutans biofilm with variable degrees. The highest reduction observed was with the supernatants of L. salivarius (87% for Streptococcus mutans adherence, and 47% for Streptococcus mutans preformed biofilm). The vicR gene was down‐regulated in planktonic forms and biofilm‐forming Streptococcus mutans exposed to all tested SCS. On the other hand, the vicK gene was down‐regulated upon the exposure of Streptococcus mutans to L. casei and L. reuteri supernatants. This down‐regulation might explain the reduction in Streptococcus mutans adherence and preformed biofilm as demonstrated by the SEM results. The vicKRX system has a significant influence on biofilm formation, and the null mutation in the vicK and vicR genes can cause aberrant biofilms which are easily removed 65. The vicRKX system regulates the glucosyltransferase‐encoding genes, and thus, mutation in this system can cause a significant decrease in gtfD gene expression, as well as increased expression of the gtfB gene 66. Changes in the gtfB and gtfD gene expressions, due to a mutated vicRKX system, were observed in planktonic Streptococcus mutans in the presence of L. casei, L. reuteri and L. plantarum supernatants, which caused a reduction in both vicK and vicR genes. In biofilm‐forming cells, both gtfB and gtfD genes were down‐regulated in the presence of all tested Lactobacillus sp. despite reduction in vicK and vicR genes. This could be attributed to the influence of factors other than vicKRX on the gtf genes such as: luxS (AI‐2 autoinducer‐coding synthesis), ropA (encoding for the trigger factor) and RegM (the catabolite‐repression regulator in Streptococcus mutans) 67, in addition to biosurfactants produced by Lactobacillus sp. which could reduce gtfB, gtfC and gtfD expressions in Streptococcus mutans 68.

Gtf genes that code for glucosyltransferase enzyme are primary virulence factors for Streptococcus mutans and thus can be a selective drug target for prevention of cariogenic biofilms. The Lactobacillus sp. supernatant‐induced altered gene expression indicates a promising anticaries effect. In vitro studies indicated that gtfB and gtfC were essential for the sucrose‐dependent attachment of Streptococcus mutans cells to hard surfaces and for microcolonies formation, but gtfD was not essential 52. In the biofilm‐forming bacteria, the expression of the three glucosyltransferase genes (gtfB, gtfC and gtfD) and the fructosyltransferase genes sacB (ftf) showed significant down‐regulation as compared to the control group of untreated biofilm‐forming cells. Glucosyltransferase S, encoded by gtfB, synthesizes insoluble glucan 67 and allows cell clustering 69. Thus, mutant Streptococcus mutans strains, defective in gtfB, are less cariogenic than their parent strains 70. The disruption of insoluble glucans synthesis can induce a reduction in biofilm formation, which can influence the pathogenesis 63. Thus, the gtfB expression reduction could explain the highest antibiofilm effect produced by L. salivarius on Streptococcus mutans adherence (87% reduction) and on preformed biofilm (47% reduction). The promising results of L. salivarius supernatant on Streptococcus mutans biofilms may indicate its possible anticaries effect. Thus, restoring the oral microenvironment with L. salivarius might be effective in preventing the colonization of periodontopathic bacteria 30. The difference in expression of gtfB and gtfC genes, in our study, indicates that there is no common promoter for them. Ullrich reported the potential presence of independent promoters for both genes 71. Low‐pH value increases the expression of the gtfBC gene but reduces sacB gene expression, which can lead to high‐biomass biofilms 48. The reduced Streptococcus mutans adherence and EPS formation in presence of SCS of L. casei, L. reuteri and L. plantarum despite the up‐regulation in the expression of the gtfb genes could be attributed to reduction in enzymatic function rather than reduction in gene expression 63.

The effect of Lactobacillus sp. on the production of IL‐10 and IFN‐γ was studied. IL‐10 is an immunosuppressive cytokine that is normally up‐regulated in inflamed pulp by bacterial infection to prevent the spread of inflammation 72. In our study, all tested Lactobacillus sp. supernatants inhibited IL‐10 production. To the best of our knowledge, this is the first study to show reduced IL‐10 production in response to Lactobacillus sp. This warrants further investigation. IFN‐γ is a pro‐inflammatory cytokine that synergizes with TNFα in increasing the microbicidal capacity of macrophages 73. The tested Lactobacillus sp. induced higher levels of IFN‐γ which can signify more robust innate and potentially adaptive immune responses at the site of infection.

The study showed that Lactobacillus sp. can inhibit tooth decay and control dental caries. This possible anticaries effect could be attributed to: (i) the inhibitory effect on Streptococcus mutans growth which were mainly due to organic acid generation and peroxide production; (ii) reduction in cell adherence and preformed biofilm; (iii) down‐regulation in several Streptococcus mutans virulence genes including acid tolerance genes (atpD and aguD genes), EPS‐producing genes (gtfBCD and sacB) and quorum‐sensing genes (vicKR and comCD); (iv) immunomodulatory effect due to the induction of IFN‐γ production and inhibition of IL‐10 production.

Author contributions

Dr. Reham Wasfi, Dr. Ola A. Abd El‐Rahman, Dr. Mai M. Zafer and Dr. Hossam M. Ashour contributed to the design of the study, performance of experiments, analysis of the results and writing of the manuscript.

Conflict of interest

The authors declare no competing financial interests.