Literature DB >> 29312244

Quantitative Analysis of Cellular Proteome Alterations in CDV-Infected Mink Lung Epithelial Cells.

Mingwei Tong1, Li Yi1, Na Sun1, Yuening Cheng1, Zhigang Cao1, Jianke Wang1, Shuang Li1, Peng Lin1, Yaru Sun1, Shipeng Cheng1.   

Abstract

Canine distemper virus (CDV), a paramyxovirus, causes a severe highly contagious lethal disease in carnivores, such as mink. Mink lung epithelial cells (Mv.1.Lu cells) are sensitive to CDV infection and are homologous to the natural host system of mink. The current study analyzed the response of Mv.1.Lu cells to CDV infection by iTRAQ combined with LC-MS/MS. In total, 151 and 369 differentially expressed proteins (DEPs) were markedly up-regulated or down-regulated, respectively. Thirteen DEPs were validated via real-time RT-PCR or western blot analysis. Network and KEGG pathway analyses revealed several regulated proteins associated with the NF-κB signaling pathway. Further validation was performed by western blot analysis and immunofluorescence assay, which demonstrated that different CDV strains induced NF-κB P65 phosphorylation and nuclear translocation. Moreover, the results provided interesting information that some identified DEPs possibly associated with the pathogenesis and the immune response upon CDV infection. This study is the first overview of the responses to CDV infection in Mv.1.Lu cells, and the findings will help to analyze further aspects of the molecular mechanisms involved in viral pathogenesis and the immune responses upon CDV infection.

Entities:  

Keywords:  Canine distemper virus (CDV); Isobaric tags for relative and absolute quantitation (iTRAQ); Mink lung epithelial cells (Mv.1.Lu cells); NF-κB signaling; proteomics

Year:  2017        PMID: 29312244      PMCID: PMC5743685          DOI: 10.3389/fmicb.2017.02564

Source DB:  PubMed          Journal:  Front Microbiol        ISSN: 1664-302X            Impact factor:   5.640


Introduction

Canine distemper virus (CDV), a negative-sense, single-stranded RNA virus, belonging to the genus Morbillivirus, family Paramyxoviridae, causes a severe highly contagious lethal disease in carnivores, such as dogs, lions, ferrets, raccoon dogs, foxes, and minks (Williams et al., 1988; Deem et al., 2000; Martella et al., 2010; Zhao et al., 2010; Viana et al., 2015). The disease is distributed worldwide and is characterized by respiratory and gastrointestinal tract symptoms with generalized immunosuppression (Blancou, 2004; Decaro et al., 2004). The immune system dysfunction of CDV infection favors opportunistic secondary pathogens, resulting in high morbidity and mortality in a wide range of carnivore species (Appel et al., 1982; Kauffman et al., 1982; Blixenkrone-Moller, 1989). Generally, in domestic dogs, CDV establishes a systemic infection, initiating transmission from immune cells, such as alveolar macrophages and/or dendritic cells, of the upper respiratory tract to the local lymphatic tissues by immune-mediated progression, and ultimately propagates to most organs and tissues, including epithelial tissues via cell-associated viremia (Appel et al., 1982). Epithelial cells are susceptible to CDV infection and play a role in transmission during the late stages of CDV pathogenesis (Pratakpiriya et al., 2012; Noyce et al., 2013). The virus is amplified and secreted from the epithelial cells of the respiratory, gastrointestinal, and urinary systems of the infected host (Ludlow et al., 2014). The infection of various viruses has been demonstrated to interact widely with numerous host cell proteins. Some interactions elicit changes in the host proteome, as illustrated by the capacity of the virus to both induce and evade the host immune response (Kash et al., 2006), effecting autophagy and apoptosis (Ludwig et al., 2006; Gunnage and Munz, 2009). For measles virus (MV), another morbillivirus closely similar to CDV, cell cycle arrest in lymphocytes (Naniche et al., 1999) and apoptosis in T lymphocytes (FugierVivier et al., 1997) have also been reported. Many studies have reported the effects of CDV infections on the host cell proteins, such as inhibiting STAT1 and STAT2 nuclear import (Rothlisberger et al., 2010), inducing cytokine responses in PBMCs (Nielsen et al., 2009), and inducing lymphocytes apoptosis (Kumagai et al., 2004). However, most of these reports have primarily investigated a single host cell protein or partially selected proteins and the mechanisms of CDV pathogenesis and immunomodulation have not been fully elucidated. Thus, a new approach for further understanding the pathogenic mechanism and immunomodulation of CDV infection is needed, and the identification of global host cell proteins that interact with CDV infection represents one option. More details associated with host responses to CDV infection should also shed some light on potential targets for antiviral agents. For decades, proteomic assays have been applied as significant tools to analyze the interaction of host responses to viral infection. Investigation of the changes in the proteome upon virus infection is becoming an effective instrument for providing potential targets for antiviral research. This approach has revealed the specific insights into the cellular mechanisms involved in viral pathogenesis for several viral pathogens, including transmissible gastroenteritis virus (TGEV) (An et al., 2014), human influenza A (Vester et al., 2009), canine parvovirus (CPV) (Zhao et al., 2016), marek's disease virus (MDV) (Chien et al., 2012) and infectious bronchitis virus (IBV) (Emmott et al., 2010). Isobaric tags for relative and absolute quantification (iTRAQ) combined with LC–MS/MS analysis have emerged as a powerful quantitative proteomic technique, which has been used for various virus-host interaction studies (Zhang et al., 2009; Liu et al., 2013; Luo et al., 2014). The present study is the first global view of the changes in the mink proteome upon CDV infection. Based on iTRAQ combined with LC–MS/MS, a quantitative proteomic analysis was performed to identify differentially expressed proteins (DEPs) in mink lung epithelial cells (Mv.1.Lu cells) infected with CDV at 24 hours post infection (hpi). These findings will help to analyze further aspects of the molecular mechanisms involved in viral pathogenesis and systematically understand the host immune responses challenged by CDV infection.

Materials and methods

Cell culture and virus infection

Mink lung epithelial cells (Mv.1.Lu cells) were purchased from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China) and grown in Minimum Essential Medium (Gibco ®Invitrogen, U.S.A.), supplemented with 10% fetal bovine serum (Invitrogen) at 37°C and 5% CO2. The canine distemper virus strain CDV-PS (GenBank accession no. JN896331), a low passage isolate (<7 passages) from a morbid dog in 2013 (Yi et al., 2013), was preserved in our laboratory. The virus was propagated in Vero cells. In the study, three additional passages of the virus were performed in Mv.1.Lu cells, resulting in the virus suspension with a titer of 103.1 TCID50/mL determined by a 50% tissue culture infectious dose (TCID50) assay (Yamaguchi et al., 1988). Briefly, monolayers of Mv.1.Lu cells in 96-well plates were infected with a 10-fold serial dilution of the supernatant fluids and further incubated for up to 120 h. The wells were assessed for cytopathic effects (CPE) after 3–5 days, and the TCID50 was calculated using the Reed-Muench formula. Because of the low virus titer and the impurity of the virus suspension, virus concentration and purification were performed to improve the virus titer and avoid the effect of non-viral components. The clarified suspension was concentrated by polyethylene glycol 6,000 precipitation and purified by ultracentrifugation in a gradient of sucrose according to standard procedures. Sucrose-purified viruses were then titrated using the TCID50 assay as described above, and the titer of the virus stocks increased to 106.9 TCID50/mL. The attenuated CDV vaccine CDV3 strain was treated the same as PS. The virus stocks were aliquoted and stored at −80°C until further use in the following experiments. For the establishment of viral kinetics, Mv.1.Lu cells were grown in 6-well plates and subsequently challenged by the virus (PS) at a multiplicity of infection (MOI) of 2, calculated based on the infectious virus particle concentration determined as TCID50. At 6, 12, 24, 36, 48, 60, and 72 hpi, viral propagation was confirmed by observation of the CPE and viral replication and production of PS nucleoprotein for the different time points analyzed was tested by anti-CDV NP antibody. The one-step growth curve, indicating the viral load with the time, was generated according to Chuzo ushimi with slight modifications (Ushimi et al., 1972). Briefly, 200 μL of culture medium was collected at indicated time, followed by the extraction of total RNA from all samples. qRT-PCR was then applied to detect the viral RNA at each indicated time. For iTRAQ labeling, Mv.1.Lu cells were grown in T75 flasks to 70–80% confluence and subsequently infected with the virus (PS) at an MOI of 2. As an uninfected control, a mock-infection was performed. The cells were collected at 24 hpi for the protein extraction. Three biological replicates were prepared for all samples. All experiments were performed under Biosafety Level 2 conditions.

Protein isolation, digestion, and labeling with iTRAQ reagents

The collected cells were lysed in lysis buffer containing a protease inhibitor cocktail. The lysate was sonicated and centrifuged at 14,000 g for 40 min, and the supernatant was quantified with the BCA Protein Assay Kit (Bio-Rad, U.S.A.). Subsequently, 200 μg of protein for each sample was digested with 4 μg of trypsin (Promega, WI) overnight at 37°C. According to the protocol of the iTRAQ reagents (8 plex, Applied Biosystems), 100 μg of peptide mixture from each sample was labeled follows: the three mock-infected samples were each labeled with iTRAQ 113, 114, or 115, and the three PS-infected samples were labeled with iTRAQ 116, 117, or 118. The labeled samples were then mixed and dried with a rotary vacuum concentrator.

Peptide fractionation and LC-MS/MS analysis

To reduce the complexity of the peptide mixtures, iTRAQ-labeled peptides were fractionated by SCX chromatography using the AKTA Purifier system (GE Healthcare). Briefly, the dried peptide mixture was reconstituted and acidified with buffer A (10 mM KH2PO4 in 25% of ACN, pH 3.0) and loaded onto a PolySULFOETHYL 4.6 × 100 mm column (5 μm, 200 Å, PolyLC Inc., U.S.A.). The peptides were eluted at a flow rate of 1 mL/min with a gradient of buffer B (500 mM KCl, 10 mM KH2PO4 in 25% of ACN, pH 3.0). The elution was monitored by absorbance at 214 nm, and fractions were collected every 1 min. A total of 15 fractions were collected with screening, and then desalted on C18 Cartridges (Empore™ SPE Cartridges C18 (standard density), bed I.D. 7 mm, volume 3 mL) and concentrated by vacuum centrifugation. Each fraction was injected for nanoLC-MS/MS analysis. The peptide mixture was loaded onto a reverse phase trap column (Thermo Scientific Acclaim PepMap100, 100 μm*2 cm, nanoViper C18) connected to the C18-reversed phase analytical column (Thermo Scientific Easy Column, 10 cm long, 75 μm inner diameter, 3 μm resin) in buffer A (0.1% Formic acid) and separated with a linear gradient of buffer B (84% acetonitrile and 0.1% Formic acid) at a flow rate of 300 nL/min controlled by IntelliFlow technology. The LC-MS/MS analysis was performed on a Q Exactive mass spectrometer (ThermoFisher, U.S.A.) coupled to the Easy nLC chromatography system (ThermoFisher, U.S.A.). The mass spectrometer was operated in positive ion mode. MS data was acquired using a data-dependent top 10 method, dynamically selecting the most abundant precursor ions from the survey scan (300–1,800 m/z) for HCD fragmentation. The automatic gain control (AGC) target was set to 3e6, and the maximum inject time was set to 10 ms. Dynamic exclusion duration was 40.0 s. Survey scans were acquired at a resolution of 70,000 at m/z 200 and resolution for HCD spectra was set to 17,500 at m/z 200, and the isolation width was 2 m/z. Normalized collision energy was 30 eV and the underfill ratio, which specifies the minimum percentage of the target value likely to be reached at maximum fill time, was defined as 0.1%. The instrument was run with the peptide recognition mode enabled.

Protein identification and quantification

All MS raw data files were analyzed by Proteome Discoverer software 1.4 (ThermoFisher, U.S.A.) using the Mascot 2.2 search engine against a database of mustela putorius furo protein sequences (NCBInr, released March 23, 2017, containing 38, 992 sequences). For protein identification, a mass tolerance of 0.1 Da was allowed for fragmented ions, with permission of two missed cleavages in the trypsin digests: iTRAQ8-plex (Y), oxidation (M) as the potential variable modifications, and carbamidomethyl (C), iTRAQ8-plex (N-term), and iTRAQ8-plex (K) as fixed modifications. The strict maximum parsimony principle was performed, and only peptide spectra with high or medium confidence were considered for protein grouping. A decoy database search strategy was also used to estimate the false discovery rate (FDR) to ensure the reliability of the proteins identified. For relative quantitation, proteins that involved at least one unique peptide were considered a highly confident identification and used for quantification. Additionally, to guarantee the accuracy of quantification, the proteins with coefficient of variation values <20% for three biological repeats were considered DEPs. The quantitative protein ratios were calculated and normalized by the median ratio in Mascot. For comparison, three identical mock samples, labeled with iTRAQ 113, 114, and 115, were used as references. Between samples, the proteins with fold-change ratios ≥1.20 or ≤0.83 and a p < 0.05 were considered DEPs according to the t-test.

Bioinformatics analysis

To further explore the impact of the DEP on cell physiological processes and discover internal relations between DEPs, an enrichment analysis was performed. GO enrichment on three ontologies [biological process (BP), molecular function (MF), and cellular component (CC)] was applied based on the Fisher's exact test, considering the whole quantified protein annotations as the background dataset. Benjamini–Hochberg correction for multiple testing was further applied to adjust derived p-values. Only functional categories with p-values under a threshold of 0.05 were considered significant. KEGG pathway annotation was extracted from the online KEGG PATHWAY Database (http://www.kegg.jp/kegg/pathway.html). The protein–protein interaction information involved in the immune response process of the studied proteins was subsequently retrieved from STRING software (http://string-db.org/). Then, the results were imported into Cytoscape5 software (http://www.cytoscape.org/, version 3.2.1) to visualize and further analyze functional protein-protein interaction networks.

Real-time RT-PCR

Total RNA was isolated using TRIzol Reagent (Invitrogen, U.S.A.) from Mv.1.Lu cells infected with 2 MOI PS or mock-infected cells at 12 and 24 hpi. After treatment with gDNA Removal (TransGen Biotech, China), 4 μg of each total RNA was used for cDNA synthesis. Real-Time RT-PCR (qRT-PCR) assays were performed on an Applied Biosystems® QuantStudio® 3 System (Thermo Fisher Scientific, U.S.A.) employing the TransStart Top Green qPCR SuperMix kit (TransGen Biotech, China) according to the manufacturer's protocol. The primers for amplifying TRAF6, TRAF2, IRAK4, IRAK2, NFκB2, CCL2, TNF-α, IL-6, and GAPDH are presented in Table 1. Each experiment was performed in triplicate. The relative gene expression was calculated using the 2−ΔΔCT model, which is representative of n-fold changes compared with mock-infected samples. The data was analyzed by two-way ANOVA followed by Duncan's test.
Table 1

Primers used for real-time RT-PCR.

NameAccession No.SpeciesPrimer sequence 5′-3′(Forward/Reverse)Product size (bp)
TRAF6XM_004756001FerretGAGAAACCCGTGGTCATT194
ATCGCAAGGCGTATTGTA
TRAF2XM_013058503FerretGACGTGACCTCGTCCTCTTTC192
CCTGACTCCCAACCTGACCC
IRAK4XM_013063025FerretTTCTTGCCCTGAGAACCA191
CTCCACTTTCCGATTTCC
IRAK2XM_004738517FerretCTCACCGAGTACAGGAGC162
GAACTGCATCCAGTCCC
NFκB2XM_004749394FerretTGAAGACCTTGCTGCTAAATG112
TCCAGGTTCTGTAAGGCTGTAT
IL-6EF368209FerretCAACTATGAGGGTAATAAGAAC194
GCTCCGTAGGATGAGGTGAA
CCL2HAAF01015359MinkGAGGCTGACGAGCTAT157
AGTTTGGTTCTGGGTTT
TNF-aGU327784MinkGCCGACGTGCCAATGCCCTCCTG223
TCCCTTTGGCAAGGGCTCTTGAT
GAPDHNM_001310173FerretGGTGCTGAGTATGTTGTGGAGT197
CAGTTGGTGGTACAGGAGGC
Primers used for real-time RT-PCR.

Western blot analysis

For testing the production of PS nucleoprotein for the different time points analyzed, cell lysates were harvested at 6, 12, 24, 36, 48, and 60 hpi from PS- and mock-infected samples. For confirmation of the iTRAQ-MS data by western blotting, cell lysates were harvested at 12 and 24 hpi from PS-, CDV3-, and mock- infected cultures. After measuring the protein concentrations, equivalent amounts of cellular proteins from the triplicates were separated by SDS-PAGE and electrophoretically transferred onto nitrocellulose PVDF membranes (Millipore, U.S.A.). The membranes were blocked with 2% BSA dissolved in TBS, containing 0.05% Tween-20, for 2 h at room temperature, followed by incubation with the corresponding primary antibodies (see below) at 4°C overnight and incubation with HRP-conjugated goat anti-rabbit or anti-mouse IgG secondary antibodies (Sangong Biotech, China) at room temperature for 2 h. The protein bands were detected using the ECL Detection Kit (Beyotime, China). The GAPDH protein was used as an internal control. The following primary polyclonal antibodies were used: anti-CDV NP mouse monoclonal antibody (prepared in our laboratory), NF-κB p65 (RelA) rabbit polyclonal antibody (AN365, Beyotime, China), NFκB1 p105 rabbit polyclonal antibody (4717, CST, U.S.A), NFκBIB (IκB-β) rabbit polyclonal antibody (PA5-40909, ThermoFisher, U.S.A), MHC-I mouse monoclonal antibody (ab23755, Abcam, UK), RPS29 rabbit polyclonal antibody (PA5-41744, ThermoFisher, U.S.A), IκB-α rabbit polyclonal antibody (4812, CST, U.S.A), Phospho-NF-κB p65 rabbit polyclonal antibody (MA5-15181, ThermoFisher, U.S.A), and GAPDH rabbit polyclonal antibody (CW0101M, CWBIO, China).

Immunofluorescence assay

Mv.1.Lu cells were cultivated on cover glasses in 24-well plates, followed by infection with PS or CDV3 at an MOI of 2 when the cells reached ~70% confluence. The mock-infected cells were treated with PBS as a negative control. Next, at 24 hpi, the cells were fixed with 4% paraformaldehyde and subsequently permeabilized with 0.1% Triton X-100. Further, the cells were incubated with an NF-κB P65 rabbit polyclonal antibody (Beyotime, China) and a mouse monoclonal antibody specific to CDV N protein and incubated with Cy3-labeled goat anti mouse IgG (Beyotime, China) and FITC-conjugated goat anti-rabbit IgG secondary antibody (ThermoFisher, U.S.A) prior to staining with DAPI. The fluorescent images were analyzed under confocal microscopy (Leica, Germany).

Results

Verification of PS replication in Mv.1.Lu cells

A previous study demonstrated the capacity of CDV growth in Mv.1.Lu cells (Lednicky et al., 2004), thus, we initially confirmed the ability of PS replication in Mv.1.Lu cells and established the growth kinetics of PS replication. An optimal time point under PS infection for proteomic analysis was then identified. As shown in Figure 1A, CPEs in the infection groups became visible at 24 hpi and progressed thereafter. Up to 36 hpi, an obvious CPE was observed and nearly 50 percent of the cells were detached at 48 hpi. The one-step growth curve revealed that the virus load reached a plateau of ~4.8 log10 copy numbers/μL between 24 and 60 hpi, followed by a gradual decline (Figure 1B). Collectively, 24 hpi was considered the optimal time-point for further proteomic analysis, at which a high viral load was maintained and most cells showed little CPE. Virus replication at 6 and 48 hpi was additionally ensured through RT-PCR. The abundance of the CDV-N gene increased as the infection progressed (Figure 1C). Further validation was performed by sequencing analysis of the PCR products (data not shown). Moreover, the production of nucleoprotein for the different time points analyzed was tested by anti-CDV NP antibody, the result showed quite similar tendency of the viral one-step growth curve (Figure 1D).
Figure 1

Confirmation of PS infection in Mv.1.Lu cells. (A) Photomicrographs of Mv.1.Lu cells infected with PS (MOI = 2) or mock-infected at different time-points. Images were taken at an original magnification of 20×. The CPEs of cells detachment at 24 hpi were pointed by the arrows. (B) One-step growth curve of CDV strain PS in Mv.1.Lu cells. (C) RT-PCR validation of PS infection in Mv.1.Lu cells by amplifying the CDV-N gene. (D) Western blot analysis of the nucleoprotein of PS in tested time points using anti-NP antibody.

Confirmation of PS infection in Mv.1.Lu cells. (A) Photomicrographs of Mv.1.Lu cells infected with PS (MOI = 2) or mock-infected at different time-points. Images were taken at an original magnification of 20×. The CPEs of cells detachment at 24 hpi were pointed by the arrows. (B) One-step growth curve of CDV strain PS in Mv.1.Lu cells. (C) RT-PCR validation of PS infection in Mv.1.Lu cells by amplifying the CDV-N gene. (D) Western blot analysis of the nucleoprotein of PS in tested time points using anti-NP antibody.

Identification of differentially expressed proteins in PS-infected Mv.1.Lu cells

The host response to PS infection at 24 hpi was analyzed by examining differences in protein expression. Based on a combination of three biological replicates from mock-infected and PS-infected samples, the iTRAQ-coupled LC–MS/MS analysis identified and measured a total of 37,145 peptides and 6184 proteins. The proteins were designated DEPs based on the following criteria: a p < 0.05 and fold-change ratios ≥1.2 or ≤0.833. Among all the DEPs, 151 and 369 proteins were markedly up-regulated or down-regulated, respectively. Partial DEPs are shown in Table 2 and more detailed information for all DEPs is collated in Table S1.
Table 2

Partial differentially expressed proteins in Mv.1.Lu cells infected with PS.

Accession No.GeneDescriptionLog2 ratios (infection/control)
gi|511835322C2orf78Chromosome 2 open reading frame 784.41
gi|511926358MHC-IMHC class I3.40
gi|511879956ALDHLA3Aldehyde dehydrogenase family 1, subfamily A33.09
gi|511896227CBLCCasitas B-lineage lymphoma c2.53
gi|470656855PPP4R4Protein phosphatase 4, regulatory subunit 42.30
gi|511911718VCAM1Vascular cell adhesion molecule 12.23
gi|410968650FMNL2Formin-like 22.23
gi|511858686IRAK4Interleukin-1 receptor-associated kinase 42.08
gi|511851258APOA1Apolipoprotein A-I2.03
gi|511858549TSPAN8Tetraspanin 82.00
gi|545550325PKMPyruvate kinase, muscle1.99
gi|511830126IGFBP3Insulin-like growth factor binding protein 31.98
gi|511841556AHSGalpha-2-HS-glycoprotein1.96
gi|512014297COL4A3Collagen, type IV, alpha 31.95
gi|390460231GPM6AGlycoprotein m6a1.95
gi|511845472CCL2Chemokine (C-C motif) ligand 21.95
gi|512003405CDR2Cerebellar degeneration-related 21.82
gi|297291910RPS29Ribosomal protein S291.80
gi|511836837FAM71CFamily with sequence similarity 71, member C1.73
gi|511894864FN1Fibronectin 11.73
gi|355716083RelAV-rel reticuloendotheliosis viral oncogene homolog A1.71
gi|511888661UGDHUDP-glucose 6-dehydrogenase1.70
gi|511829546HUS1Hus1 homolog1.57
gi|511902668DCLK1Doublecortin-like kinase 11.56
gi|472388445IRGM1immunity-related GTPase family M 1-like1.56
gi|511881226ENO3Enolase 3, beta muscle1.56
gi|403261872POU3F2POU domain, class 3, transcription factor 21.55
gi|472347817NINJ1Ninjurin 11.52
gi|511875241NSUN6NOP2/Sun domain family, member 61.52
gi|511910703KRT85Keratin 851.52
gi|511859527STX11Syntaxin 111.49
gi|511902130S100PS100 calcium binding protein P1.48
gi|511846797ABCA1ATP-binding cassette, sub-family A (ABC1), member 11.48
gi|6841210ABRACLcostars family ABRACL1.47
gi|511844818B4GALT5UDP-Gal: beta GlcNAc beta 1,4-galactosyltransferase, polypeptide 51.46
gi|511849816TACO1Translational activator of mitochondrially encoded cytochrome coxidase I1.44
gi|511898473RER1RER1 retention in endoplasmic reticulum 1 homolog1.43
gi|511903237MAN1A2annosidase, alpha, class 1A, member 21.43
gi|511908385SH3BP5SH3-domain binding protein 5 (BTK-associated)1.42
gi|511943416COMMD9COMM domain containing 91.42
gi|511898597TMEM68Transmembrane protein 681.42
gi|511849632APOHApolipoprotein H1.42
gi|545185645ARF1ADP-ribosylation factor 11.41
gi|511935026GBP6Guanylate binding protein family, member 61.41
gi|512011829EHD1EH-domain containing 11.41
gi|533173825PCP4Purkinje cell protein 41.40
gi|511837380GCATGlycine C-acetyltransferase1.40
gi|512004618NIT1Nitrilase 11.39
gi|511870449TRAF6tumor necrosis factor receptor-associated factor 61.39
gi|511895854SLC8A2Solute carrier family 8, member 21.38
gi|512006423REEP6Receptor accessory protein 61.38
gi|511916720UBE2L6Ubiquitin ISG15-conjugating enzyme E2L 61.37
gi|511833334USP48Ubiquitin specific peptidase 481.37
gi|13775200SF3B5Splicing factor 3b, subunit 51.36
gi|511848426TMCC3Transmembrane and coiled coil domains 31.36
gi|511983423ATP5DATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit1.35
gi|511921987RBM15DRNA binding motif protein 15B1.35
gi|511868041AP1G2Adaptor protein complex AP-1, gamma 2 subunit1.35
gi|511842841FAM49AFamily with sequence similarity 49, member A1.35
gi|511829942SEMA3CSema domain, immunoglobulin domain1.35
gi|511915046CTSKCathepsin K1.34
gi|511991226SMSSpermine synthase1.34
gi|511869470AEBP2AE binding protein 21.34
gi|511832998SFNStratifin1.33
gi|30584771TUBA4ATubulin, alpha 4a1.33
gi|511882364UNC13AUnc-13 homolog A1.33
gi|864509599IL-6Interleukin-61.33
gi|14210488DCTN5Dynactin 5 (p25)1.32
gi|511831346TNFAIP3Tumor necrosis factor, alpha-induced protein 31.32
gi|511916377CTSL2Cathepsin L21.32
gi|119590561HSPE1Heat shock 10 kDa protein 11.32
gi|511883864SUMF2Sulfatase modifying factor 21.32
gi|545527366NRBP1Nuclear receptor binding protein 11.32
gi|511869866ETV6Ets variant gene 6 (TEL oncogene)1.32
gi|511914585FAM83GFamily with sequence similarity 83, member G1.31
gi|355696495IRAK2Interleukin-1 receptor-associated kinase 21.31
gi|511904212DUS3lDihydrouridine synthase 3-like1.31
gi|511871618PPP1R12BProtein phosphatase 1, regulatory (inhibitor) subunit 12B1.30
gi|511901047C11orf68UPF0696 C11orf68 homolog1.30
gi|511906727CNP2′,3′-cyclic nucleotide 3' phosphodiesterase1.30
gi|13385318KDELR2KDEL endoplasmic reticulum protein retention receptor 21.30
gi|511834309BPGM2,3-bisphosphoglycerate mutase1.30
gi|511992880GGHGamma-glutamyl hydrolase1.30
gi|511825419PDLIM7PDZ and LIM domain 71.29
gi|511886519WLSWntless homolog (Drosophila)1.29
gi|511921959RAD54L2RAD54 like 2 (S. cerevisiae)1.29
gi|332856788PRMT1Protein arginine N-methyltransferase 11.28
gi|511910087LNPLimb and neural patterns1.28
gi|532072898POLR3HPolymerase (RNA) III (DNA directed) polypeptide H1.28
gi|511914328SAMD9lSterile alpha motif domain containing 9-like1.27
gi|511833014DHDDSDehydrodolichyl diphosphate synthase1.27
gi|511974382SERPINB2Serine (or cysteine) peptidase inhibitor, clade B, member 21.27
gi|355707086NFκB2Nuclear factor of kappa light polypeptide protein enhancer in B-cells 21.27
gi|511923803TNF-aTumor necrosis factor alpha1.27
gi|511841350PARLPresenilin associated, rhomboid-like1.27
gi|511862001FOXO3Forkhead box O31.27
gi|11345462SPCS3signal peptidase complex subunit 31.26
gi|511834349CEP41Centrosomal protein 41kDa1.26
gi|511857535HPS5Hermansky-Pudlak syndrome 51.26
gi|511876736PURGPurine-rich element binding protein G1.26
gi|511846480GLIPR2GLI pathogenesis-related 21.26
gi|511837127C12orf23UPF0444 transmembrane C12orf23 homolog1.26
gi|355707083NFκB1Nuclear factor of kappa light polypeptide protein enhancer in B-cells 11.26
gi|511827086FLNBFilamin, beta1.26
gi|511989679LPCAT1Lysophosphatidylcholine acyltransferase 11.26
gi|511876709MAK16MAK16 homolog (S. cerevisiae)1.25
gi|511909041CD2BP2CD2 antigen (cytoplasmic tail) binding protein 21.25
gi|511827872HMCESRIKEN cDNA 8430410A17 gene1.25
gi|511857770MICAL2Microtubule associated monoxygenase, calponin and LIM domain containing 21.25
gi|472384836HSPG2Heparan sulfate proteoglycan 21.25
gi|512007599CLCN7Chloride channel, voltage-sensitive 71.25
gi|511900977YIF1AYip1 interacting factor homolog A1.25
gi|472343859CD47CD47 antigen1.25
gi|511983624SCAMP4Secretory carrier membrane protein 41.25
gi|511876596WHSC1L1Wolf-Hirschhorn syndrome candidate 1-like 1 (human)1.25
gi|511850086SH3PXD2ASH3 and PX domains 2A1.25
gi|511936255TSTThiosulfate sulfurtransferase (rhodanese)1.25
gi|511911865PHF11PHD finger protein 111.25
gi|564300780TRIM33Tripartite motif-containing 331.22
gi|511902306TAPBPTAP binding protein (tapasin)1.24
gi|511882769MYO10Myosin X1.24
gi|511893223KANK1KN motif and ankyrin repeat domains 11.24
gi|511907397MYL6BMyosin, light polypeptide 6B1.24
gi|511883719TBL2Transducin (beta)-like 21.24
gi|511884480TOR3ATorsin family 3, member A1.23
gi|511873534TRAF2TNF receptor-associated factor 21.23
gi|555290040AK6Adenylate kinase isoenzyme 61.23
gi|511923928ANO9Anoctamin 91.23
gi|511902535COL12A1Collagen, type XII, alpha 11.23
gi|511887693RAB38RAB38, member of RAS oncogene family1.22
gi|511906384DHX8DEAH (Asp-Glu-Ala-His) box polypeptide 81.22
gi|488526784FCF1FCF1 small subunit (SSU) processome component homolog1.22
gi|511844820PTGISProstaglandin I2 (prostacyclin) synthase1.22
gi|432094860TUBA3ATubulin, alpha 3A1.22
gi|27369539RAP2CRAP2C, member of RAS oncogene family1.22
gi|511926986GSTK1Glutathione S-transferase kappa 11.22
gi|472384437GOLPH3Golgi phosphoprotein 31.21
gi|149017087RPRD1ARegulation of nuclear pre-mRNA domain containing 1A1.21
gi|511908773BCL2lL3BCL2-like 13 (apoptosis facilitator)1.21
gi|511841295ATP11BATPase, class VI, type 11B1.21
gi|511976077AKAP2Uncharacterized protein1.21
gi|544446238PRMT5Protein arginine N-methyltransferase 51.21
gi|511976770MNPP1Multiple inositol polyphosphate histidine phosphatase 11.20
gi|511960500P2RX4Purinergic receptor P2X, ligand-gated ion channel 41.20
gi|511875437TENM3Teneurin transmembrane protein 31.20
gi|511901261CDCA5Cell division cycle associated 51.20
gi|512002654TRABDTraB domain containing1.20
gi|511855781TRMT6tRNA methyltransferase 6 homolog (S. cerevisiae)1.20
gi|511839811E2F4E2F transcription factor 4, p107/p130-binding1.20
gi|511889285EEF1A1eukaryotic translation elongation factor 1 alpha 10.22
gi|511857546L-LDHL-lactate dehydrogenase0.25
gi|511861258RPH3ARabphilin 3A0.27
gi|511866746TDRD9Tudor domain containing 90.33
gi|511911235SMURF1SMAD specific E3 ubiquitin protein ligase 10.37
gi|511974128COL14A1Collagen, type XIV, alpha 10.38
gi|511869618MGPMatrix Gla protein0.39
gi|511836785GATA6GATA binding protein 60.4
gi|511837372SH3BP1SH3-domain binding protein 10.46
gi|511904960CLDN25Claudin 250.46
gi|512021328WWC3WWC family member 30.48
gi|511863285ACSF3acyl-CoA synthetase family member 30.49
gi|511976906CCNT2Cyclin T20.5
gi|511842520CTDP1CTD phosphatase, subunit 10.5
gi|511889359SULT1C2Sulfotransferase family, cytosolic, 1C, member 20.51
gi|511910161C1orf123Chromosome 1 open reading frame 1230.51
gi|7657315LSM3LSM3-like protein, U6 small nuclear RNA associated0.51
gi|511864485DTD1D-tyrosyl-tRNA deacylase 1 homolog (S. cerevisiae)0.52
gi|431906893KLF5Kruppel-like factor 50.52
gi|511849400NHE-RFNa(+)/H(+) exchange regulatory cofactor NHE-RF0.53
gi|257900516REEP1Receptor accessory protein 10.53
gi|472355383RASA2RAS p21 protein activator 20.54
gi|511898541SKISki sarcoma viral oncogene homolog (avian)0.54
gi|511890018CDK12Cyclin-dependent kinase 120.55
gi|511910134AGPSAlkylglycerone phosphate synthase0.56
gi|511883096PPICPeptidylprolyl isomerase C0.58
gi|511855302CDAN1Codanin 10.58
gi|511972404SMTNL2Smoothelin-like 20.59
gi|511845637TADA2ATranscriptional adaptor 2A0.59
gi|511922352EFEMP1EGF containing fibulin-like extracellular matrix protein 10.59
gi|511893959KIAA1671RIKEN cDNA 2900026A02 gene0.6
gi|511873494CLIC3Chloride intracellular channel 30.61
gi|511960748ZFP592Zinc finger protein 5920.61
gi|472387045PHPT1Phosphohistidine phosphatase 10.62
gi|511876643RAB11FIP1RAB11 family interacting protein 1 (class I)0.62
gi|472387045PHPT1Phosphohistidine phosphatase 10.62
gi|511903670MKL1Megakaryoblastic leukemia (translocation) 10.63
gi|511848742LRRC45Leucine rich repeat containing 450.65
gi|194211939CACNB3Calcium channel, voltage-dependent, beta 3 subunit0.66
gi|511923560INPP5JInositol polyphosphate 5-phosphatase J0.66
gi|511915011GABPB2GA binding protein transcription factor, beta subunit 20.66
gi|511875266DNAJC1DnaJ (Hsp40) homolog, subfamily C, member 10.67
gi|511836048LZTR1Leucine-zipper-like transcriptional regulator, 10.67
gi|511849384TMEM104Transmembrane protein 1040.67
gi|511838875WDSUB1WD repeat, sterile alpha motif and U-box domain containing 10.68
gi|555975747NSA2NSA2 ribosome biogenesis homolog (S. cerevisiae)0.68
gi|511870441PRR5LProline rich 5 like0.68
gi|511829768BCAP29B cell receptor associated protein 290.69
gi|511913605CCDC97Coiled-coil domain containing 970.69
gi|301766733FAM127AFAM127-like0.69
gi|511865423NDFIP2Nedd4 family interacting protein 20.69
gi|511881790CCDC51Coiled-coil domain containing 510.7
gi|511847011ALADAminolevulinate, delta-, dehydratase0.7
gi|511833880LZICLeucine zipper and CTNNBIP1 domain containing0.7
gi|511903211WARS2Tryptophanyl tRNA synthetase 2, mitochondrial0.7
gi|545881843AGAP3ArfGAP with GTPase domain, ankyrin repeat and PH domain 30.7
gi|511841170PDLIM4PDZ and LIM domain 40.71
gi|511913696BLVRBBiliverdin reductase B [flavin reductase (NADPH)]0.71
gi|511906284TMUB2Transmembrane and ubiquitin-like domain containing 20.71
gi|511876053ECHDC3Enoyl CoA hydratase domain containing 30.71
gi|512011090UPK3AUroplakin 3A0.71
gi|355707095NFκBIBNuclear factor of kappa light polypeptide protein enhancer in B-cells inhibitor, beta0.72
gi|511896151BLOC1S3Biogenesis of lysosome-related organelles complex 1 subunit 30.72
gi|73950021PTP4A2Protein tyrosine phosphatase 4a20.72
gi|511883659HSPB1Heat shock protein 10.73
gi|511826747CDH6Cadherin 6, type 2, K-cadherin (fetal kidney)0.74
gi|511854070RHBDF1Rhomboid 5 homolog 1 (Drosophila)0.74
gi|512011195LPPLIM domain containing preferred translocation partner in lipoma0.74
gi|511926830DPP7Dipeptidyl-peptidase 70.74
gi|511931993LRP8Low density lipoprotein receptor-related protein 80.75
gi|511862458MTRF1LMitochondrial translational release factor 1-like0.75
gi|511906536COASYbifunctional coenzyme A synthase isoform X30.75
gi|511890142SP2Sp2 transcription factor0.75
gi|511910713KRT7Keratin 70.75
gi|511887578TMEM126BTransmembrane protein 126B0.75
gi|281349685ZFAND5Zinc finger, AN1-type domain 50.75
gi|511853128SRRM2Serine/arginine repetitive matrix 20.75
gi|511986770BDH23-hydroxybutyrate dehydrogenase, type 20.76
gi|545501819TNRC6ATrinucleotide repeat containing 6a0.76
gi|511899033TSC22D3TSC22 domain family, member 30.76
gi|2286213GNAQGuanine nucleotide binding protein, alpha q polypeptide0.76
gi|511836121MROPL40Mitochondrial ribosomal protein L400.76
gi|511834186NDUFB10NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 30.76
gi|511830220PLA2G7Phospholipase A2, group VII0.76
gi|511896100CD3EAPCD3E antigen, epsilon polypeptide associated protein0.76
gi|511907610R3HDM2R3H domain containing 20.76
gi|511843304COL4A1Collagen, type IV, alpha 10.77
gi|511878807ELF1E74-like factor 10.77
gi|511918709UBQLN4Ubiquilin 40.77
gi|511890619SCFD1sec1 family domain-containing 20.78
gi|511830488CNPY3Canopy 3 homolog (zebrafish)0.78
gi|73965148ARF2ADP-ribosylation factor 20.78
gi|511909743ZBTB10Zinc finger and BTB domain containing 100.78
gi|511970268CD2APCD2-associated protein0.78
gi|511854253SLC12A6Solute carrier family 12, member 60.79
gi|511888766LIMCH1LIM and calponin homology domains 10.79
gi|511900684SLC16A1Solute carrier family 16, member 10.79
gi|511888312GPAMGlycerol-3-phosphate acyltransferase, mitochondrial0.79
gi|511951833PCM1Pericentriolar material 10.79
gi|511848172KANK2KN motif and ankyrin repeat domains 20.79
gi|511925038MRPS18BMitochondrial ribosomal protein S18B0.79
gi|511913714C19orf47RIKEN cDNA 2310022A10 gene0.79
gi|511943046HS1BP3HCLS1 binding protein 30.8
gi|511919532NSL1NSL1, MIND kinetochore complex component, homolog (S. cerevisiae)0.8
gi|511906743RABL3RAB, member of RAS oncogene family-like 30.8
gi|511831382REPS1RalBP1 associated Eps domain containing protein0.8
gi|511914923RFX5Regulatory factor X, 5 (influences HLA class II expression)0.8
gi|511837364GGA1Golgi-associated, gamma adaptin ear containing, ARF binding protein 10.8
gi|511845503RFFLRing finger and FYVE like domain containing protein0.8
gi|511839695CDH11Cadherin 11, type 2, OB-cadherin0.81
gi|511849128EVPLlEnvoplakin0.81
gi|511840215WWP2WW domain containing E3 ubiquitin protein ligase 20.81
gi|511866085CKBCreatine kinase, brain0.81
gi|532066199RPL10ARibosomal protein L10a0.81
gi|511853705CHTF18CTF18, chromosome transmission fidelity factor 180.81
gi|511829476FIGNL1Fidgetin-like 10.81
gi|511975646TFCP2Transcription factor CP20.81
gi|511856781CACUlCDK2 associated, cullin domain 10.82
gi|511868239JUBAjuba0.82
gi|32880141DNAJA1DnaJ homolog subfamily A member 10.82
gi|511885805STIM2Stromal interaction molecule 20.82
gi|511916124TCF12Transcription factor 120.82
gi|345786001NAA35N(alpha)-acetyltransferase 35, NatC auxiliary subunit0.82
gi|511897376ARHGEF17Rho guanine nucleotide exchange factor (GEF) 170.82
gi|511866734AHNAKAHNAK nucleoprotein isoform 10.83
gi|511856200KANK4KN motif and ankyrin repeat domains 40.83
gi|301762790ZFP148Zinc finger protein 1480.83
gi|511849083RHBPF2Rhomboid 5 homolog 2 (Drosophila)0.83
Partial differentially expressed proteins in Mv.1.Lu cells infected with PS.

Functional characterization of the DEPs

To characterize the biological functions of the 520 DEPs, canonical Gene Ontology (GO) enrichment were performed using DAVID (Dennis et al., 2003) and UniProt databases to obtain relevant annotations about the cellular components (CC), molecular functions (MF), and biological processes (BP). First, the putative subcellular localizations of the DEPs were analyzed. As depicted in Figure 2, a majority of the DEPs were mainly distributed in the nucleus (45.64%) and cytoplasm (20.09%), followed by extracellular space (10.50%), mitochondria (9.75%), and plasma membrane (9.72%), and a smaller portion were localized in the chloroplast (2.66%), lysosome (0.59%), Golgi (0.30%), cytoskeleton (0.30%), peroxidase (0.30%), and ER (0.15%) (more detailed information is collated in Table S2).
Figure 2

Subcellular localization of the DEPs in Mv.1.Lu cells infected with PS.

Subcellular localization of the DEPs in Mv.1.Lu cells infected with PS. Interestingly, the GO analysis showed that most proteins were assigned to functions involved in similar molecular functions and biological processes. As shown in Figure 3A, most DEPs were closely related to binding and catalytic activity when infected by PS infection (more detailed information is provided in Table S3). The BP annotation showed that DEPs associated with various biological processes, including cellular process, metabolic process, biological regulation, immune system process and process of response to stimulus (Figure 3B) (more detailed information is provided in Table S4). Collectively, these categories consisted of the following proteins: CCL2, IRAK4, UBE2L6, NFκB1, NFκB2, TNF-a, IRAK2, IL-6, TRAF6, APOA1, TNFAIP3, TRAF2, RelA, and VCAM1 (up-regulated proteins) and CCR7, CXCR7, SMURF1, NFκBIB, MAPK7, RBM15, IGF2, TSC1, and CD59 (down-regulated proteins). To further investigate the pathways involving the identified DEPs, KEGG pathway analysis was performed. According to the results, DEPs were mainly involved in the NF-κB and NOD-Like receptor (NLR) signaling pathways. In addition, several proteins could be mapped to apoptosis and specific disease associations, consisting of infectious and respiratory diseases (Figure 3C) (more detailed information is shown in Table S5).
Figure 3

Functional characterization of the up-regulated and down-regulated proteins. (A) Molecular function (GO-MF) analysis. (B) Biological process (GO-BP) analysis. (C) KEGG Pathway analysis.

Functional characterization of the up-regulated and down-regulated proteins. (A) Molecular function (GO-MF) analysis. (B) Biological process (GO-BP) analysis. (C) KEGG Pathway analysis.

Network analysis of the DEPs involved in immune response process

In the present study, we detected a total of 27 DEPs involved in the immune response process. To further investigate the interaction network associated with the immune response, these 27 proteins were imported into STRING software and further analyzed by Cytoscape5. As shown in Figure 4, 13 strongly interacting proteins were interestingly grouped into a functional set chiefly associated with the NF-κB signaling pathway. The interaction network provides clues for further illumination of the pathogenic mechanism and immunomodulation between CDV and the mink host.
Figure 4

Network Analysis of the DEPs involved in immune response process. Significantly up-regulation and down-regulation proteins are represented in red and green, respectively. Varying magnitudes of the protein expression change are indicated in the color depth. The lines with different thicknesses showed the molecular relationships with different degree.

Network Analysis of the DEPs involved in immune response process. Significantly up-regulation and down-regulation proteins are represented in red and green, respectively. Varying magnitudes of the protein expression change are indicated in the color depth. The lines with different thicknesses showed the molecular relationships with different degree.

Confirmation of the iTRAQ-MS data by western blotting or real-time RT-PCR

To confirm the iTRAQ-MS data, we selected significantly changed proteins, including NFκB1, RelA, MHC-I, RPS29, and NFκBIB, which reliably cross-reacted with polyclonal antibodies to the corresponding human proteins for western blotting analysis. As shown in Figure 5A, the five representative proteins showed up-regulated or down-regulated expression in PS-infected Mv.1.Lu cells at 12 and 24 hpi (the original blots are shown in Figure S1), in accordance with the results of the iTRAQ analysis (Figure 5B). However, due to the limitation of the availability of antibodies to Neovison vison proteins, the confirmation of DEPs by immunoblotting was restricted. Thus, eight other proteins involved in the immune response process were selected and tested using real-time RT-PCR. As illustrated in Figure 5C, compared to the mock group, mRNA expression of TRAF6, TRAF2, IRAK4, IRAK2, NFκB2, CCL2, TNF-a, and IL-6 in PS-infected cells was significantly up-regulated in a time-dependent manner, which further confirmed the iTRAQ-MS data.
Figure 5

Confirmation of the iTRAQ-MS data by western blotting or real-time RT-PCR. (A) Western blot analysis of NF-κB1, RelA, MHC-I, RPS29, and NFκBIB in PS-infected and control samples at 12 and 24 hpi. GAPDH was served as internal reference. (B) The intensity ratio of the corresponding bands (infection/mock) was quantified using ImageJ software and normalized against GAPDH. (C) Eight selected differently expression proteins related to NF-κB pathway were testified using real-time RT-PCR method. Each gene was performed in three independent experiments. The relative gene expression was calculated using 2-ΔΔ model, representative of n-fold changes in comparison with mock-infected samples. Error bars represent the standard error for triplicate samples. *P < 0.05; **P < 0.01; ***P < 0.001. The data was analyzed by two-way ANOVA followed by Duncan's test.

Confirmation of the iTRAQ-MS data by western blotting or real-time RT-PCR. (A) Western blot analysis of NF-κB1, RelA, MHC-I, RPS29, and NFκBIB in PS-infected and control samples at 12 and 24 hpi. GAPDH was served as internal reference. (B) The intensity ratio of the corresponding bands (infection/mock) was quantified using ImageJ software and normalized against GAPDH. (C) Eight selected differently expression proteins related to NF-κB pathway were testified using real-time RT-PCR method. Each gene was performed in three independent experiments. The relative gene expression was calculated using 2-ΔΔ model, representative of n-fold changes in comparison with mock-infected samples. Error bars represent the standard error for triplicate samples. *P < 0.05; **P < 0.01; ***P < 0.001. The data was analyzed by two-way ANOVA followed by Duncan's test.

CDV infection induces the phosphorylation and nuclear translocation of NF-κB P65 and the degradation of IκB-α proteins

The activation of the NF-κB signaling pathway requires a series of cascade reactions, followed by the recruitment and phosphorylation of NF-κB protein and subsequent translocation from the cytoplasm to the nucleus, as well as the proteasome degradation of IκB proteins, which ultimately induces the production of inflammatory cytokines and type I IFN. Therefore, the degradation of IκB proteins (typically represented by IκB-α) and phosphorylation and nuclear accumulation of the NF-κB proteins (typically represented by NF-κB P65) are distinct features of NF-κB signaling pathway activation. The network analysis of the DEPs involved in the immune response has preliminarily indicated the induction of the NF-κB pathway by PS infection. To further validate this speculation, Mv.1.Lu cells were infected with PS at 2 MOI, after incubation for 12 or 24 h, total proteins were collected to measure the expression of IκB-a and phosphorylated NF-κB P65 proteins. As shown in Figure 6A, compared to that in mock-infected cells, phosphorylated NF-κB P65 (P-P65) and IκB-a proteins were obviously increased and decreased in PS-infected cells, respectively (the original blots are shown in Figure S2). To assess whether PS infection facilitates NF-κB P65 nuclear translocation, Mv.1.Lu cells were infected with PS at an MOI of 2 or mock infected for 24 h. As shown in Figure 6B, NF-κB P65 showed evident nuclear translocation in PS-infected cells but remained in the cytoplasm of mock-infected cells. Further, to determine whether other CDV strains could activate NF-κB P65, the expression of phosphorylated p65 and IκB-α was also detected in CDV3-infected cells, which was increased and decreased, respectively (Figure 6A). Additionally, the nuclear translocation of NF-κB P65 was also observed in CDV3-infected cells (Figure 6B).
Figure 6

CDV infection induces the phosphorylation and nuclear translocation of NF-κB P65 and the degradation of IκB-α proteins (A) CDV infection strengthened NF-κB P65 phosphorylation and IκB-α degradation. Mv.1.Lu cells were infected with 2 MOI PS or CDV3. At 24 hpi, cells were gathered for detecting the expression levels of phosphorylated NF-κB P65 protein and IκB-α protein. (B) CDV infection facilitated NF-κB P65 nuclear translocation. Mv.1.Lu cells were infected with 2 MOI PS, CDV3 or mock-infected. At 24 hpi, the cells were fixed and incubated with rabbit polyclonal antibody specific to mink NF-κB P65 and mouse monoclonal antibody specific to CDV N protein, then incubated with FITC-labeled goat anti rabbit IgG and Cy3-labeled goat anti mouse IgG, respectively. Cell nuclei were stained by DAPI. The fluorescent images were analyzed under a confocal microscopy (Leica, Germany).

CDV infection induces the phosphorylation and nuclear translocation of NF-κB P65 and the degradation of IκB-α proteins (A) CDV infection strengthened NF-κB P65 phosphorylation and IκB-α degradation. Mv.1.Lu cells were infected with 2 MOI PS or CDV3. At 24 hpi, cells were gathered for detecting the expression levels of phosphorylated NF-κB P65 protein and IκB-α protein. (B) CDV infection facilitated NF-κB P65 nuclear translocation. Mv.1.Lu cells were infected with 2 MOI PS, CDV3 or mock-infected. At 24 hpi, the cells were fixed and incubated with rabbit polyclonal antibody specific to mink NF-κB P65 and mouse monoclonal antibody specific to CDV N protein, then incubated with FITC-labeled goat anti rabbit IgG and Cy3-labeled goat anti mouse IgG, respectively. Cell nuclei were stained by DAPI. The fluorescent images were analyzed under a confocal microscopy (Leica, Germany).

Discussion

CDV infection commonly causes a severe lethal disease in carnivores, including minks. However, the molecular mechanisms involved in viral pathogenesis and host immune responses have not been fully elucidated. To date, no research has focused on differential proteome analysis of host cells in response to CDV infection. Therefore, we utilized an iTRAQ approach to identify the DEPs to further explore the pathogenic mechanism and immunomodulation of CDV infection through an analysis of the effects on host cell proteins in the mink. The present study is the first to use Mv.1.Lu cells for iTRAQ analysis due to their ability to efficiently support CDV replication in vitro, and this cell line is homologous to the natural host system of minks. As a starting point, we determined an optimal time to perform proteomic analysis by monitoring the CPEs and analyzing the one-step viral growth curve in PS-infected Mv.1.Lu cells. The results revealed that PS infection induced serials CPE changes from 12 to 60 hpi, with the virus load exhibiting a plateau between 24 and 60 hpi. Considering the high virus load was maintained at 24 hpi and most cells showed little CPE, we conducted the following proteomic analysis based on 24 hpi. In total, we identified 151 up-regulated and 369 down-regulated proteins. Notably, an interesting observation in the present study was that CDV infection induces NF-κB activation in Mv.1.Lu cells. The NF-κB pathway regulates the expression of numerous immune system components to efficiently modulate the innate immune, inflammatory, and antiviral responses (Bose et al., 2003; Bours, 2005) and comprises a hub of cellular signal transduction pathways involved in host immune responses to viral challenge (Moynagh, 2005). So far, NF-κB has been reported as activated following various viral infections of porcine parvovirus (Cao et al., 2017), type 2 porcine circovirus (Wei et al., 2008), and herpes simplex type 1 (Patel et al., 1998). Additionally, NF-kB activation has previously been shown in MV infection (Helin et al., 2001) and was postulated as one of the mechanisms by which CDV might induce osteoclastogenesis (Mee and Sharpe, 1993). Moreover, NF-kB was subsequently demonstrated as induced by CDV (Onderstepoort strain) infection in human osteoclast precursors (Selby et al., 2006); however, these observations are all cases in humans or found in case of one single CDV strain. No reports of different CDV strains affecting NF-κB signaling in mink cells have been previously demonstrated. In the present study, nine NF-κB signaling regulators and downstream cytokines, including TNF-a, IRAK4, TRAF6, TRAF2, NFκB1, NFκB2, RelA, TNFaIP3, and VCAM1, were significantly up-regulated, and the NF-κB complex inhibitory protein IκB-β was obviously down-regulated. Further, KEGG pathway and network analyses of the DEPs involved in the immune response process also indicated the induction of the NF-κB signaling pathway. These results preliminarily indicated the activation of the NF-κB pathway by PS infection in Mv.1.Lu cells. More profound confirmation was observed by the detection of the phosphorylation and nuclear translocation of the NF-κB p65 subunit and the proteasome degradation of IκB-α protein in PS-infected Mv.1.Lu cells. Moreover, the activation of NF-κB p65 in CDV3-infected Mv.1.Lu cells also confirmed these findings. Together with the previous finding that NF-κB activation was found in human cells after CDV (Onderstepoort strain) challenge, these findings enriched the current knowledge of NF-κB activation by CDV infection, suggesting that NF-κB activation was not specific for a certain CDV strain or a certain species cells, but was suitable at least in part for several CDV strains and different species cells. Further validation is needed to compare the ability of various CDV strains to activate NF-κB signaling in other cell lines. In addition, some DEPs involved in the NF-κB pathway, containing IRAK4, RelA, TRAF6, NFκB1, and TNF-a together with IRAK2 and IL-6, were also identified as associated with measles and respiratory diseases, such as tuberculosis and pertussis, which are similar to the respiratory symptoms of CDV infection. The causative agent of measles is MV. In dogs and ferrets, CDV causes a disease that is highly similar to measles in humans (Hutchins et al., 2004; Perry and Halsey, 2004). Several theories have proposed that IL-6 is a critical inducer in the development of pagetic osteoclasts and bone lesions in Paget's disease induced by MV (Roodman et al., 1992; Ehrlich and Roodman, 2005). Mice expressing IL-6 and TNF-a in astrocytes suffer ataxia, inflammation and neurodegeneration after MV infection (Akassoglou et al., 1997; Raber et al., 1997). Therefore, the expression of these cytokines could contribute, in part, to mink pathological symptoms during CDV infection. Furthermore, in the present study, NLR signaling pathway was closely associated with PS infection. This innate immunity signaling pathway may play essential roles in the production of type I interferon and in promoting inflammasome assembly upon virus activation (Kobayashi et al., 2002; Sabbah et al., 2009). Recent studies have suggested that the inflammasome NLRP3, known as the NOD-like-receptor-family, pyrin domain-containing 3, recognizes several RNA viruses, such as influenza virus (Allen et al., 2009; Ichinohe et al., 2010), VSV (Rajan et al., 2011), and EMCV (Poeck et al., 2010). MV also activates the NLRP3 inflammasome, resulting in the caspase-1-mediated maturation of IL-1β (Zilliox et al., 2007; Komune et al., 2011). The NF-κB-induced activation of NLRP3 and pro-IL-1β gene expression is requisite for activating caspase-1 by the NLRP3 inflammasome to further regulate the secretion of the inflammatory cytokines IL-1β and IL-18 (Motta et al., 2015). However, whether there is signaling crosstalk between NF-κB activation and the NLR signaling pathway during CDV infection is an open question. Collectively, the findings suggested that activation of the innate immune NF-κB signaling pathway and the NLR signaling pathway was involved in mink immune responses against CDV infection, and the NF-κB signaling was associated with the pathological respiratory or other symptoms in mink after CDV infection. Further research may answer these questions. CDV infection could cause gastrointestinal symptoms or severe diarrhea after secondary infection. The NHERF, Na+/H+ exchanger regulatory factor, commonly locates or becomes enclosed in the intestinal brush border, thereby binding to the renal proximal tubule brush border Na+/H+ exchanger NHE3 protein, which is mainly responsible for the absorption of electroneutral salt in the intestine and is the most essential sodium absorptive transporter (Donowitz et al., 2005). Therefore, NHERF plays a crucial part in establishing and maintaining the functional integrity of the intestinal barrier. Previous reports have demonstrated that NHERF down-regulation leads to reduced Na+ absorption though affecting NHE3 activity, ultimately increasing intestinal epithelial permeability and the risk of inflammatory bowel disease (IBD) (Sartor, 2006; Strober et al., 2007). Butler et al. discovered that the dysregulation of sodium transit contributed to piglet diarrhea and the pathogenicity of TGEV after infection (Butler et al., 1974). In the present study, NHERF is significantly down-regulated, consistent with a previous observation of the significant down-regulation of NHERF1 (a member of NHERF family) protein in TGEV-infected PK-15 cells using quantitative proteomic analysis (An et al., 2014). Accordingly, the observation suggested that the down-regulation of NHERF by PS infection induced disordered salt and water transit through NHE3 dysfunction and further leaded to in the malfunction of the sodium pump in the intestinal barrier, ultimately resulting in gastrointestinal symptoms or severe diarrhea in infected minks. The present study provides a new view of the pathogenesis of diarrhea in CDV-infected minks. Ubiquitination, the covalent conjunction of ubiquitin to the target protein substrate, is the first of two successive steps associated with ubiquitin–proteasome pathway, which is responsible for a wide variety of cellular functions, including the activation of NF-κB signaling and type I IFN pathways (Ciechanover, 1994; Glickman and Ciechanover, 2002). Accumulated evidence has suggested that various viruses have evolved complicated mechanisms to exploit or manipulate the ubiquitin–proteasome pathway (Gao and Luo, 2006). For example, the activation of the ubiquitin–proteasome pathway is required for influenza virus replication (Widjaja et al., 2010) and is also required other viruses, such as rotavirus (Lopez et al., 2011), human cytomegalovirus (Tran et al., 2010), and porcine reproductive and respiratory syndrome virus (Zhou et al., 2014). The present study identified TRAF2, TRAF6, UBE2L6 (E2 ubiquitin ISG15-conjugating enzyme), USP48 (an ISG15 specific isopeptidase enzyme) and TRIM33 (E3 ubiquitin- ligase) as up-regulated proteins involved in protein ubiquitination. TRAF2 and TRAF6 are well-recognized as signal transducers in the NF-κB signaling pathway that function together with a dimeric ubiquitin-conjugating enzyme complex to catalyze the synthesis of K63-linked polyubiquitin chains and ultimately activate IκB kinase (IKK) and the downstream NF-κB pathway (Deng et al., 2000; Yang et al., 2016). As an IFN-induced ubiquitin-like protein, ISG15 plays a role in immunomodulation and imparting a direct antiviral activity against a wide spectrum of virus (Pincetic et al., 2010; Dai et al., 2011; Sooryanarain et al., 2017). Although the present study failed to detect the ISG15 protein, we identified the significantly up-regulated proteins UBE2L6 and USP48, which are strongly related to the ISGylation of ISG15. Similar to the mechanism of ubiquitination, ISGylation involves the sequential co-operation of E1, E2, E3 and an ISG15-specific isopeptidase enzyme (here identified as USP48) to facilitate ISG15 combination with target proteins for the execution of antiviral responses (Kroeker et al., 2013; Falvey et al., 2017). The tripartite-motif family (TRIM) of proteins plays essential roles in the innate immune responses to antimicrobial infections. TRIM33, a member of the TRIM family and previously known as transcriptional intermediary factor 1 gamma (TIF1-γ), functions in monocyte/macrophage mediated inflammation (Gallouet et al., 2017) and inflammasome activation (Weng et al., 2014). Our results provided the first evidence of multiple differentially up-regulated immune-related proteins associated with protein ubiquitination in response to PS infection in Mv.1.Lu cells, indicating that ubiquitination appeared to be a pivotal regulatory mechanism in the immune responses to CDV infection in mink. Apoptosis plays a role in regulating the pathogenesis of various infectious diseases, which oppositely affect viral pathogenesis by either restraining viral transmission or accelerating viral propagation by the release of the virus particles (Pastorino et al., 2009). In the present study, seven up-regulated proteins, including TNF-a, RelA, NFκB1, TRAF2, a-tubulin, CTSK (Cathepsin K), and CTSV (Cathepsin V), were identified as apoptosis-related, suggesting the induction of apoptosis in PS infection in Mv.1.Lu cells. CTSK and CTSV are associated with a mitochondria-dependent intrinsic pathway to trigger the apoptosis of host cells, while TNF-a participates in an extrinsic receptor-mediated pathway (Benedict et al., 2002). This finding was consistent with previous reports showing that CDV induces apoptosis in the cerebellum and lymphoid tissues of the natural infection of dogs and in Vero cells in vitro (Moro et al., 2003; Del Puerto et al., 2010, 2011). The mechanisms of apoptosis in the pathogenesis of CDV have not yet been clearly illuminated, and the extensive study of these proteins should enhance the current understanding of the mechanisms underlying apoptosis regulation during CDV infection. In summary, the present study provides the first overview of the protein alterations in CDV-infected Mv.1.Lu cells using iTRAQ analysis. The identification of differently expressed proteins reflects a comprehensive interaction network of Mv.1.Lu cells and CDV during infection. Although some significantly regulated proteins were suggested to be related to the pathological symptoms and the immune responses to CDV infection, further functional elucidations are needed to clarify the pathogenic mechanisms and the immune responses to additionally identify new therapeutic targets for preventing CDV infection.

Author contributions

MT and SC designed the study; MT, LY, NS, and YC performed the experiments; ZC and JW analyzed the data; SL, PL, and YS prepared the figures and tables; MT wrote the manuscript.

Conflict of interest statement

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
  83 in total

1.  Quantitative proteomics using stable isotope labeling with amino acids in cell culture reveals changes in the cytoplasmic, nuclear, and nucleolar proteomes in Vero cells infected with the coronavirus infectious bronchitis virus.

Authors:  Edward Emmott; Mark A Rodgers; Andrew Macdonald; Sarah McCrory; Paul Ajuh; Julian A Hiscox
Journal:  Mol Cell Proteomics       Date:  2010-05-13       Impact factor: 5.911

2.  Porcine parvovirus induces activation of NF-κB signaling pathways in PK-15 cells mediated by toll-like receptors.

Authors:  Liyan Cao; Jianfei Chen; Yanwu Wei; Hongyan Shi; Xin Zhang; Jing Yuan; Da Shi; Jianbo Liu; Xiangdong Zhu; Xin Wang; Shangjin Cui; Li Feng
Journal:  Mol Immunol       Date:  2017-03-21       Impact factor: 4.407

3.  Measles virus activates NF-kappa B and STAT transcription factors and production of IFN-alpha/beta and IL-6 in the human lung epithelial cell line A549.

Authors:  E Helin; R Vainionpää; T Hyypiä; I Julkunen; S Matikainen
Journal:  Virology       Date:  2001-11-10       Impact factor: 3.616

4.  Measles virus V protein inhibits NLRP3 inflammasome-mediated interleukin-1β secretion.

Authors:  Noritaka Komune; Takeshi Ichinohe; Minako Ito; Yusuke Yanagi
Journal:  J Virol       Date:  2011-10-12       Impact factor: 5.103

5.  Distemper virus infection in ferrets: an animal model of measles-induced immunosuppression.

Authors:  C A Kauffman; A G Bergman; R P O'Connor
Journal:  Clin Exp Immunol       Date:  1982-03       Impact factor: 4.330

6.  Lymphocyte-mediated immune cytotoxicity in dogs infected with virulent canine distemper virus.

Authors:  M J Appel; W R Shek; B A Summers
Journal:  Infect Immun       Date:  1982-08       Impact factor: 3.441

7.  Dog distemper: imported into Europe from South America?.

Authors:  Jean Blancou
Journal:  Hist Med Vet       Date:  2004

8.  Quantitative analysis of cellular proteome alterations in human influenza A virus-infected mammalian cell lines.

Authors:  Diana Vester; Erdmann Rapp; Dörte Gade; Yvonne Genzel; Udo Reichl
Journal:  Proteomics       Date:  2009-06       Impact factor: 3.984

9.  Lymphoid apoptosis in acute canine distemper.

Authors:  Kazuyoshi Kumagai; Ryoji Yamaguchi; Kazuyuki Uchida; Susumu Tateyama
Journal:  J Vet Med Sci       Date:  2004-02       Impact factor: 1.267

10.  Complete Nucleotide Sequence of Canine Distemper Virus CDV-PS, Isolated from Dogs in China.

Authors:  Li Yi; Hongli Xu; Jianke Wang; Yuening Cheng; Hailing Zhang; Xijun Yan; Shipeng Cheng
Journal:  Genome Announc       Date:  2013-05-16
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.