Tânia Simões1, Ramona Schuster1, Fabian den Brave2, Mafalda Escobar-Henriques1. 1. Institute for Genetics, Cologne Excellence Cluster on Cellular Stress Responses in Aging-Associated Diseases, University of Cologne, Cologne, Germany. 2. Department of Molecular Cell Biology, Max Planck Institute of Biochemistry, Am Klopferspitz 18, Martinsried, Germany.
Abstract
Cdc48/p97, a ubiquitin-selective chaperone, orchestrates the function of E3 ligases and deubiquitylases (DUBs). Here, we identify a new function of Cdc48 in ubiquitin-dependent regulation of mitochondrial dynamics. The DUBs Ubp12 and Ubp2 exert opposing effects on mitochondrial fusion and cleave different ubiquitin chains on the mitofusin Fzo1. We demonstrate that Cdc48 integrates the activities of these two DUBs, which are themselves ubiquitylated. First, Cdc48 promotes proteolysis of Ubp12, stabilizing pro-fusion ubiquitylation on Fzo1. Second, loss of Ubp12 stabilizes Ubp2 and thereby facilitates removal of ubiquitin chains on Fzo1 inhibiting fusion. Thus, Cdc48 synergistically regulates the ubiquitylation status of Fzo1, allowing to control the balance between activation or repression of mitochondrial fusion. In conclusion, we unravel a new cascade of ubiquitylation events, comprising Cdc48 and two DUBs, fine-tuning the fusogenic activity of Fzo1.
Cdc48/p97, a ubiquitin-selective chaperone, orchestrates the function of E3 ligases and deubiquitylases (DUBs). Here, we identify a new function of Cdc48 in ubiquitin-dependent regulation of mitochondrial dynamics. The DUBs Ubp12 and Ubp2 exert opposing effects on mitochondrial fusion and cleave different ubiquitin chains on the mitofusin Fzo1. We demonstrate that Cdc48 integrates the activities of these two DUBs, which are themselves ubiquitylated. First, Cdc48 promotes proteolysis of Ubp12, stabilizing pro-fusion ubiquitylation on Fzo1. Second, loss of Ubp12 stabilizes Ubp2 and thereby facilitates removal of ubiquitin chains on Fzo1 inhibiting fusion. Thus, Cdc48 synergistically regulates the ubiquitylation status of Fzo1, allowing to control the balance between activation or repression of mitochondrial fusion. In conclusion, we unravel a new cascade of ubiquitylation events, comprising Cdc48 and two DUBs, fine-tuning the fusogenic activity of Fzo1.
Mitochondria are dynamic organelles constantly undergoing fusion and fission events, modulated by a variety of post-translational modifiers including ubiquitin (Escobar-Henriques and Langer, 2014; Komander and Rape, 2012). Due to their pathological relevance, e.g. for Parkinson’s disease, these processes are subject to intense investigation. For example, Parkin-dependent ubiquitylation of mitochondrial outer membrane (OM) proteins modulates the elimination of the damaged organelles by mitophagy, or via mitochondrial-derived vesicles (MDV) that fuse with the late endosome (Pickrell and Youle, 2015; Sugiura et al., 2014). Most fusion processes, including the Parkin-MDV pathway, rely on SNAREs (McLelland et al., 2016). In contrast, fusion of the endoplasmic reticulum (ER) and of mitochondria depend on large dynamin-related GTPases (Escobar-Henriques and Anton, 2013; Hu and Rapoport, 2016). In mitochondria, they are named mitofusins (Mfn1/Mfn2 in mammals, Fzo1 in yeast). Deficiencies in Mfn2 cause the type 2 subset of the Charcot-Marie-Tooth disease (CMT), the most common degenerative disorder of the peripheral nervous system (Züchner et al., 2004).The ubiquitin-specific chaperone Cdc48/p97 is required to maintain mitochondrial morphology (Esaki and Ogura, 2012). However, the underlying molecular mechanism of how Cdc48 regulates mitochondrial dynamics is not understood. Cdc48 is an essential AAA-ATPase and one of the most abundant proteins in the cell, which recognizes many ubiquitylated substrates and is involved in a myriad of biological processes (Franz et al., 2014; Meyer and Weihl, 2014). Cdc48 segregates ubiquitylated substrates from protein complexes, or from membranes, thus allowing their proteolysis by the proteasome (Franz et al., 2014). For example, Cdc48 is important for ER-associated protein degradation (ERAD), modulates the turnover of mitochondrial OM proteins (OMMAD), participates in apoptosis responses (Laun et al., 2001) and mediates clearance of damaged lysosomes by autophagy (Avci and Lemberg, 2015; Heo et al., 2010; Papadopoulos et al., 2017; Tanaka et al., 2010; Wu et al., 2016; Xu et al., 2011; Zattas and Hochstrasser, 2015). On the other hand, Cdc48 also binds E3 ubiquitin ligases and deubiquitylases (DUBs) thereby regulating substrate ubiquitylation (Meyer and Weihl, 2014).DUBs are proteases that catalyze the reversion of the ubiquitylation reaction (Love et al., 2007), critically contributing to ubiquitin homeostasis (Amerik and Hochstrasser, 2004; Kimura and Tanaka, 2010; Park and Ryu, 2014; Swatek and Komander, 2016). DUBs activate ubiquitin by releasing it from ubiquitin precursor polypeptides but are also determinants for the modification status of ubiquitylated substrates, allowing to dampen ubiquitin-mediated events (Clague et al., 2013). Importantly, DUBs are associated with a number of human diseases and represent promising drug targets, whose regulation and mechanism of action need to be explored (Heideker and Wertz, 2015; Sahtoe and Sixma, 2015). Two deubiquitylases, Ubp2 and Ubp12, were found to have opposite effects on mitochondrial morphology (Anton et al., 2013). Ubiquitin chains on Fzo1 that are recognized and cleaved by Ubp12 activate mitochondrial fusion. In contrast, other ubiquitin chains on Fzo1 that instead are recognized and cleaved by Ubp2 target Fzo1 for proteasomal degradation and inhibit mitochondrial fusion. Therefore, although it is clear that ubiquitin is a double-faced regulator of mitochondrial fusion (Escobar-Henriques and Langer, 2014), how Ubp2 and Ubp12 exert opposite effects on Fzo1 and mitochondrial fusion remained poorly studied.Here, we identify a role of Cdc48 in mitochondrial fusion, as part of a novel enzymatic cascade consisting of Cdc48, Ubp12 and Ubp2. Cdc48 negatively regulates Ubp12, which negatively regulates Ubp2, explaining why these two DUBs exert opposite effects on their targets and on ubiquitin homeostasis.
Results
Cdc48 promotes mitochondrial fusion and prevents Fzo1 turnover
Although it is clear that Cdc48 affects mitochondrial dynamics (Esaki and Ogura, 2012), the underlying mechanisms are unclear. The role of Cdc48 for mitochondrial morphology was investigated in the hypomorphic mutant cdc48-2, expressing GFP targeted to mitochondria. In this allele, Cdc48 is mutated for A547T, in its ATPase domain D2, whereas in the most commonly used cdc48-3 strain, Cdc48 is instead mutated in R387K, in the D1 ATPase (C. Hickey and M. Hochstrasser, p. communication). Both cdc48-3 and cdc48-2 mutations impair typical Cdc48-dependent processes for transmembrane proteins, like ERAD (Bays et al., 2001; Hitchcock et al., 2001; Latterich et al., 1995). We observed that cdc48-2 cells presented fragmented mitochondria (Figure 1A), consistent with the mitochondrial phenotypes observed upon impairment of the ATPase activity of Cdc48 (Esaki and Ogura, 2012). This suggested problems in mitochondrial fusion and prompted us to evaluate the role of Cdc48 on Fzo1, present at the outer membrane of mitochondria. Mitochondrial fusion is abolished in the absence of Fzo1 ubiquitylation (Anton et al., 2013). Consistent with mitochondrial fragmentation, we observed a decrease of Fzo1 ubiquitylation in cdc48-2 mutant cells, when compared to wild-type (wt) cells (Figure 1B, black arrows). We have previously shown that pro-fusion ubiquitylation of Fzo1 increases its stability (Anton et al., 2013). Accordingly, the steady state levels of Fzo1 and its ubiquitylated forms were decreased in cdc48-2 cells (compare Figure 1C and B), to a similar and not significantly different extent (data not shown). Consistent with the cdc48-2 allele, the levels of Fzo1 were slightly decreased in the cdc48-3 mutant or in cells deleted for the Cdc48 co-factors Npl4, Ufd1 and Ufd3/Doa1 (Figure 1—figure supplement 1A–C). It was previously shown that Ubc6, an endoplasmic reticulum (ER) membrane protein, is degraded by the proteasome via ERAD, a process dependent on Cdc48 (Lenk et al., 2002). Therefore, we also analyzed the steady state levels of Ubc6 in the same CDC48 mutant strains. As expected, and in contrast to Fzo1, the steady state levels of Ubc6 were increased upon impairment of Cdc48 activity (Figure 1C and Figure 1—figure supplement 1A–C). This suggested that Cdc48 regulates Fzo1 by a mechanism different from OMMAD or ERAD. Since both Fzo1 and Ubc6 were mostly affected in the cdc48-2 mutant, we decided to use this strain for further analysis. However, it is unclear why cdc48-2 affects Ubc6 and Fzo1 stronger than cdc48-3. We investigated why cdc48-2 mutant cells have lower levels of Fzo1, by testing with cycloheximide (CHX) chase experiments if Cdc48 regulates Fzo1 stability. Moreover, to simultaneously test the role of the proteasome, we deleted the efflux pumps Snq2 and Pdr5. We observed that Fzo1 degradation was inhibited by the presence of the proteasome inhibitor MG132, indicating that the decreased levels of Fzo1 observed in cdc48-2 cells were due to proteasome-dependent turnover of Fzo1 (Figure 1D). In contrast, proteasome inhibition did not affect Fzo1 turnover in wt cells consistent with previous observations (Anton et al., 2013; Escobar-Henriques et al., 2006). Importantly, all these phenotypes could be rescued by expression of the wt Cdc48 protein but not by expression of the Cdc48A547T variant, mimicking the specific mutation in cdc48-2 (Figure 1—figure supplement 2A–C). In conclusion, Cdc48 is required to maintain the Fzo1 protein, thus promoting mitochondrial fusion events.
Figure 1.
Cdc48 regulates Fzo1 and mitochondrial fusion.
(A) Mitochondrial morphology of CDC48 mutant cells. Wild-type (wt) or cdc48-2 mutant cells were analyzed for mitochondrial tubulation after expressing a mitochondrial-targeted GFP plasmid. Cellular (Nomarski) and mitochondrial (GFP) morphology were visualized by fluorescence microscopy. Bottom panel, quantification of four independent experiments (with more than 200 cells each) including mean and standard deviation (SD), as described (Cumming et al., 2007). (B) Ubiquitylation of Fzo1 upon mutation of CDC48. Crude mitochondrial extracts from wt or cdc48-2 mutant cells expressing HA-Fzo1, or the corresponding empty vector, were solubilized and analyzed by SDS-PAGE and immunoblotting using HA-specific antibodies. Unmodified and ubiquitylated forms of HA-Fzo1 are indicated by a black arrowhead or black arrows, respectively. Ubiquitylated forms of Fzo1 are labeled with Ub. Bottom panel, quantification of three independent experiments, normalized to PoS and including SD. **, p≤0.01 (paired t-test). (C) Steady state levels of Fzo1 upon mutation of CDC48. Total cellular extracts of wt or cdc48-2 mutant cells were analyzed by SDS-PAGE and immunoblotting using Fzo1- or Ubc6-specific and, as a loading control, Tom40-specific antibodies. Bottom panels, quantification of three independent experiments, including SD. (D) Proteasome dependence of Fzo1 degradation in cdc48-2 mutant cells. The turnover of endogenous Fzo1 expressed in Δpdr5 Δsnq2 and Δpdr5 Δsnq2 cdc48-2 cells was assessed after inhibition of cytosolic protein synthesis with cycloheximide (CHX), for the indicated time points in exponentially growing cultures in absence or presence of the proteasomal inhibitor MG132. Samples were analyzed by SDS-PAGE and immunoblotting using Fzo1-specific, Ubc6-specific (as an unstable protein control) and Sec61-specific (as a loading control) antibodies. Right panel, quantification of five independent experiments, including SD. PoS, PonceauS staining.
(A) Steady state levels of Fzo1 upon mutation of CDC48. Total cellular extracts of Δfzo1 or wt cells or different CDC48 mutant cells were analyzed by SDS-PAGE and immunoblotting using Fzo1-, Ubc6- and Tom40-specific antibodies. Bottom panels, quantification of five independent experiments, including SD. ns, p>0.05; *, p≤0.05; ***, p≤0.001 (One-way ANOVA, Tukey’s multiple comparison test). (Β) Role of Cdc48 cofactors in the steady state levels of Fzo1. Total cellular extracts of wt cells or ufd1-2 and npl4-1 mutant cells were analyzed by SDS-PAGE and immunoblotting using Fzo1- or Ubc6-specific antibodies. Bottom panels, quantification of seven (ufd1-2) or nine (npl4-1) independent experiments, including SD. **p≤0.01; ***p≤0.001 (paired t-test). (C) Steady state levels of Fzo1 upon deletion of DOA1. Total cellular extracts of Δfzo1, wt or Δdoa1 cells were analyzed by SDS-PAGE and immunoblotting using Fzo1-, Ubc6- and Tom40-specific antibodies. Bottom panel, quantification of five independent experiments, including SD. *p≤0.05 (paired t-test). PoS, PonceauS staining.
(A) Rescue analysis of Fzo1 steady state levels in cdc48-2 cells. Total cellular extracts of wt or cdc48-2 mutant cells expressing Cdc48, Cdc48A547T or the corresponding empty vector were analyzed by SDS-PAGE and immunoblotting using an HA-specific antibody. (B) Rescue analysis of Fzo1 ubiquitylation in cdc48-2 cells. Crude mitochondrial extracts from wt or cdc48-2 mutant cells, additionally expressing HA-Fzo1 and Cdc48, Cdc48A547T or the corresponding empty vector, as indicated, were lysed and HA-tagged Fzo1 was precipitated using HA-coupled beads. Samples were analyzed by SDS-PAGE and immunoblotting using an HA-specific antibody. Unmodified and ubiquitylated forms of HA-Fzo1 are indicated as in Figure 1B. (C) Rescue analysis of mitochondrial morphology in cdc48-2 cells. Wt or cdc48-2 mutant cells expressing Cdc48 or Cdc48A547T or the corresponding empty vector as indicated were analyzed for mitochondrial tubulation after expressing a mitochondrial-targeted GFP plasmid, as in Figure 1A. Quantification from three different experiments (with more than 200 cells each), including SD, as described (Cumming et al., 2007). IP, immunoprecipitation. PoS, PonceauS staining.
Figure 1—figure supplement 1.
Cdc48 regulates Fzo1 and mitochondrial fusion.
(A) Steady state levels of Fzo1 upon mutation of CDC48. Total cellular extracts of Δfzo1 or wt cells or different CDC48 mutant cells were analyzed by SDS-PAGE and immunoblotting using Fzo1-, Ubc6- and Tom40-specific antibodies. Bottom panels, quantification of five independent experiments, including SD. ns, p>0.05; *, p≤0.05; ***, p≤0.001 (One-way ANOVA, Tukey’s multiple comparison test). (Β) Role of Cdc48 cofactors in the steady state levels of Fzo1. Total cellular extracts of wt cells or ufd1-2 and npl4-1 mutant cells were analyzed by SDS-PAGE and immunoblotting using Fzo1- or Ubc6-specific antibodies. Bottom panels, quantification of seven (ufd1-2) or nine (npl4-1) independent experiments, including SD. **p≤0.01; ***p≤0.001 (paired t-test). (C) Steady state levels of Fzo1 upon deletion of DOA1. Total cellular extracts of Δfzo1, wt or Δdoa1 cells were analyzed by SDS-PAGE and immunoblotting using Fzo1-, Ubc6- and Tom40-specific antibodies. Bottom panel, quantification of five independent experiments, including SD. *p≤0.05 (paired t-test). PoS, PonceauS staining.
Figure 1—figure supplement 2.
Cdc48 regulates Fzo1 and mitochondrial fusion.
(A) Rescue analysis of Fzo1 steady state levels in cdc48-2 cells. Total cellular extracts of wt or cdc48-2 mutant cells expressing Cdc48, Cdc48A547T or the corresponding empty vector were analyzed by SDS-PAGE and immunoblotting using an HA-specific antibody. (B) Rescue analysis of Fzo1 ubiquitylation in cdc48-2 cells. Crude mitochondrial extracts from wt or cdc48-2 mutant cells, additionally expressing HA-Fzo1 and Cdc48, Cdc48A547T or the corresponding empty vector, as indicated, were lysed and HA-tagged Fzo1 was precipitated using HA-coupled beads. Samples were analyzed by SDS-PAGE and immunoblotting using an HA-specific antibody. Unmodified and ubiquitylated forms of HA-Fzo1 are indicated as in Figure 1B. (C) Rescue analysis of mitochondrial morphology in cdc48-2 cells. Wt or cdc48-2 mutant cells expressing Cdc48 or Cdc48A547T or the corresponding empty vector as indicated were analyzed for mitochondrial tubulation after expressing a mitochondrial-targeted GFP plasmid, as in Figure 1A. Quantification from three different experiments (with more than 200 cells each), including SD, as described (Cumming et al., 2007). IP, immunoprecipitation. PoS, PonceauS staining.
Cdc48 regulates Fzo1 and mitochondrial fusion.
(A) Mitochondrial morphology of CDC48 mutant cells. Wild-type (wt) or cdc48-2 mutant cells were analyzed for mitochondrial tubulation after expressing a mitochondrial-targeted GFP plasmid. Cellular (Nomarski) and mitochondrial (GFP) morphology were visualized by fluorescence microscopy. Bottom panel, quantification of four independent experiments (with more than 200 cells each) including mean and standard deviation (SD), as described (Cumming et al., 2007). (B) Ubiquitylation of Fzo1 upon mutation of CDC48. Crude mitochondrial extracts from wt or cdc48-2 mutant cells expressing HA-Fzo1, or the corresponding empty vector, were solubilized and analyzed by SDS-PAGE and immunoblotting using HA-specific antibodies. Unmodified and ubiquitylated forms of HA-Fzo1 are indicated by a black arrowhead or black arrows, respectively. Ubiquitylated forms of Fzo1 are labeled with Ub. Bottom panel, quantification of three independent experiments, normalized to PoS and including SD. **, p≤0.01 (paired t-test). (C) Steady state levels of Fzo1 upon mutation of CDC48. Total cellular extracts of wt or cdc48-2 mutant cells were analyzed by SDS-PAGE and immunoblotting using Fzo1- or Ubc6-specific and, as a loading control, Tom40-specific antibodies. Bottom panels, quantification of three independent experiments, including SD. (D) Proteasome dependence of Fzo1 degradation in cdc48-2 mutant cells. The turnover of endogenous Fzo1 expressed in Δpdr5 Δsnq2 and Δpdr5 Δsnq2 cdc48-2 cells was assessed after inhibition of cytosolic protein synthesis with cycloheximide (CHX), for the indicated time points in exponentially growing cultures in absence or presence of the proteasomal inhibitor MG132. Samples were analyzed by SDS-PAGE and immunoblotting using Fzo1-specific, Ubc6-specific (as an unstable protein control) and Sec61-specific (as a loading control) antibodies. Right panel, quantification of five independent experiments, including SD. PoS, PonceauS staining.(A) Steady state levels of Fzo1 upon mutation of CDC48. Total cellular extracts of Δfzo1 or wt cells or different CDC48 mutant cells were analyzed by SDS-PAGE and immunoblotting using Fzo1-, Ubc6- and Tom40-specific antibodies. Bottom panels, quantification of five independent experiments, including SD. ns, p>0.05; *, p≤0.05; ***, p≤0.001 (One-way ANOVA, Tukey’s multiple comparison test). (Β) Role of Cdc48 cofactors in the steady state levels of Fzo1. Total cellular extracts of wt cells or ufd1-2 and npl4-1 mutant cells were analyzed by SDS-PAGE and immunoblotting using Fzo1- or Ubc6-specific antibodies. Bottom panels, quantification of seven (ufd1-2) or nine (npl4-1) independent experiments, including SD. **p≤0.01; ***p≤0.001 (paired t-test). (C) Steady state levels of Fzo1 upon deletion of DOA1. Total cellular extracts of Δfzo1, wt or Δdoa1 cells were analyzed by SDS-PAGE and immunoblotting using Fzo1-, Ubc6- and Tom40-specific antibodies. Bottom panel, quantification of five independent experiments, including SD. *p≤0.05 (paired t-test). PoS, PonceauS staining.(A) Rescue analysis of Fzo1 steady state levels in cdc48-2 cells. Total cellular extracts of wt or cdc48-2 mutant cells expressing Cdc48, Cdc48A547T or the corresponding empty vector were analyzed by SDS-PAGE and immunoblotting using an HA-specific antibody. (B) Rescue analysis of Fzo1 ubiquitylation in cdc48-2 cells. Crude mitochondrial extracts from wt or cdc48-2 mutant cells, additionally expressing HA-Fzo1 and Cdc48, Cdc48A547T or the corresponding empty vector, as indicated, were lysed and HA-tagged Fzo1 was precipitated using HA-coupled beads. Samples were analyzed by SDS-PAGE and immunoblotting using an HA-specific antibody. Unmodified and ubiquitylated forms of HA-Fzo1 are indicated as in Figure 1B. (C) Rescue analysis of mitochondrial morphology in cdc48-2 cells. Wt or cdc48-2 mutant cells expressing Cdc48 or Cdc48A547T or the corresponding empty vector as indicated were analyzed for mitochondrial tubulation after expressing a mitochondrial-targeted GFP plasmid, as in Figure 1A. Quantification from three different experiments (with more than 200 cells each), including SD, as described (Cumming et al., 2007). IP, immunoprecipitation. PoS, PonceauS staining.
Cdc48 binds and regulates ubiquitylated Fzo1
We further investigated how Cdc48 affected Fzo1. Given that stress conditions disrupt mitochondrial tubulation (Knorre et al., 2013), it was important to show that Cdc48 directly regulates Fzo1 and mitochondrial morphology. First, co-immunoprecipitation experiments revealed that Cdc48 physically interacted with Fzo1 (Figure 2A). We previously showed that the formation of ubiquitin chains on Fzo1 (Figure 2A, black arrows), which are linked to lysine 398, requires previous ubiquitylation of its lysine 464 (Anton et al., 2013). Therefore, Fzo1 ubiquitylation is lost in the mutant Fzo1K464R (Figure 2A). We observed that the interaction between Cdc48 and the non-ubiquitylated variant Fzo1K464R was impaired (Figure 2A), in agreement with ubiquitin being recognized by Cdc48. To assess the specificity of the cdc48-2 effect on Fzo1 protein levels, we tested if this depended on Fzo1 ubiquitylation. Thus, the non-ubiquitylated variant Fzo1K464R was used. We observed that the steady state levels of Fzo1K464R were largely insensitive to the cdc48-2 mutation (Figure 2—figure supplement 1). This points to a direct regulatory role of Cdc48 on Fzo1, only after its ubiquitylation. These pro-fusion ubiquitin forms on Fzo1 are recognized by Ubp12. In addition, we previously identified other ubiquitin forms on Fzo1, that inhibit fusion. They are removed by Ubp2 and can be detected only in the presence of the catalytically inactive variant Ubp2C745S (Anton et al., 2013) (Figure 2B, Input, red arrows). Therefore, we investigated binding of Cdc48 to Fzo1 under these conditions, where both pro-fusion and anti-fusion forms are present. We noticed that despite the clear increase in ubiquitylation of Fzo1 upon Ubp2C745S expression (2.44 times), Cdc48 binding to Fzo1 was not increased (Figure 2B). Therefore, the additional presence of ubiquitin chains inhibiting fusion does not increase Cdc48 binding. Consistently, for the Fzo1K464R variant, which in the presence of Ubp2C745S is ubiquitylated to a similar level as the wt protein (0.96 times, despite the absence of pro-fusion ubiquitylation), no binding to Cdc48 above background can be detected. Thus, similar to Ubp12, Cdc48 recognizes specifically the pro-fusion ubiquitylated forms of Fzo1.
Figure 2.
Cdc48 specifically affects ubiquitylated Fzo1.
(A) Physical interaction between Cdc48 and ubiquitylated Fzo1. HA-Fzo1, HA-Fzo1K464R or the corresponding vector were expressed in ∆fzo1 cells. Crude mitochondrial extracts were lysed and HA-tagged Fzo1 was precipitated using HA-coupled beads and analyzed by SDS-PAGE and immunoblotting using HA- and Cdc48-specific antibodies. Unmodified and ubiquitylated forms of HA-Fzo1 are indicated as in 1B. (B) Effect of the anti-fusion ubiquitylation of Fzo1 on its interaction with Cdc48. HA-Fzo1 or HA-Fzo1K464R, expressed in the presence of Ubp2 (∆fzo1 cells plus empty vector) or Ubp2C745S (∆ubp2 ∆fzo1 cells plus Ubp2C745S-Flag), or the corresponding vector control (the empty vectors corresponding to HA-Fzo1 and Ubp2C745S-Flag, expressed in ∆ubp2 ∆fzo1 cells), were analyzed for Cdc48 interaction, as in 2A. Unmodified and ubiquitylated forms of HA-Fzo1 are indicated by a black arrowhead or black arrows, respectively. Red arrows with no fill indicate Fzo1 ubiquitylated species specifically accumulating upon expression of Ubp2C745S. PoS, PonceauS staining; IP, immunoprecipitation; WB, western blot.
Steady state levels of HA-Fzo1K464R upon mutation of CDC48. Total cellular extracts of ∆fzo1 or ∆fzo1 cdc48-2 mutant cells expressing HA-Fzo1 or HA-Fzo1K464R were analyzed by SDS-PAGE and immunoblotting using Fzo1-,Ubc6- and Tom40-specific antibodies. Bottom panel, quantification of four independent experiments, including SD. PoS, Ponceau S staining.
Figure 2—figure supplement 1.
Cdc48 specifically affects ubiquitylated Fzo1.
Steady state levels of HA-Fzo1K464R upon mutation of CDC48. Total cellular extracts of ∆fzo1 or ∆fzo1 cdc48-2 mutant cells expressing HA-Fzo1 or HA-Fzo1K464R were analyzed by SDS-PAGE and immunoblotting using Fzo1-,Ubc6- and Tom40-specific antibodies. Bottom panel, quantification of four independent experiments, including SD. PoS, Ponceau S staining.
Cdc48 specifically affects ubiquitylated Fzo1.
(A) Physical interaction between Cdc48 and ubiquitylated Fzo1. HA-Fzo1, HA-Fzo1K464R or the corresponding vector were expressed in ∆fzo1 cells. Crude mitochondrial extracts were lysed and HA-tagged Fzo1 was precipitated using HA-coupled beads and analyzed by SDS-PAGE and immunoblotting using HA- and Cdc48-specific antibodies. Unmodified and ubiquitylated forms of HA-Fzo1 are indicated as in 1B. (B) Effect of the anti-fusion ubiquitylation of Fzo1 on its interaction with Cdc48. HA-Fzo1 or HA-Fzo1K464R, expressed in the presence of Ubp2 (∆fzo1 cells plus empty vector) or Ubp2C745S (∆ubp2 ∆fzo1 cells plus Ubp2C745S-Flag), or the corresponding vector control (the empty vectors corresponding to HA-Fzo1 and Ubp2C745S-Flag, expressed in ∆ubp2 ∆fzo1 cells), were analyzed for Cdc48 interaction, as in 2A. Unmodified and ubiquitylated forms of HA-Fzo1 are indicated by a black arrowhead or black arrows, respectively. Red arrows with no fill indicate Fzo1 ubiquitylated species specifically accumulating upon expression of Ubp2C745S. PoS, PonceauS staining; IP, immunoprecipitation; WB, western blot.Steady state levels of HA-Fzo1K464R upon mutation of CDC48. Total cellular extracts of ∆fzo1 or ∆fzo1 cdc48-2 mutant cells expressing HA-Fzo1 or HA-Fzo1K464R were analyzed by SDS-PAGE and immunoblotting using Fzo1-,Ubc6- and Tom40-specific antibodies. Bottom panel, quantification of four independent experiments, including SD. PoS, Ponceau S staining.
Cdc48 supports turnover of ubiquitylated Ubp12
Given the specific interaction of both Cdc48 (Figure 2B) and Ubp12 (Anton et al., 2013) with ubiquitin chains on Fzo1 promoting fusion, we tested if Cdc48 regulated Ubp12. To analyze if Ubp12 is an unstable protein, wt and cdc48-2 cells were transformed with an episomal plasmid expressing Ubp12 under the ADH1 promoter (Anton et al., 2013). CHX chase experiments revealed that Ubp12 is degraded in a Cdc48- and proteasome-dependent manner (Figure 3—figure supplement 1A and B). Similarly, chromosomally tagged Ubp12 is an unstable protein and its turnover depends on Cdc48 (Figure 3A). To analyze if Ubp12 is ubiquitylated, the DUB was immunoprecipitated and analyzed by immunoblotting for Ubp12-Flag or for ubiquitin (Figure 3B). We observed slower migrating forms of Ubp12 with the Flag-specific antibody, which were also detected by a ubiquitin-specific antibody. These studies demonstrated that Ubp12 is modified by ubiquitin. We next tested whether Cdc48 could be co-immunoprecipitated with Ubp12, from solubilized crude mitochondrial extracts. We observed that Ubp12 physically interacted with Cdc48 (Figure 3C), suggesting that Cdc48 directly supports degradation of ubiquitylated Ubp12.
Figure 3—figure supplement 1.
Cdc48 supports ubiquitin-dependent turnover of Ubp12.
(A) Turnover of episomal Ubp12 in wt or cdc48-2 cells. Ubp12-Flag stability was assessed after inhibition of cytosolic protein synthesis with cycloheximide (CHX), for the indicated time points in exponentially growing cultures. Samples were analyzed by SDS-PAGE and immunoblotting using Flag-, Ubc6- and Tom40-specific antibodies. Bottom panel, quantification of three independent experiments, including SD. (B) Proteasome dependence of Ubp12-Flag degradation. The turnover of Ubp2-Flag, expressed from an episomal plasmid, was assessed as in 1D. Samples were analyzed by SDS-PAGE and immunoblotting using Flag-, Ubc6- and Ssc1-specific antibodies. (C) Ubp12 expression levels. Expression levels of endogenously Flag-tagged Ubp12 (Ubp12-Flagint), Ubp12-Flag expressed from an episomal plasmid and endogenously Flag-tagged Ubp12 under the control of a pGAL promoter (pGAL-Ubp12-Flagint) (grown in glucose or galactose as indicated) were analyzed by SDS-PAGE and immunoblotting using Flag- and Ssc1-specific antibodies. Pos, PonceauS staining.
Figure 3.
Cdc48 supports ubiquitin-dependent turnover of Ubp12.
(A) Stability of the Ubp12 protein. The turnover of Ubp12 endogenously Flag tagged (Ubp12-Flagint), in wt or cdc48-2 cells, was assessed with CHX chase, as in 1D. Samples were analyzed by SDS-PAGE and immunoblotting using a Flag-, Tom40- and, as an unstable protein control, a Ubc6-specific antibody. Bottom panel, quantification of three independent experiments, including SD. (B) Ubiquitylation of Ubp12. The Ubp12C372S-Flag inactive variant, expressed from an episomal plasmid, was immunoprecipitated from total soluble extracts using Flag-coupled beads. After elution, Ubp12 was analyzed by western blot using Flag- or ubiquitin (Ub - P4D1)-specific antibodies. Ubiquitylated forms of Ubp12C372S-Flag are labeled with Ub. (C) Physical interaction between Cdc48 and Ubp12. The catalytically inactive Ubp12C372S-Flag variant, expressed from an episomal plasmid, or the corresponding empty vector, were expressed in Δubp12 (CDC48) or Δubp12 cdc48-2 (cdc48-2) mutant cells and analyzed for Cdc48 interaction. Crude mitochondrial extracts were lysed, Flag-tagged Ubp12 was precipitated using Flag-coupled beads, and the eluate analyzed by SDS-PAGE and immunoblotting using Flag- and Cdc48-specific antibodies. PoS, Ponceau S staining; IP, immunoprecipitation; WB, western blot.
(A) Turnover of episomal Ubp12 in wt or cdc48-2 cells. Ubp12-Flag stability was assessed after inhibition of cytosolic protein synthesis with cycloheximide (CHX), for the indicated time points in exponentially growing cultures. Samples were analyzed by SDS-PAGE and immunoblotting using Flag-, Ubc6- and Tom40-specific antibodies. Bottom panel, quantification of three independent experiments, including SD. (B) Proteasome dependence of Ubp12-Flag degradation. The turnover of Ubp2-Flag, expressed from an episomal plasmid, was assessed as in 1D. Samples were analyzed by SDS-PAGE and immunoblotting using Flag-, Ubc6- and Ssc1-specific antibodies. (C) Ubp12 expression levels. Expression levels of endogenously Flag-tagged Ubp12 (Ubp12-Flagint), Ubp12-Flag expressed from an episomal plasmid and endogenously Flag-tagged Ubp12 under the control of a pGAL promoter (pGAL-Ubp12-Flagint) (grown in glucose or galactose as indicated) were analyzed by SDS-PAGE and immunoblotting using Flag- and Ssc1-specific antibodies. Pos, PonceauS staining.
Cdc48 supports ubiquitin-dependent turnover of Ubp12.
(A) Stability of the Ubp12 protein. The turnover of Ubp12 endogenously Flag tagged (Ubp12-Flagint), in wt or cdc48-2 cells, was assessed with CHX chase, as in 1D. Samples were analyzed by SDS-PAGE and immunoblotting using a Flag-, Tom40- and, as an unstable protein control, a Ubc6-specific antibody. Bottom panel, quantification of three independent experiments, including SD. (B) Ubiquitylation of Ubp12. The Ubp12C372S-Flag inactive variant, expressed from an episomal plasmid, was immunoprecipitated from total soluble extracts using Flag-coupled beads. After elution, Ubp12 was analyzed by western blot using Flag- or ubiquitin (Ub - P4D1)-specific antibodies. Ubiquitylated forms of Ubp12C372S-Flag are labeled with Ub. (C) Physical interaction between Cdc48 and Ubp12. The catalytically inactive Ubp12C372S-Flag variant, expressed from an episomal plasmid, or the corresponding empty vector, were expressed in Δubp12 (CDC48) or Δubp12 cdc48-2 (cdc48-2) mutant cells and analyzed for Cdc48 interaction. Crude mitochondrial extracts were lysed, Flag-tagged Ubp12 was precipitated using Flag-coupled beads, and the eluate analyzed by SDS-PAGE and immunoblotting using Flag- and Cdc48-specific antibodies. PoS, Ponceau S staining; IP, immunoprecipitation; WB, western blot.(A) Turnover of episomal Ubp12 in wt or cdc48-2 cells. Ubp12-Flag stability was assessed after inhibition of cytosolic protein synthesis with cycloheximide (CHX), for the indicated time points in exponentially growing cultures. Samples were analyzed by SDS-PAGE and immunoblotting using Flag-, Ubc6- and Tom40-specific antibodies. Bottom panel, quantification of three independent experiments, including SD. (B) Proteasome dependence of Ubp12-Flag degradation. The turnover of Ubp2-Flag, expressed from an episomal plasmid, was assessed as in 1D. Samples were analyzed by SDS-PAGE and immunoblotting using Flag-, Ubc6- and Ssc1-specific antibodies. (C) Ubp12 expression levels. Expression levels of endogenously Flag-tagged Ubp12 (Ubp12-Flagint), Ubp12-Flag expressed from an episomal plasmid and endogenously Flag-tagged Ubp12 under the control of a pGAL promoter (pGAL-Ubp12-Flagint) (grown in glucose or galactose as indicated) were analyzed by SDS-PAGE and immunoblotting using Flag- and Ssc1-specific antibodies. Pos, PonceauS staining.
Cdc48 regulation of Fzo1 depends on Ubp12
Our results show that Cdc48 and Ubp12 have opposing roles on Fzo1 ubiquitylation levels (Figure 1B and [Anton et al., 2013]). Consistently, Ubp12 and Cdc48 also present opposing phenotypes regarding mitochondrial tubulation (Figure 1A and [Anton et al., 2013]). Given that Cdc48 controls Ubp12 levels, we speculated that Cdc48 regulates mitochondrial morphology and Fzo1 via Ubp12. We monitored mitochondrial morphology in cdc48-2 cells in presence or absence of UBP12, expressing mitochondrial-targeted GFP. Strikingly, deletion of UBP12 in cdc48-2 cells rescued mitochondrial tubulation, resembling Δubp12 cells (Figure 4A). Importantly, the mitochondrial hypertubulation of Δubp12 cells depended on Fzo1 (Figure 4—figure supplement 1A–C). Even in Δfzo1 Δdnm1 cells, resembling wt cells in mitochondrial shape, further deletion of UBP12 did not induce hypertubulation, confirming that Ubp12 regulates mitochondrial morphology via Fzo1 (Figure 4—figure supplement 1D). Mitochondrial fusion is also required to maintain the cellular growth on respiratory media, i.e. media containing the non-fermentable carbon sources glycerol or lactate (Hermann et al., 1998). Therefore, to further support the physiological importance of Cdc48 and Ubp12, we analyzed the respiratory capacity of cdc48-2 in presence or absence of UBP12. In agreement with restored tubulation of mitochondria, we observed that the growth defect of cdc48-2 cells at 37°C on lactate media could be improved upon deletion of UBP12 (Figure 4B). Given that Δfzo1 cells irreversibly loose mitochondrial DNA, we investigated if this is also the case for cdc48-2 cells. Consistent with the respiratory reversibility of cdc48-2 cells upon further deletion of UBP12, we observed that cdc48-2 cells did not lose mitochondrial DNA (Figure 4—figure supplement 2A and B). Importantly, the respiratory defect of cdc48-2 cells could be complemented by expression of Cdc48 but not of Cdc48A547T (Figure 4—figure supplement 2C). Finally, cdc48-2Δubp12 cells also showed improved ubiquitylation of Fzo1 (Figure 4C). Together, these results show that Cdc48 maintains Fzo1 ubiquitylation and activates mitochondrial fusion by downregulating Ubp12. However, two pieces of evidence suggest that Cdc48 might have other functions in this pathway, apart from regulating Ubp12. First, we observed that the physical interaction between Fzo1 and Cdc48 is not mediated by Ubp12 (Figure 4—figure supplement 2D), suggesting that Cdc48 directly recognizes ubiquitylated Fzo1. Second, deletion of UBP12 in cdc48-2 cells did not restore the steady state levels of Fzo1 (Figure 4—figure supplement 2E). Notably, this is consistent with our previous observation that mitochondrial fusion depends on ubiquitylated rather than on the steady state levels of Fzo1 (Anton et al., 2013).
Figure 4.
Interdependence of Cdc48 and Ubp12 for Fzo1 regulation.
(A) Mitochondrial morphology upon deletion of UBP12 and/or mutation of CDC48. The indicated mutant cells were analyzed for mitochondrial tubulation after expressing a mitochondrial-targeted GFP plasmid, as in Figure 1A. Right panel, quantification from three different experiments (with more than 200 cells each), including SD, as described (Cumming et al., 2007) (B) Respiratory capacity of cells upon deletion of UBP12 and/or mutation of CDC48. Fivefold serial dilutions of exponentially growing cells of wt or the mutant strains Δubp12, cdc48-2, and Δubp12 cdc48-2 were spotted on YP media supplemented with lactate (YPLac) and incubated at 30°C for two days or 37°C for five days. (C) Ubiquitylation levels of Fzo1 upon deletion of UBP12 and/or mutation of CDC48. Crude mitochondrial extracts from the indicated strains additionally expressing HA-Fzo1, or the corresponding empty vector, were analyzed by SDS-PAGE and immunoblotting using an HA-specific antibody. Unmodified and ubiquitylated forms of HA-Fzo1 are indicated as in Figure 1B. Bottom panel, quantification of four independent experiments, normalized to PoS and including SD. ns, p>0.05. *, p≤0.05, **, p≤0.01 (One-way ANOVA, Tukey’s multiple comparison test). PoS, PonceauS staining.
(A) Mitochondrial morphology upon deletion of UBP12 in Δfzo1 cells. The indicated mutant cells were analyzed for mitochondrial tubulation after expressing a mitochondrial-targeted GFP plasmid, as in Figure 1A. Quantification from three different experiments (with more than 200 cells each), including SD, as described (Cumming et al., 2007). (B) Mitochondrial morphology upon expression of HA-Fzo1 in Δfzo1 Δubp12 cells. The indicated mutant cells were analyzed for mitochondrial tubulation after expressing a mitochondrial-targeted GFP plasmid, as in Figure 1A. Quantification from three different experiments (with more than 200 cells each), including SD, as described (Cumming et al., 2007). (C) Mitochondrial morphology upon endogenous expression of HA-Fzo1 or HA-Fzo1K464R in Δubp12 cells. The indicated mutant cells were analyzed for mitochondrial tubulation after expressing a mitochondrial-targeted GFP plasmid, as in Figure 1A. Quantification from one experiment (with more than 200 cells each). (D) Mitochondrial morphology upon deletion of UBP12 in Δfzo1 Δdnm1 cells. The indicated mutant cells were analyzed for mitochondrial tubulation after expressing a mitochondrial-targeted GFP plasmid, as in Figure 1A. Quantification from three different experiments (with more than 200 cells each), including SD, as described (Cumming et al., 2007).
(A) Analysis of mtDNA content in cdc48-2 cells using RT-PCR. mtDNA content in Δfzo1, wt and cdc48-2 cells was analyzed by measuring COX3 and ACT1 (as housekeeping gene) RNA levels using RT-PCR. Quantification of six independent experiments, including SD. *p≤0.05 (paired t-test). (B) Analysis of mtDNA content in cdc48-2 cells using the Cox2 protein amount. Total cellular extracts of Δfzo1, wt and cdc48-2 cells were analyzed by SDS-PAGE and immunoblotting using Cox2- (as mtDNA marker) or Ubc6-specific antibodies. Bottom panel, quantification of five independent experiments, including SD. *p≤0.05 (paired t-test). (C) Respiratory capacity of cdc48-2 cells upon expression of wt or mutant Cdc48. A spot assay was performed as described in Figure 4B with the indicated cells but using YPLac, grown at 30°C for 1 day and at 37°C for 3 days. (D) Physical interaction between Cdc48 and Fzo1 in Δubp12 cells. HA-Fzo1 or the corresponding empty vector was expressed in wt or Δubp12 cells and analyzed for Cdc48 interaction, as in 2A. Crude mitochondrial extracts were lysed, HA tagged Fzo1 was precipitated using HA-coupled beads, and the eluate was analyzed by SDS-PAGE and immunoblotting using HA- and Cdc48-specific antibodies. Unmodified and ubiquitylated forms of HA-Fzo1 are indicated as in Figure 1B. (E) Steady state levels of Fzo1 upon deletion of UBP2 and/or mutation of CDC48. Total cellular extracts of wt cells or Δubp12, cdc48-2 and Δubp12 cdc48-2 mutant cells were analyzed by SDS-PAGE and immunoblotting using HA-, Ubc6- and Tom40-specific antibodies. Bottom panel, quantification of six independent experiments, including SD. ns, p>0.05 (One-way ANOVA; Tukey’s multiple comparison test). PoS, Ponceau S staining; IP, immunoprecipitation; WB, western blot.
Figure 4—figure supplement 1.
Interdependence of Cdc48 and Ubp12 for Fzo1 regulation.
(A) Mitochondrial morphology upon deletion of UBP12 in Δfzo1 cells. The indicated mutant cells were analyzed for mitochondrial tubulation after expressing a mitochondrial-targeted GFP plasmid, as in Figure 1A. Quantification from three different experiments (with more than 200 cells each), including SD, as described (Cumming et al., 2007). (B) Mitochondrial morphology upon expression of HA-Fzo1 in Δfzo1 Δubp12 cells. The indicated mutant cells were analyzed for mitochondrial tubulation after expressing a mitochondrial-targeted GFP plasmid, as in Figure 1A. Quantification from three different experiments (with more than 200 cells each), including SD, as described (Cumming et al., 2007). (C) Mitochondrial morphology upon endogenous expression of HA-Fzo1 or HA-Fzo1K464R in Δubp12 cells. The indicated mutant cells were analyzed for mitochondrial tubulation after expressing a mitochondrial-targeted GFP plasmid, as in Figure 1A. Quantification from one experiment (with more than 200 cells each). (D) Mitochondrial morphology upon deletion of UBP12 in Δfzo1 Δdnm1 cells. The indicated mutant cells were analyzed for mitochondrial tubulation after expressing a mitochondrial-targeted GFP plasmid, as in Figure 1A. Quantification from three different experiments (with more than 200 cells each), including SD, as described (Cumming et al., 2007).
Figure 4—figure supplement 2.
Interdependence of Cdc48 und Ubp12 for Fzo1 regulation.
(A) Analysis of mtDNA content in cdc48-2 cells using RT-PCR. mtDNA content in Δfzo1, wt and cdc48-2 cells was analyzed by measuring COX3 and ACT1 (as housekeeping gene) RNA levels using RT-PCR. Quantification of six independent experiments, including SD. *p≤0.05 (paired t-test). (B) Analysis of mtDNA content in cdc48-2 cells using the Cox2 protein amount. Total cellular extracts of Δfzo1, wt and cdc48-2 cells were analyzed by SDS-PAGE and immunoblotting using Cox2- (as mtDNA marker) or Ubc6-specific antibodies. Bottom panel, quantification of five independent experiments, including SD. *p≤0.05 (paired t-test). (C) Respiratory capacity of cdc48-2 cells upon expression of wt or mutant Cdc48. A spot assay was performed as described in Figure 4B with the indicated cells but using YPLac, grown at 30°C for 1 day and at 37°C for 3 days. (D) Physical interaction between Cdc48 and Fzo1 in Δubp12 cells. HA-Fzo1 or the corresponding empty vector was expressed in wt or Δubp12 cells and analyzed for Cdc48 interaction, as in 2A. Crude mitochondrial extracts were lysed, HA tagged Fzo1 was precipitated using HA-coupled beads, and the eluate was analyzed by SDS-PAGE and immunoblotting using HA- and Cdc48-specific antibodies. Unmodified and ubiquitylated forms of HA-Fzo1 are indicated as in Figure 1B. (E) Steady state levels of Fzo1 upon deletion of UBP2 and/or mutation of CDC48. Total cellular extracts of wt cells or Δubp12, cdc48-2 and Δubp12 cdc48-2 mutant cells were analyzed by SDS-PAGE and immunoblotting using HA-, Ubc6- and Tom40-specific antibodies. Bottom panel, quantification of six independent experiments, including SD. ns, p>0.05 (One-way ANOVA; Tukey’s multiple comparison test). PoS, Ponceau S staining; IP, immunoprecipitation; WB, western blot.
Interdependence of Cdc48 and Ubp12 for Fzo1 regulation.
(A) Mitochondrial morphology upon deletion of UBP12 and/or mutation of CDC48. The indicated mutant cells were analyzed for mitochondrial tubulation after expressing a mitochondrial-targeted GFP plasmid, as in Figure 1A. Right panel, quantification from three different experiments (with more than 200 cells each), including SD, as described (Cumming et al., 2007) (B) Respiratory capacity of cells upon deletion of UBP12 and/or mutation of CDC48. Fivefold serial dilutions of exponentially growing cells of wt or the mutant strains Δubp12, cdc48-2, and Δubp12 cdc48-2 were spotted on YP media supplemented with lactate (YPLac) and incubated at 30°C for two days or 37°C for five days. (C) Ubiquitylation levels of Fzo1 upon deletion of UBP12 and/or mutation of CDC48. Crude mitochondrial extracts from the indicated strains additionally expressing HA-Fzo1, or the corresponding empty vector, were analyzed by SDS-PAGE and immunoblotting using an HA-specific antibody. Unmodified and ubiquitylated forms of HA-Fzo1 are indicated as in Figure 1B. Bottom panel, quantification of four independent experiments, normalized to PoS and including SD. ns, p>0.05. *, p≤0.05, **, p≤0.01 (One-way ANOVA, Tukey’s multiple comparison test). PoS, PonceauS staining.(A) Mitochondrial morphology upon deletion of UBP12 in Δfzo1 cells. The indicated mutant cells were analyzed for mitochondrial tubulation after expressing a mitochondrial-targeted GFP plasmid, as in Figure 1A. Quantification from three different experiments (with more than 200 cells each), including SD, as described (Cumming et al., 2007). (B) Mitochondrial morphology upon expression of HA-Fzo1 in Δfzo1 Δubp12 cells. The indicated mutant cells were analyzed for mitochondrial tubulation after expressing a mitochondrial-targeted GFP plasmid, as in Figure 1A. Quantification from three different experiments (with more than 200 cells each), including SD, as described (Cumming et al., 2007). (C) Mitochondrial morphology upon endogenous expression of HA-Fzo1 or HA-Fzo1K464R in Δubp12 cells. The indicated mutant cells were analyzed for mitochondrial tubulation after expressing a mitochondrial-targeted GFP plasmid, as in Figure 1A. Quantification from one experiment (with more than 200 cells each). (D) Mitochondrial morphology upon deletion of UBP12 in Δfzo1 Δdnm1 cells. The indicated mutant cells were analyzed for mitochondrial tubulation after expressing a mitochondrial-targeted GFP plasmid, as in Figure 1A. Quantification from three different experiments (with more than 200 cells each), including SD, as described (Cumming et al., 2007).
Interdependence of Cdc48 und Ubp12 for Fzo1 regulation.
(A) Analysis of mtDNA content in cdc48-2 cells using RT-PCR. mtDNA content in Δfzo1, wt and cdc48-2 cells was analyzed by measuring COX3 and ACT1 (as housekeeping gene) RNA levels using RT-PCR. Quantification of six independent experiments, including SD. *p≤0.05 (paired t-test). (B) Analysis of mtDNA content in cdc48-2 cells using the Cox2 protein amount. Total cellular extracts of Δfzo1, wt and cdc48-2 cells were analyzed by SDS-PAGE and immunoblotting using Cox2- (as mtDNA marker) or Ubc6-specific antibodies. Bottom panel, quantification of five independent experiments, including SD. *p≤0.05 (paired t-test). (C) Respiratory capacity of cdc48-2 cells upon expression of wt or mutant Cdc48. A spot assay was performed as described in Figure 4B with the indicated cells but using YPLac, grown at 30°C for 1 day and at 37°C for 3 days. (D) Physical interaction between Cdc48 and Fzo1 in Δubp12 cells. HA-Fzo1 or the corresponding empty vector was expressed in wt or Δubp12 cells and analyzed for Cdc48 interaction, as in 2A. Crude mitochondrial extracts were lysed, HA tagged Fzo1 was precipitated using HA-coupled beads, and the eluate was analyzed by SDS-PAGE and immunoblotting using HA- and Cdc48-specific antibodies. Unmodified and ubiquitylated forms of HA-Fzo1 are indicated as in Figure 1B. (E) Steady state levels of Fzo1 upon deletion of UBP2 and/or mutation of CDC48. Total cellular extracts of wt cells or Δubp12, cdc48-2 and Δubp12 cdc48-2 mutant cells were analyzed by SDS-PAGE and immunoblotting using HA-, Ubc6- and Tom40-specific antibodies. Bottom panel, quantification of six independent experiments, including SD. ns, p>0.05 (One-way ANOVA; Tukey’s multiple comparison test). PoS, Ponceau S staining; IP, immunoprecipitation; WB, western blot.
Ubp12 mediates deubiquitylation of Ubp2
We noticed that increased levels of Fzo1, present in ∆ubp12 cells, specifically depended on Ubp2 (Figure 5A). Therefore, Ubp12 and Ubp2, which affect the stability of Fzo1 in opposite manners, are also interdependent. Next, we analyzed if Ubp2 and Ubp12 also presented other opposing and interdependent phenotypes related to ubiquitin. First, we analyzed cellular growth of cells lacking UBP2, UBP12 or both, in the presence of sub-lethal doses of CHX, a phenotype commonly tested to monitor imbalances in ubiquitin homeostasis (Gerlinger et al., 1997; Hanna et al., 2003; Rumpf and Jentsch, 2006). Second, we directly quantified the levels of free ubiquitin vs. substrate-conjugated ubiquitin in the same strains. We observed that indeed Ubp2 and Ubp12 had opposite phenotypes (Figure 5—figure supplement 1). In addition, the consistent interdependence of these two enzymes suggested a DUB hierarchy, which prompted us to test a possible regulation of the Ubp2 protein by Ubp12. We tested if Ubp2 is an unstable protein and whether Ubp12 is involved in its degradation, after inhibition of protein synthesis with CHX. The levels of genomically tagged Ubp2 decreased over time and Ubp2-turnover was regulated by Ubp12 (Figure 5B) and by the proteasome (Figure 5—figure supplement 2A). Moreover, co-immunoprecipitation experiments revealed that Ubp2 interacted with Ubp12, suggesting a direct regulation between both DUBs (Figure 5—figure supplement 2B). We therefore investigated if Ubp2 could be ubiquitylated, in a Ubp12-dependent manner. After immunoprecipitation of Ubp2-Flag, and consistent with recent observations (Cavellini et al., 2017), we observed the presence of slowly migrating forms of Ubp2 during electrophoresis, in wt cells (Figure 5—figure supplement 2C) but mostly in Δubp12 cells (Figure 5C, left panel). Importantly, we show that these forms could also be detected using a ubiquitin-specific antibody, demonstrating that they represent ubiquitylated Ubp2 (Figure 5C and Figure 5—figure supplement 2C, right panels). This indicates that Ubp12 mediates deubiquitylation of Ubp2 and suggests that Ubp2 acts downstream of Ubp12, thus revealing a hierarchical cascade between DUBs, of relevance for the protein levels of Fzo1 and for ubiquitin homeostasis.
Figure 5.
Ubp12 modulates Ubp2 ubiquitylation and turnover.
(A) Interdependent role of Ubp2 and Ubp12 for the steady state levels of Fzo1. Total cellular extracts of wt or Δubp2, Δubp12, and Δubp2 Δubp12 mutant cells expressing HA-Fzo1 and also expressing either Ubp2-Flag or the corresponding empty vector, as indicated, were analyzed by SDS-PAGE and immunoblotting using HA- and Tom40-specific antibodies. Bottom panel, quantification of four independent experiments, including SD. (B) Turnover of endogenous Ubp2 in wt or Δubp12 cells. The turnover of endogenously 3xHA-tagged Ubp2 (Ubp2-3xHAint) was assessed as in 3A. Samples were analyzed by SDS-PAGE and immunoblotting using antibodies against HA, Ubc6 and Ssc1. Right panel, quantification of four independent experiments, including SD. For the statistical analysis of the degradation kinetics of each strain, a paired t-test was used; for the statistical analysis of the difference in steady state levels of both strains at the indicated time points (t1h, t3h) an unpaired t-test was used. ns, p>0.05; *, p≤0.05; **, p≤0.01. (C) Ubiquitylation of Ubp2. The Ubp2C745S-Flag inactive variant, expressed in wt or Δubp12 cells, was immunoprecipitated from total soluble extracts using Flag-coupled beads. Eluted Ubp2 was analyzed by western blot using Flag- or ubiquitin (Ub - P4D1)-specific antibodies. Ubiquitylated forms of Ubp2C745S-Flag are labeled with Ub. PoS, Ponceau S staining; IP, immunoprecipitation; WB, western blot.
(A) Opposing roles of Ubp2 and Ubp12 for CHX resistance. A spot assay was performed, as described in Figure 4B, but on synthetic media supplemented with glucose (SCD) in the absence or presence of 0.5 µg/ml CHX and incubated at 30°C for one or five days, respectively. (B) Distinct roles of Ubp2 and Ubp12 for cellular ubiquitylation. Total cellular extracts of the indicated strains were analyzed by SDS-PAGE and immunoblotting using ubiquitin (Ub; αP4D1) and Tpi1-specific antibodies, used as loading control. Free ubiquitin or ubiquitylated conjugates are labeled with Ub. Right panels, quantification of three independent experiments showing the levels of free Ub or Ub conjugates, including SD.
(A) Proteasome dependence of Ubp2-Flag degradation in Δpdr5 Δsnq2 mutant cells. The turnover of ectopically expressed Ubp2-Flag was assessed as in Figure 1D. Samples were analyzed by SDS-PAGE and immunoblotting using Flag- and Ubc6-specific antibodies. (B) Physical interaction between Ubp2 and Ubp12. Catalytically inactive variants ectopically expressed Ubp2C745S-Flag and non-tagged Ubp12C372S, or their corresponding empty vectors, were expressed in Δubp2 Δubp12 cells. Total soluble extracts were prepared and Ubp12C372S was precipitated using Sepharose beads in the presence or absence of a Ubp12-specific antibody, as indicated. The eluates were analyzed by SDS-PAGE and immunoblotting using Flag- and Ubp12-specific antibodies. (C) Ubiquitylation of Ubp2. The Ubp2C745S-Flag inactive variant, expressed in wt, Δubp12 and Δubp12Δmdm30 cells, was immunoprecipitated from total soluble extracts using Flag-coupled beads. Eluted Ubp2 was analyzed by western blot using antibodies specific for Flag or ubiquitin (Ub; αP4D1). Ubiquitylated forms of Ubp2C745S-Flag are labeled with Ub. PoS, PonceauS staining; IP, immunoprecipitation; WB, western blot.
Figure 5—figure supplement 1.
Ubp12 modulates Ubp2 ubiquitylation and turnover.
(A) Opposing roles of Ubp2 and Ubp12 for CHX resistance. A spot assay was performed, as described in Figure 4B, but on synthetic media supplemented with glucose (SCD) in the absence or presence of 0.5 µg/ml CHX and incubated at 30°C for one or five days, respectively. (B) Distinct roles of Ubp2 and Ubp12 for cellular ubiquitylation. Total cellular extracts of the indicated strains were analyzed by SDS-PAGE and immunoblotting using ubiquitin (Ub; αP4D1) and Tpi1-specific antibodies, used as loading control. Free ubiquitin or ubiquitylated conjugates are labeled with Ub. Right panels, quantification of three independent experiments showing the levels of free Ub or Ub conjugates, including SD.
Figure 5—figure supplement 2.
Ubp12 modulates Ubp2 ubiquitylation and turnover.
(A) Proteasome dependence of Ubp2-Flag degradation in Δpdr5 Δsnq2 mutant cells. The turnover of ectopically expressed Ubp2-Flag was assessed as in Figure 1D. Samples were analyzed by SDS-PAGE and immunoblotting using Flag- and Ubc6-specific antibodies. (B) Physical interaction between Ubp2 and Ubp12. Catalytically inactive variants ectopically expressed Ubp2C745S-Flag and non-tagged Ubp12C372S, or their corresponding empty vectors, were expressed in Δubp2 Δubp12 cells. Total soluble extracts were prepared and Ubp12C372S was precipitated using Sepharose beads in the presence or absence of a Ubp12-specific antibody, as indicated. The eluates were analyzed by SDS-PAGE and immunoblotting using Flag- and Ubp12-specific antibodies. (C) Ubiquitylation of Ubp2. The Ubp2C745S-Flag inactive variant, expressed in wt, Δubp12 and Δubp12Δmdm30 cells, was immunoprecipitated from total soluble extracts using Flag-coupled beads. Eluted Ubp2 was analyzed by western blot using antibodies specific for Flag or ubiquitin (Ub; αP4D1). Ubiquitylated forms of Ubp2C745S-Flag are labeled with Ub. PoS, PonceauS staining; IP, immunoprecipitation; WB, western blot.
Ubp12 modulates Ubp2 ubiquitylation and turnover.
(A) Interdependent role of Ubp2 and Ubp12 for the steady state levels of Fzo1. Total cellular extracts of wt or Δubp2, Δubp12, and Δubp2 Δubp12 mutant cells expressing HA-Fzo1 and also expressing either Ubp2-Flag or the corresponding empty vector, as indicated, were analyzed by SDS-PAGE and immunoblotting using HA- and Tom40-specific antibodies. Bottom panel, quantification of four independent experiments, including SD. (B) Turnover of endogenous Ubp2 in wt or Δubp12 cells. The turnover of endogenously 3xHA-tagged Ubp2 (Ubp2-3xHAint) was assessed as in 3A. Samples were analyzed by SDS-PAGE and immunoblotting using antibodies against HA, Ubc6 and Ssc1. Right panel, quantification of four independent experiments, including SD. For the statistical analysis of the degradation kinetics of each strain, a paired t-test was used; for the statistical analysis of the difference in steady state levels of both strains at the indicated time points (t1h, t3h) an unpaired t-test was used. ns, p>0.05; *, p≤0.05; **, p≤0.01. (C) Ubiquitylation of Ubp2. The Ubp2C745S-Flag inactive variant, expressed in wt or Δubp12 cells, was immunoprecipitated from total soluble extracts using Flag-coupled beads. Eluted Ubp2 was analyzed by western blot using Flag- or ubiquitin (Ub - P4D1)-specific antibodies. Ubiquitylated forms of Ubp2C745S-Flag are labeled with Ub. PoS, Ponceau S staining; IP, immunoprecipitation; WB, western blot.(A) Opposing roles of Ubp2 and Ubp12 for CHX resistance. A spot assay was performed, as described in Figure 4B, but on synthetic media supplemented with glucose (SCD) in the absence or presence of 0.5 µg/ml CHX and incubated at 30°C for one or five days, respectively. (B) Distinct roles of Ubp2 and Ubp12 for cellular ubiquitylation. Total cellular extracts of the indicated strains were analyzed by SDS-PAGE and immunoblotting using ubiquitin (Ub; αP4D1) and Tpi1-specific antibodies, used as loading control. Free ubiquitin or ubiquitylated conjugates are labeled with Ub. Right panels, quantification of three independent experiments showing the levels of free Ub or Ub conjugates, including SD.(A) Proteasome dependence of Ubp2-Flag degradation in Δpdr5 Δsnq2 mutant cells. The turnover of ectopically expressed Ubp2-Flag was assessed as in Figure 1D. Samples were analyzed by SDS-PAGE and immunoblotting using Flag- and Ubc6-specific antibodies. (B) Physical interaction between Ubp2 and Ubp12. Catalytically inactive variants ectopically expressed Ubp2C745S-Flag and non-tagged Ubp12C372S, or their corresponding empty vectors, were expressed in Δubp2 Δubp12 cells. Total soluble extracts were prepared and Ubp12C372S was precipitated using Sepharose beads in the presence or absence of a Ubp12-specific antibody, as indicated. The eluates were analyzed by SDS-PAGE and immunoblotting using Flag- and Ubp12-specific antibodies. (C) Ubiquitylation of Ubp2. The Ubp2C745S-Flag inactive variant, expressed in wt, Δubp12 and Δubp12Δmdm30 cells, was immunoprecipitated from total soluble extracts using Flag-coupled beads. Eluted Ubp2 was analyzed by western blot using antibodies specific for Flag or ubiquitin (Ub; αP4D1). Ubiquitylated forms of Ubp2C745S-Flag are labeled with Ub. PoS, PonceauS staining; IP, immunoprecipitation; WB, western blot.
Ubp12 recognizes short K48-linked ubiquitin chains on Fzo1
In contrast to numerous proteins that are destabilized in absence of DUBs, deletion of UBP12 stabilizes Fzo1 (Figure 6—figure supplement 1) and Ubp2 (Figure 5B). Consistently, the two other known substrates of Ubp12 – Rad23 (Gödderz et al., 2017) and Gpa1 (Wang et al., 2005) are also not destabilized in Δubp12 cells. To characterize the deubiquitylation reaction of Ubp12 in more detail, we analyzed the ubiquitin linkages on Fzo1 and Ubp2 accumulating in Δubp12 cells. Overexpression of ubiquitin mutated in K48R strongly decreased Fzo1 and Ubp2 ubiquitylation, revealing that their ubiquitin chains are linked via K48 (Figure 6A and C). However, the ubiquitin chains on Fzo1 that destabilize it and inhibit fusion, which are not bound by Ubp12, are also K48-linked (Figure 6B) (Anton et al., 2013). Thus, differences in ubiquitin chains cannot explain why Ubp12 stabilizes its substrates. To further analyze Ubp12, its ubiquitin chain preference was tested using in vitro deubiquitylation assays (Hospenthal et al., 2015). As a substrate, we used either K48-linked or K63-linked ubiquitin, present in the form of either di-ubiquitin (Figure 6D) or ubiquitin chains (Figure 6E). However, in all cases, Ubp12 revealed no chain preference (Figure 6D,E). This suggested that it is not Ubp12 but rather the chains themselves on the substrates that prevent their turnover. Thus, we determined the number of ubiquitin moieties present on Fzo1, upon co-expression of tagged and non-tagged ubiquitin molecules. We observed that co-expression of ubiquitin and Myc-ubiquitin decomposed the first ubiquitylated form of Fzo1, i.e running closest to non-modified Fzo1, into two bands (Figure 6F). This corresponds to the presence of either ubiquitin or Myc-ubiquitin attached to Fzo1 and confirms that this form corresponds to mono-ubiquitylated Fzo1. Interestingly, however, for the two other ubiquitylated forms with lower electrophoretic mobility, we observed that only two additional bands could be observed above each of them. They correspond to either the presence of two Myc-ubiquitin molecules or one ubiquitin and one Myc-ubiquitin conjugated to Fzo1. These results suggest that the K48 chains on Fzo1 consist of two ubiquitin moieties. In conclusion, Ubp12 recognizes ubiquitylated chains on Fzo1 composed of a very small number of ubiquitin moieties. We therefore propose that Ubp12 does not stabilize its substrates because their ubiquitin chains are too short to target proteasomal turnover.
Figure 6—figure supplement 1.
Characterization of the deubiquitylation reaction by Ubp12.
Opposite effects of Ubp12 and Ubp2 in Fzo1 stability. The turnover of HA-Fzo1 in wt, Δubp12, Δubp2 or Δubp12 Δubp2 cells was assessed after inhibition of cytosolic protein synthesis with cycloheximide (CHX), for the indicated time points in exponentially growing cultures. Samples were analyzed by SDS-PAGE and immunoblotting using a HA- and Hsp70-specific antibodies. Left panel, quantification of three independent experiments, including SD.
Figure 6.
Characterization of the deubiquitylation reaction by Ubp12.
(A) Analysis of ubiquitin chain-type composition of Fzo1. Crude mitochondrial extracts from wt or Δubp12 mutant cells expressing HA-Fzo1, and over-expressing either wt ubiquitin (Ub) or ubiquitin with a K48R mutation (UbK48R), were solubilized, subjected to HA-immunoprecipitation and analyzed by SDS-PAGE and immunoblotting using an HA-specific antibody. Unmodified and ubiquitylated forms of HA-Fzo1 are indicated as in 1B. (B) Ubiquitin chain-type analysis of Fzo1 upon Ubp2C745S expression. Crude mitochondrial extracts from wt or Δubp2 (expressing Ubp2C745S) cells expressing HA-Fzo1 endogenously, and overexpressing either wt ubiquitin (Ub) or UbK48R, were analyzed as in A. Unmodified and ubiquitylated forms of HA-Fzo1 are indicated as in 2B (C) Analysis of Ubp2 ubiquitin chain composition in Δubp12 cells. Soluble extracts from Δubp12 cells expressing Ubp2C745S-Flag and different ubiquitin variants (as indicated) were prepared and Flag-tagged Ubp2C745S was precipitated using Flag-coupled beads. The eluate was analyzed by SDS-PAGE and immunoblotting using antibodies against Flag and ubiquitin (Ub; αP4D1). (D) Deubiquitylation (DUB) assay using Ub2 chains. Purified di-ubiquitin chains (Ub2) composed of either only K48- or K63-linkages were treated with the purified DUBs Ubp12, USP21 and USP2. Treated chains were analyzed by SDS-PAGE and immunoblotting using a ubiquitin-specific antibody (Ub; αP4D1). Mono-ubiquitin or di-ubiquitin chains are labeled with Ub1 or Ub2, respectively. (E) DUB assay using Ub-chains. Purified poly-ubiquitin chains (Ub-chains) composed of either only K48- or K63-linkages were treated with the purified DUBs Ubp12, USP21 or USP2. Treated chains were analyzed by SDS-PAGE and immunoblotting as in C. Ubiquitin chains were labeled as in D with the subscript value indicating the amount of ubiquitin moieties in the respective chain. (F) Ubiquitylation pattern of Fzo1. Wt cells expressing HA-Fzo1 were analyzed for Fzo1 ubiquitylation upon the expression of Myc-ubiquitin, or the respective empty vector. HA-Fzo1 was immunoprecipitated from mitochondrial extracts using HA-coupled beads. Eluted Fzo1 was split into two and samples were analyzed by SDS-PAGE and immunoblotting using HA- or Myc-specific antibodies. Unmodified and ubiquitylated forms of HA-Fzo1 are indicated as in 1B. The composition of the additional species apparent upon co-expression of Myc-tagged ubiquitin is explained in the inset. PoS, PonceauS staining.
Opposite effects of Ubp12 and Ubp2 in Fzo1 stability. The turnover of HA-Fzo1 in wt, Δubp12, Δubp2 or Δubp12 Δubp2 cells was assessed after inhibition of cytosolic protein synthesis with cycloheximide (CHX), for the indicated time points in exponentially growing cultures. Samples were analyzed by SDS-PAGE and immunoblotting using a HA- and Hsp70-specific antibodies. Left panel, quantification of three independent experiments, including SD.
Characterization of the deubiquitylation reaction by Ubp12.
(A) Analysis of ubiquitin chain-type composition of Fzo1. Crude mitochondrial extracts from wt or Δubp12 mutant cells expressing HA-Fzo1, and over-expressing either wt ubiquitin (Ub) or ubiquitin with a K48R mutation (UbK48R), were solubilized, subjected to HA-immunoprecipitation and analyzed by SDS-PAGE and immunoblotting using an HA-specific antibody. Unmodified and ubiquitylated forms of HA-Fzo1 are indicated as in 1B. (B) Ubiquitin chain-type analysis of Fzo1 upon Ubp2C745S expression. Crude mitochondrial extracts from wt or Δubp2 (expressing Ubp2C745S) cells expressing HA-Fzo1 endogenously, and overexpressing either wt ubiquitin (Ub) or UbK48R, were analyzed as in A. Unmodified and ubiquitylated forms of HA-Fzo1 are indicated as in 2B (C) Analysis of Ubp2 ubiquitin chain composition in Δubp12 cells. Soluble extracts from Δubp12 cells expressing Ubp2C745S-Flag and different ubiquitin variants (as indicated) were prepared and Flag-tagged Ubp2C745S was precipitated using Flag-coupled beads. The eluate was analyzed by SDS-PAGE and immunoblotting using antibodies against Flag and ubiquitin (Ub; αP4D1). (D) Deubiquitylation (DUB) assay using Ub2 chains. Purified di-ubiquitin chains (Ub2) composed of either only K48- or K63-linkages were treated with the purified DUBs Ubp12, USP21 and USP2. Treated chains were analyzed by SDS-PAGE and immunoblotting using a ubiquitin-specific antibody (Ub; αP4D1). Mono-ubiquitin or di-ubiquitin chains are labeled with Ub1 or Ub2, respectively. (E) DUB assay using Ub-chains. Purified poly-ubiquitin chains (Ub-chains) composed of either only K48- or K63-linkages were treated with the purified DUBs Ubp12, USP21 or USP2. Treated chains were analyzed by SDS-PAGE and immunoblotting as in C. Ubiquitin chains were labeled as in D with the subscript value indicating the amount of ubiquitin moieties in the respective chain. (F) Ubiquitylation pattern of Fzo1. Wt cells expressing HA-Fzo1 were analyzed for Fzo1 ubiquitylation upon the expression of Myc-ubiquitin, or the respective empty vector. HA-Fzo1 was immunoprecipitated from mitochondrial extracts using HA-coupled beads. Eluted Fzo1 was split into two and samples were analyzed by SDS-PAGE and immunoblotting using HA- or Myc-specific antibodies. Unmodified and ubiquitylated forms of HA-Fzo1 are indicated as in 1B. The composition of the additional species apparent upon co-expression of Myc-tagged ubiquitin is explained in the inset. PoS, PonceauS staining.Opposite effects of Ubp12 and Ubp2 in Fzo1 stability. The turnover of HA-Fzo1 in wt, Δubp12, Δubp2 or Δubp12 Δubp2 cells was assessed after inhibition of cytosolic protein synthesis with cycloheximide (CHX), for the indicated time points in exponentially growing cultures. Samples were analyzed by SDS-PAGE and immunoblotting using a HA- and Hsp70-specific antibodies. Left panel, quantification of three independent experiments, including SD.
Ubp12-Ubp2 cascade activity impinges on Fzo1 ubiquitylation
Both Ubp12 and Ubp2 deubiquitylate Fzo1, but they clearly bind different forms of ubiquitylated Fzo1 (Anton et al., 2013). Ubp12 binds ubiquitylated forms of Fzo1 that stabilize Fzo1 and promote mitochondrial fusion. In turn, Ubp2 recognizes other ubiquitylated forms of Fzo1, that instead signal Fzo1 turnover thus preventing mitochondrial fusion. Given that Ubp12 acts upstream of Ubp2, we speculated that the pro-fusion ubiquitylated forms of Fzo1, Ubp12-specific, would also precede its Ubp2-specific anti-fusion forms. This predicts an impairment of anti-fusion forms in the absence of pro-fusion forms. Therefore, as previously, the mutant Fzo1K464R was chosen as a tool, because it loses the pro-fusion ubiquitylation (Figure 7A, inset, black arrows, compare lanes 1 and 2). Moreover, as in Figure 2B, the catalytically-inactive Ubp2C745S protein was expressed additionally. This allows visualization of the Ubp2-specific anti-fusion forms as well (Figure 7A, inset, red arrows, lane 3), resulting in a massive increase in overall ubiquitylation of Fzo1 (compare lanes 1 and 3). As predicted by our hypothesis, much of this increase was lost when K464 was mutated to R (compare lanes 3 and 4). This shows that Ubp2-dependent ubiquitylation largely requires previous K464-dependent ubiquitylation . Therefore, pro-fusion ubiquitylation, which stabilizes Fzo1, primes Fzo1 for the formation of anti-fusion ubiquitylation. These anti-fusion forms, instead, signal Fzo1 for proteasomal degradation, so that in Δubp2 cells Fzo1 is less abundant (Anton et al., 2013). Taking this into consideration, the steady state levels of Fzo1 were used as a read-out for the presence of anti-fusion ubiquitylation on Fzo1. We noticed that whereas the steady state levels of Fzo1 decreased by 91% inΔubp2 cells, as expected, the steady state levels of Fzo1K464R only decreased by 47% (Figure 7B). This shows that Fzo1K464R is much less sensitive to the deletion of UBP2 than wt Fzo1, consistent with a lower abundance of the anti-fusion ubiquitylation. To confirm this result, the levels of Fzo1 were also tested upon further deletion of MDM30 inΔubp2 cells, which encodes the E3 ligase-component responsible for pro-fusion ubiquitylation on Fzo1 (Cohen et al., 2008; Escobar-Henriques et al., 2006; Fritz et al., 2003). Indeed, we could observe a rescue of Fzo1 steady state levels inΔubp2 Δmdm30 cells, confirming that pro-fusion precedes anti-fusion ubiquitylation on Fzo1 (Figure 7C). We conclude that Ubp2-specific ubiquitylation of Fzo1 largely depends on Ubp12-specific ubiquitylation of Fzo1, indicating a regulatory cascade of Ubp12 and Ubp2 on Fzo1.
Figure 7.
Interdependent roles of Ubp2 and Ubp12.
(A) Effect of Ubp2C745S on Fzo1K464R ubiquitylation. HA-Fzo1 or HA-Fzo1K464R were expressed in the presence of Ubp2 (∆fzo1 cells plus empty vector) or instead in the presence of Ubp2C745S (∆ubp2 ∆fzo1 plus Ubp2C745S-Flag), as indicated. Crude mitochondrial extracts were solubilized and HA-tagged Fzo1 was analyzed by SDS-PAGE and immunoblotting using an HA-specific antibody. Unmodified and ubiquitylated forms of HA-Fzo1 are indicated as in 2B. (B) Effect of UBP2 deletion on the steady state levels of Fzo1K464R. Total cellular extracts of indicated strains expressing HA-Fzo1 or HA-Fzo1K464R as indicated were analyzed by SDS-PAGE and immunoblotting using HA- and Tom40-specific antibodies. Bottom panel, quantification of five independent experiments, including SD. (C) Effect of Ubp2 and Mdm30 on the steady state levels of Fzo1. Total cellular extracts of wt, Δubp2 and Δubp2 Δmdm30 cells expressing HA-tagged Fzo1 endogenously (HA-Fzo1int) were analyzed by SDS-PAGE and immunoblotting using HA- and Tom40-specific antibodies. Bottom panel, quantification of three independent experiments, including SD. PoS, Ponceau S staining.
Interdependent roles of Ubp2 and Ubp12.
(A) Effect of Ubp2C745S on Fzo1K464R ubiquitylation. HA-Fzo1 or HA-Fzo1K464R were expressed in the presence of Ubp2 (∆fzo1 cells plus empty vector) or instead in the presence of Ubp2C745S (∆ubp2 ∆fzo1 plus Ubp2C745S-Flag), as indicated. Crude mitochondrial extracts were solubilized and HA-tagged Fzo1 was analyzed by SDS-PAGE and immunoblotting using an HA-specific antibody. Unmodified and ubiquitylated forms of HA-Fzo1 are indicated as in 2B. (B) Effect of UBP2 deletion on the steady state levels of Fzo1K464R. Total cellular extracts of indicated strains expressing HA-Fzo1 or HA-Fzo1K464R as indicated were analyzed by SDS-PAGE and immunoblotting using HA- and Tom40-specific antibodies. Bottom panel, quantification of five independent experiments, including SD. (C) Effect of Ubp2 and Mdm30 on the steady state levels of Fzo1. Total cellular extracts of wt, Δubp2 and Δubp2 Δmdm30 cells expressing HA-tagged Fzo1 endogenously (HA-Fzo1int) were analyzed by SDS-PAGE and immunoblotting using HA- and Tom40-specific antibodies. Bottom panel, quantification of three independent experiments, including SD. PoS, Ponceau S staining.
Cdc48 mitochondrial phenotypes depend on Ubp2
To challenge the Cdc48-DUBs regulatory cascade, we first tested if the role of Cdc48 on Fzo1 steady state levels depended on Ubp2 and Ubp12. Indeed, and in contrast to wt cells, in ∆ubp2 ∆ubp12 cells the steady state levels of Fzo1 were insensitive to further mutating Cdc48 (Figure 8A). Moreover, ∆ubp2 cells and ∆ubp2 ∆ubp12 were similarly insensitive to the presence of the cdc48-2 allele (Figure 8B), consistent with the UBP2 UBP12 epistasis results (Figure 5A and Figure 5—figure supplement 1A and B). Next, we tested if overexpression of Ubp2 could rescue cdc48-2 phenotypes. This was to be expected because deletion of UBP12 rescues CDC48 mutant phenotypes but also leads to increased levels of Ubp2. Consistently, mitochondrial tubulation was significantly improved under these conditions (Figure 8C). Moreover, Ubp2 overexpression improved the growth defect of cdc48-2 cells on lactate media at the non-permissive temperature of 37°C, supporting the physiological impact of the Ubp2 levels in cdc48-2 cells (Figure 8D). Therefore, the respiratory capacity of the cdc48-2 cells could be improved not only by UBP12 deletion but also by overexpression of Ubp2. Finally, a physical interaction between Ubp2 and Cdc48 could be observed (Figure 8—figure supplement 1). Together our results highlight a model in which Cdc48, Ubp12 and Ubp2 orchestrate a multilayered cascade regulation, culminating on Fzo1 ubiquitylation and mitochondrial fusion.
Figure 8.
Cdc48 regulates mitochondrial fusion via Ubp12 and Ubp2.
(A) Steady state levels of Fzo1 in Δubp2 Δubp12 upon mutation of CDC48. Total cellular extracts of wt, cdc48-2, Δubp2 Δubp12 and Δubp2 Δubp12 cdc48-2 cells were analyzed by SDS-PAGE and immunoblotting using Fzo1- and Tom40-specific antibodies. Bottom panel, quantification of five independent experiments, including SD. (B) Steady state levels of Fzo1 in Δubp2 cells upon deletion of CDC48. Total cellular extracts of wt, cdc48-2, Δubp2 and Δubp2 cdc48-2 cells were analyzed by SDS-PAGE and immunoblotting using Fzo1- and Tom40-specific antibodies. Bottom panel, quantification of five independent experiments, including SD. (C) Mitochondrial morphology of cdc48-2 cells upon overexpression of Ubp2. Wt or cdc48-2 mutant cells expressing Ubp2 or the corresponding empty vector were analyzed for mitochondrial tubulation after expressing a mitochondrial-targeted GFP plasmid, as in Figure 1A. Quantification from three different experiments (with more than 200 cells each), including SE, as described (Cumming et al., 2007). ns, p>0.05. **p≤0.01, ***p≤0.001 (One-way ANOVA, Tukey’s multiple comparison test). (D) Role of Ubp2 overexpression on the respiratory capacity of CDC48-deficient cells. A spot assay was performed as described in Figure 4B with the indicated cells but using synthetic media supplemented with lactate (SCLac) and incubated for 4 days. PoS, Ponceau S staining.
Physical interaction between Ubp2 and Cdc48. The catalytically inactive variant Ubp2C745S-Flag or the corresponding empty vector were expressed in Δubp12 cells and analyzed for Cdc48 interaction, as in 2A. Crude mitochondrial extracts were lysed and Flag-tagged Ubp2C745S was precipitated using Flag-coupled beads. The eluate was analyzed by SDS-PAGE and immunoblotting using Flag- and Cdc48-specific antibodies. PoS, Ponceau S staining; IP, immunoprecipitation; WB, western blot.
Figure 8—figure supplement 1.
Cdc48 regulates mitochondrial fusion via Ubp12 and Ubp2.
Physical interaction between Ubp2 and Cdc48. The catalytically inactive variant Ubp2C745S-Flag or the corresponding empty vector were expressed in Δubp12 cells and analyzed for Cdc48 interaction, as in 2A. Crude mitochondrial extracts were lysed and Flag-tagged Ubp2C745S was precipitated using Flag-coupled beads. The eluate was analyzed by SDS-PAGE and immunoblotting using Flag- and Cdc48-specific antibodies. PoS, Ponceau S staining; IP, immunoprecipitation; WB, western blot.
Cdc48 regulates mitochondrial fusion via Ubp12 and Ubp2.
(A) Steady state levels of Fzo1 in Δubp2 Δubp12 upon mutation of CDC48. Total cellular extracts of wt, cdc48-2, Δubp2 Δubp12 and Δubp2 Δubp12 cdc48-2 cells were analyzed by SDS-PAGE and immunoblotting using Fzo1- and Tom40-specific antibodies. Bottom panel, quantification of five independent experiments, including SD. (B) Steady state levels of Fzo1 in Δubp2 cells upon deletion of CDC48. Total cellular extracts of wt, cdc48-2, Δubp2 and Δubp2 cdc48-2 cells were analyzed by SDS-PAGE and immunoblotting using Fzo1- and Tom40-specific antibodies. Bottom panel, quantification of five independent experiments, including SD. (C) Mitochondrial morphology of cdc48-2 cells upon overexpression of Ubp2. Wt or cdc48-2 mutant cells expressing Ubp2 or the corresponding empty vector were analyzed for mitochondrial tubulation after expressing a mitochondrial-targeted GFP plasmid, as in Figure 1A. Quantification from three different experiments (with more than 200 cells each), including SE, as described (Cumming et al., 2007). ns, p>0.05. **p≤0.01, ***p≤0.001 (One-way ANOVA, Tukey’s multiple comparison test). (D) Role of Ubp2 overexpression on the respiratory capacity of CDC48-deficient cells. A spot assay was performed as described in Figure 4B with the indicated cells but using synthetic media supplemented with lactate (SCLac) and incubated for 4 days. PoS, Ponceau S staining.Physical interaction between Ubp2 and Cdc48. The catalytically inactive variant Ubp2C745S-Flag or the corresponding empty vector were expressed in Δubp12 cells and analyzed for Cdc48 interaction, as in 2A. Crude mitochondrial extracts were lysed and Flag-tagged Ubp2C745S was precipitated using Flag-coupled beads. The eluate was analyzed by SDS-PAGE and immunoblotting using Flag- and Cdc48-specific antibodies. PoS, Ponceau S staining; IP, immunoprecipitation; WB, western blot.
Discussion
Precise regulation of cellular processes by protein ubiquitylation requires a tight control of the enzymes involved. We reveal a new mode of DUB regulation by Cdc48 for Fzo1 and mitochondrial fusion (Figure 9). This is likely of broader relevance for the regulation of DUBs and ubiquitin homeostasis.
Figure 9.
Synergistic regulation of mitochondrial fusion by the Cdc48 cascade.
Cdc48 supports turnover of Ubp12, stabilizing ubiquitylation on Fzo1 that promotes mitochondrial fusion (green ubiquitins). Moreover, degradation of Ubp12 stabilizes Ubp2, facilitating the removal of ubiquitin chains on Fzo1 inhibiting mitochondrial fusion (red ubiquitins). Thereby, Cdc48 activates mitochondrial fusion via Ubp12 and Ubp2. In contrast, Cdc48 impairment blocks progression of mitochondrial fusion by actively preventing Ubp12 turnover. Ubp12 then leads to a cascade of events inhibiting mitochondrial fusion: A) removal of the pro-fusion ubiquitylated forms and B) inhibition of Ubp2, consequently leading to the accumulation of the anti-fusion ubiquitylated forms. This cascade allows a synergistic effect of Cdc48, via a DUB regulatory cascade, to effectively promote or inhibit mitochondrial fusion.
Synergistic regulation of mitochondrial fusion by the Cdc48 cascade.
Cdc48 supports turnover of Ubp12, stabilizing ubiquitylation on Fzo1 that promotes mitochondrial fusion (green ubiquitins). Moreover, degradation of Ubp12 stabilizes Ubp2, facilitating the removal of ubiquitin chains on Fzo1 inhibiting mitochondrial fusion (red ubiquitins). Thereby, Cdc48 activates mitochondrial fusion via Ubp12 and Ubp2. In contrast, Cdc48 impairment blocks progression of mitochondrial fusion by actively preventing Ubp12 turnover. Ubp12 then leads to a cascade of events inhibiting mitochondrial fusion: A) removal of the pro-fusion ubiquitylated forms and B) inhibition of Ubp2, consequently leading to the accumulation of the anti-fusion ubiquitylated forms. This cascade allows a synergistic effect of Cdc48, via a DUB regulatory cascade, to effectively promote or inhibit mitochondrial fusion.
Synergistic function of Cdc48 in Fzo1 ubiquitylation
Cdc48 promotes degradation of Ubp12, controlling Fzo1 ubiquitylation. Ubp12 prevents mitochondrial fusion by two means. On the one hand, it removes the ubiquitylation on Fzo1 that is required for fusion. On the other hand, it promotes degradation of Ubp2. This leaves the anti-fusion ubiquitylation of Fzo1 unopposed, resulting in Fzo1 degradation. Therefore, by supporting turnover of Ubp12, Cdc48 dually preserves mitochondrial fusion events. In contrast, when only a non-functional variant of the protein is present, as is the case in cdc48-2 cells, Cdc48 cannot protect the pro-fusion ubiquitylation of Fzo1. In this case, the cascade will synergistically converge in degradation of Fzo1 and thus inhibition of mitochondrial fusion will occur. The interdependence between these two pathways contributes to a coordinated cellular decision by Cdc48 to either fuse mitochondria or instead prevent it by degrading Fzo1. Moreover, the Cdc48-Ubp12-Ubp2 cascade allows fine-tuning of substrate ubiquitylation and modulation of the biological processes thereof, as exemplified for Fzo1 and mitochondrial fusion (Figure 9).
Roles of Cdc48 on mitochondrial dynamics
Cdc48/p97 extracts ubiquitylated substrates from membranes, thus allowing their recognition and degradation by the proteasome (Franz et al., 2014; Rape et al., 2001). This is exemplified with the ER protein Ubc6, and was also shown for mitochondrial OM proteins (Neutzner et al., 2007), including mitofusins under damaging conditions (Tanaka et al., 2010). Therefore, Cdc48/p97 and ubiquitin regulate mitochondrial fusion in both yeast and mammals. Moreover, eukaryotes present a similar ubiquitin pattern of mitofusins, suggesting that the new function of Cdc48 presented here could be conserved in mammals under non-damaging conditions.
Critical role of the DUB cascade for mitochondrial fusion
Mitochondrial fusion is a complex multistep process dependent on sequential events involving GTP binding and hydrolysis by Fzo1, Fzo1 oligomerization and finally ubiquitylation of Fzo1 (Anton et al., 2011; Brandt et al., 2016; Cohen et al., 2011; Ishihara et al., 2004). Although it is clear that ubiquitin critically determines mitochondrial fusion events, the underlying mechanisms are largely unknown (Anton et al., 2013). The DUBs Ubp12 and Ubp2 cleave different ubiquitylated forms of Fzo1 that either promote or repress mitochondrial fusion, respectively (Anton et al., 2013). Here, given that Ubp12 regulates Ubp2, we show that these two ubiquitylation pathways are connected. Consistently, on Fzo1, Ubp12-specific ubiquitylation also precedes Ubp2-specific ubiquitylation. In fact, unopposed anti-fusion ubiquitylation, as it is the case in Δubp2 cells, disrupts mitochondrial tubulation. This renders the role of Ubp2 in mitochondrial dynamics quite clear, namely protecting mitochondrial fusion. In contrast, the need for a dedicated DUB that removes the pro-fusion ubiquitylation forms, i.e. the need for Ubp12, remained unclear. Now, the Ubp12-Ubp2 cascade allows to understand the purpose of Ubp12, solving the paradox of why inhibition of the pro-fusion ubiquitylation on Fzo1 is required: in fact, too much pro-fusion ubiquitylation also means too much anti-fusion ubiquitylation, a problem counteracted by the deubiquitylation activity of Ubp12 on Fzo1. We conclude that this cascade ensures a tight control of Fzo1 ubiquitylation at levels sufficient to allow mitochondrial fusion but preventing unnecessary ubiquitylation that instead targets Fzo1 for proteasomal turnover.
Which E3 ligases and DUBs modify Fzo1?
The cascade between Ubp12 and Ubp2 also allows revising recent results linking Ubp2 and Mdm30 (Cavellini et al., 2017). Mdm30 catalyzes the formation of the pro-fusion ubiquitin forms on Fzo1 (Cohen et al., 2008). The pro-fusion forms are bound and cleaved by Ubp12, depend on lysine 464 of Fzo1, and are essential for mitochondrial fusion (Anton et al., 2013). As to the anti-fusion ubiquitin forms on Fzo1, two types could now be observed: low molecular weight, K464-independent, anti-fusion ubiquitylation (as seen in Figure 7A, lane 4), consistent with previous results (Anton et al., 2013), but mostly high molecular weight anti-fusion ubiquitylation, instead K464-dependent (as seen in Figure 7A, lane 3). This shows that the anti-fusion ubiquitin forms on Fzo1 largely depend on its pro-fusion forms. Therefore, it is not surprising that anti-fusion, Ubp2-specific, ubiquitylation on Fzo1 also largely depends on Mdm30. Nevertheless, future studies are required to clarify if Mdm30 itself catalyzes the formation of this high molecular weight fraction of the anti-fusion ubiquitylation on Fzo1. Moreover, it is clear that Mdm30 is not the ligase responsible for the anti-fusion low molecular weight forms on Fzo1 (Anton et al., 2013), which therefore remains to be identified.
Our results unravel for the first time a regulatory cascade of two DUBs, Ubp12 and Ubp2, with opposing functions in ubiquitin homeostasis. A 20–40% depletion in ubiquitin levels leads to cellular growth defects under various stress conditions in yeast, to lethality or infertility in mice, and to neurological diseases like ataxia, gracile axonal dystrophy or Parkinson’s disease (Kimura and Tanaka, 2010; Park and Ryu, 2014). The level of free ubiquitin is adjusted to the cellular needs, and is critically regulated by deubiquitylase activity (Chernova et al., 2003; Swaminathan et al., 1999). Here, we reveal distinct roles of two DUBs - Ubp2 and Ubp12 - for the maintenance of ubiquitin homeostasis. Δubp12 cells are hyperresistant to cycloheximide (CHX), a chemical inhibitor of protein translation. Similar observations were previously reported in proteasome mutants, with impaired proteolysis (Gerlinger et al., 1997). Consistently, just like proteasome mutants, also Δubp12 cells accumulate conjugated ubiquitin, without affecting the levels of free ubiquitin. In turn, Δubp2 cells showed a 40% depletion of free ubiquitin and hypersensitivity to CHX, consistent with similar observations in strains presenting decreased free ubiquitin levels (Hanna et al., 2003). Nevertheless, along with reduced free ubiquitin, deletion of UBP2 also clearly led to increased levels of ubiquitin conjugates, as observed upon DmUsp5 depletion in the fruit fly (Kovács et al., 2015). In fact, the importance of free ubiquitin pools versus ubiquitin conjugates for cellular growth is not well understood. Our analysis of Δubp2 cells sheds light on this question, demonstrating that depletion of free ubiquitin is epistatic over the accumulation of ubiquitylated conjugates for cellular growth.
Differences in DUB behavior
What could justify the opposite behavior of Ubp2 and Ubp12 in ubiquitin homeostasis and substrate turnover? The removal of ubiquitin from a substrate is generally expected to increase its stability, as observed for Fzo1 in Δubp2 cells. Consistently, Ubp2 appears as a general quality control deubiquitylase recognizing both K48- and K63-linked ubiquitin chains that signal for turnover, both by the UPS and by the lysosome (Anton et al., 2013; Fang et al., 2016; Ho et al., 2017; Silva et al., 2015). In contrast, the turnover of both Fzo1 and Ubp2 is decreased in Δubp12 cells. Moreover, Ubp12 does not stabilize Rad23 (Gödderz et al., 2017) and Gpa1 (Wang et al., 2005), i.e. its two other known substrates. Ubp12 exhibits a broad substrate specificity in vitro recognizing both K48- and K63-linked chains, consistent with previous observations (Schaefer and Morgan, 2011). Thus, it is not Ubp12 but the substrate that behaves unexpectedly. Notably, the ubiquitin signals that accumulate in Fzo1, Ubp2, Rad23 and Gpa1 are all composed of a limited number of discrete bands, instead of the high molecular weight smear, typical for polyubiquitylated substrates. For Fzo1, we find that Ubp12 recognizes ubiquitylated forms that only contain two ubiquitin moieties that are linked via K48. We propose that the presence of a short number of ubiquitin molecules on the ubiquitin chains recognized by Ubp12 could explain why they do not serve as a good signal for proteasomal degradation. The protein Met4 was also shown to be ubiquitylated with a a limited number of discrete bands (Flick et al., 2004; Kuras et al., 2002). In this case, intramolecular association with a ubiquitin binding domain in Met4 shields the ubiquitin chains, thus preventing their elongation and protecting Met4 against proteasomal degradation (Flick et al., 2006; Tyrrell et al., 2010).
Regulation of DUB activity by ubiquitin
How deubiquitylation is controlled is poorly understood. Our findings suggest that this involves ubiquitylation of the DUBs themselves, because both Ubp2 and Ubp12 are regulated by ubiquitylation. This consequently renders DUBs interdependent, as exemplified with Ubp12 being the DUB of Ubp2. Interestingly, several examples in the literature illustrate a big diversity of DUB regulation (Michel et al., 2017). Therefore, additional mechanisms to proteolysis for the atypical function of Ubp2 ubiquitylation can be proposed. For example, Ubp2 ubiquitylation could induce a conformational change favouring catalytic activity, as observed for the DUB ATXN3 (Todi et al., 2010). This is supported by the observation that Ubp2 is among the largest yeast DUBs. In addition, several residues of Ubp2 were found to be phosphorylated (Swaney et al., 2013), suggesting that coordinated ubiquitylation/phosphorylation events could increase its activity. Finally, given that many DUBs often act as part of protein complexes, Ubp2 ubiquitylation could favor its interaction with Ubp12 and/or Cdc48. This could release autoinhibition by a conformational change, as observed for the DUB Ubp6 upon binding to the proteasome, i.e. a AAA+ ATPase like Cdc48 (Hanna et al., 2006). In fact, Cdc48 has been shown to associate with several DUBs (Ossareh-Nazari et al., 2010; Papadopoulos et al., 2017; Rumpf and Jentsch, 2006; Uchiyama et al., 2002) but also recognizes ubiquitylated proteins, consistent with its interaction with both Ubp12 and Ubp2. Therefore, DUB ubiquitylation could allow recruitment of Cdc48 and provide a platform guiding DUBs to their relevant substrates. This would also justify the need for Fzo1-Cdc48 physical interaction. In fact, a local regulation of Fzo1 by Cdc48 could allow increased efficiency of the Cdc48-DUB cascade on Fzo1 regulation.In conclusion, our results suggest that Cdc48 serves as a binding platform allowing cross-talk regulation between DUBs, bringing new insights into the knowledge of ubiquitin biology. These general findings open new perspectives to address some poorly understood questions, e.g. how Cdc48 regulates homotypic fusion events and how DUBs are interdependently regulated, possibly accounting for the multitude of DUBs present in a cell.
Materials and methods
Yeast strains and growth media
See Table 1 for details of all yeast strains used. Except for Δpdr5 Δsnq2 (YGA58, from J. Dohmen) and ufd1-2, npl4-1 and their corresponding wild type (DF5, from S. Jentsch) all other yeast strains are isogenic to the S288c (Euroscarf). They were grown according to standard procedures to the exponential growth phase at 30°C (unless stated otherwise) on complete (YP) or synthetic (SC) media supplemented with 2% (w/v) glucose (D), 2% (w/v) galactose or 2% (w/v) lactate (Lac). Cycloheximide (CHX) (Sigma, Germany) (100 µg/ml for protein shut-down, or 0.5 μg/ml when indicated, from a stock of 10 mg/ml in H2O) or MG132 (Calbiochem) (50 or 100 μM from a stock of 10 mM in DMSO) was added when indicated.
Table 1.
Yeast strains used in this study.
Strain #
Strain name
Genotype
Reference
FA2
∆fzo1
FZO1::kanMX4 in BY4741
Brachmann et al., 1998
FA230
cdc48-1
cdc48-1::KanMX4 in BY4741
Li et al. (2011)
FA231
cdc48-2
cdc48-2::KanMX4 in BY4741
Li et al. (2011)
FA232
cdc48-3
cdc48-3::KanMX4 in BY4741
Li et al. (2011)
FA260
∆ubp2
UBP2::kanMX4 in BY4741
Brachmann et al., 1998
FA269
∆ubp12
UBP12::kanMX4 in BY4741
Brachmann et al., 1998
FA362
∆fzo1 ∆ubp2
FZO1::kanMX4; UBP2::kanMX4; obtained by crossing
Anton et al. (2013)
FA382
∆ubp2 ∆ubp12
UBP12::kanMX4; UBP2::kanMX4; obtained by crossing
Anton et al. (2013)
FA390
∆ubp12 ∆mdm30
UBP12::kanMX4; MDM30::kanMX4; obtained by crossing
this study
FA407
HA-Fzo1int in wt
HA-Fzo1 genomically integrated with NatNT2 into RS140
Anton et al. (2013)
FA415
HA-Fzo1int in ∆ubp2
HA-Fzo1 genomically integrated with NatNT2 into FA260
Anton et al. (2013)
FA427
HA-Fzo1int in ∆ubp2 ∆mdm30
HA-Fzo1 genomically integrated with NatNT2 into ∆ubp2 ∆mdm30
Anton et al. (2013)
FA432
∆fzo1 ∆ubp12
FZO1::kanMX4; UBP12::kanMX4; obtained by crossing
this study
FA451
HA-Fzo1-K464Rint in wt
HA-Fzo1K464R genomically integrated with NatNT2 into RS140
Ubp2-9Myc genomically integrated with NatNT2 into RS140
this study
TS1144
Ubp2-3HAint in wt
Ubp2-3HA genomically integrated with hphNT1 in RS140
this study
TS1147
Ubp2-3HAint in ∆ubp12
Ubp2-3HA genomically integrated with hphNT1 in FA269
this study
TS1153
pGAL-Ubp12-Flagint in wt
pGAL-Ubp12-Flag genomically integrated with kanMX4 into RS544
this study
Plasmids
All plasmids used in this study are described in Table 2. Plasmid #65, encoding a non-tagged Ubp12C372S variant, expressed under the control of the ADH1 promoter, was amplified from Ubp12C372S-Flag and cloned with Pst1, Sal1 into the same sites of YEplac195. Plasmid #150, encoding Cdc48A547T was generated by point mutagenesis using plasmid #75.
Table 2.
Plasmids used in this study.
Plasmid #
Plasmid name
Description
Bacterial selection
Reference
8
pRS316
pRS316, cen, Ura3
Amp
Sikorski and Hieter, 1989
10
HA-Fzo1 on pRS316
HA-Fzo1 on pRS316, Fzo1 prom, cen, Ura3
Amp
Anton et al. (2013)
14
HA-Fzo1-K464R on pRS316
HA-Fzo1K464R on pRS316, Fzo1 prom, cen, Ura3
Amp
Anton et al. (2013)
58
YEplac181
YEplac181, 2µ, Leu2
Amp
Gietz and Sugino, 1988
59
Ubp2-Flag on YEplac181
Ubp2-Flag on YEplac181, Adh1 prom, 2µ, Leu2
Amp
Anton et al. (2013)
60
Ubp2-C745S-Flag on YEplac181
Ubp2C745S-Flag on YEplac181, Adh1 prom, 2µ, Leu2
Amp
Anton et al. (2013)
61
Ubp12-Flag on YEplac181
Ubp2-Flag on YEplac181, Adh1 prom, 2µ, Leu2
Amp
Anton et al. (2013)
62
Ubp12-C372S-Flag on YEplac181
Ubp2C372S-Flag on YEplac181, Adh1 prom, 2µ, Leu2
Amp
Anton et al. (2013)
63
YEplac195
YEplac195, 2µ, Ura3
Amp
Gietz and Sugino, 1988
65
Ubp12C372S on YEplac195
Ubp12C372S (non-tagged) on YEplac195, 2µ, Ura3
Amp
this study
70
mt-GFP on pYX142
mt-GFP on pYX142, cen, Leu2
Amp
Westermann and Neupert, 2000
75
Cdc48 wt on pRS313
Cdc48 wt on pRS313, cen, His3
Amp
Esaki and Ogura (2012)
79
pRS313
pRS313, cen, His3
Amp
Sikorski and Hieter, 1989
150
Cdc48-A547T on pRS313
Cdc48A547T on pRS313, cen, His3
Amp
this study
341
Ub on pKT10
Ub on pK10, 2µ, Ura3
Amp
Tanaka et al., 1990
342
Ub-K48R on pKT10
UbK48R on pK10, 2µ, Ura3
Amp
Tanaka et al., 1990
343
Ub-K63R on pKT10
UbK63R on pK10, 2µ, Ura3
Amp
Tanaka et al., 1990
344
Ub-K48R,K63R on pKT10
UbK48R,K63R on pK10, 2µ, Ura3
Amp
Tanaka et al., 1990
356
Myc-Ub on pRS426
pCup1-Myc-Ub on pRS426, 2µ, Ura3
Amp
Li et al., 2015
375
pRS426
pRS426, 2µ, Ura3
Amp
Li et al., 2015
Antibodies
All antibodies used in this study are described in Table 3.
Table 3.
Antibodies used in this study.
Name
Dilution
Reference
Cdc48
1:1000/1:10,000
T. Sommer
Cox2
1:5000
W. Neupert
Flag M2
1:1000
Sigma (F1804)
Fzo1
1:1000
this study
HA
1:1000
Roche (11867423001)
Myc
1:1000
Cell Signaling (#2276)
Sec61
1:10,000
T. Sommer
Ssc1
1:40,000
Fölsch et al., 1998
Tom40
1:40,000
W. Neupert
Tpi1
1:5000
J. Dohmen
Ub (P4D1)
1:1000
Cell Signaling (#3936)
Ubc6
1:10,000
T. Sommer
Ubp12
1:200
this study
Spot tests
For growth assays, serial 1:5 dilutions of exponentially growing cells using a starting OD600 of 0.5 or 0.005 were spotted on YP or SC media containing glucose or lactate and were grown at 30°C or 37°C, as indicated.
Protein steady state levels and synthesis shutoff
For analysis of protein steady state levels, total proteins from 3 OD600 exponentially growing cells were extracted at alkaline pH (Escobar-Henriques et al., 2006) and analyzed by SDS-PAGE and immunoblotting. To monitor protein turnover, cycloheximide (100 µg/ml) was added to exponential cells. Samples of 3 OD600 cells were collected at the indicated time points and total proteins were extracted and analyzed as described above. For monitoring proteasome-dependent degradation of endogenous Fzo1 in wt and cdc48-2 cells, additionally deleted for SNQ2 and PDR5, YPD media was used (Liu et al., 2007), and cells were treated with 50 μM MG132, 30 min before adding cycloheximide. For monitoring proteasome-dependent degradation of Ubp2, expressed from plasmid #59, SCD media was used, and 50 μM MG132 was added 1 hr before starting the cycloheximide chase. Western blots were quantified using Image Quant (GE Healthcare, Illinois, USA). Levels of the protein of interest at time zero were set to 1. Mean values are shown and the error bars reflect the standard deviation (SD).
Analysis of free ubiquitin and ubiquitin-conjugates
Total proteins were extracted as described above for the analysis of protein steady state levels but solubilized in LDS buffer (Thermo Fisher Scientific, Massachusetts, USA). Samples were run on precast 4–12% bis-tris gels (Thermo Fisher Scientific) using MES buffer (50 mM MES, 50 mM Tris Base, 0.1% SDS, 1 mM EDTA, pH 7.3) and transferred to PVDF membranes. Membranes were treated with denaturing solution (6 M guanidium chloride, 20 mM Tris pH 7.5, 1 mM PMSF, 5 mM β-mercaptoethanol) for 30 min and then washed before blocking. Proteins were detected with a ubiquitin-specific antibody (P4D1; Cell Signaling, Massachusetts) and a Tpi1-specific antibody, as a loading control. Quantifications were performed using Image Quant (GE Healthcare). Wt values were set to one and the mutants are shown in relation to the wt. Mean values are shown and the error bars reflect the standard deviation (SD).
Analysis of Ubp12 ubiquitylation
Immunoprecipitation of Ubp12C372S-Flag was performed as follows: 160 OD600 of yeast cells grown in SCD media to the exponential growth phase were disrupted with glass beads (0.4–0.6 µm) in TBS. After centrifugation, at 16000 g for 10 min, the supernatant was employed to perform an overnight precipitation of Ubp12C372S-Flag, using Flag-coupled beads (Sigma-Aldrich). Elution was performed for 2 hr shaking at 4°C with the 3xFlag-peptide (Sigma; 200 µg/ml final concentration) in the following buffer: 50 mM Tris-HCl pH 7.5, 50 mM NaCl. After adding Laemmli buffer, the eluate was split in two, proteins were then resolved in 7% Tris-acetate gels as described (Cubillos-Rojas et al., 2012). After transfer, the nitrocellulose membrane was divided in two: one half was immunoblotted with a Flag-specific (Sigma) and the other half with a ubiquitin-specific antibody (P4D1; Cell Signaling).
Analysis of Ubp2 ubiquitylation
Immunoprecipitation of Ubp2C745S-Flag was performed as follows: 160 OD600 of yeast cells grown in SCD media to the exponential growth phase were disrupted with glass beads (0.4–0.6 µm) in RIPA buffer without detergents (HEPES-KOH 40 mM pH 7.6, NaCl 150 mM, EDTA 5 mM). After centrifugating at 16000 g for 10 min, the supernatant was diluted in an equal volume of RIPA buffer containing 2X detergents, so that the final composition was HEPES-KOH 40 mM pH 7.6, NaCl 150 mM, EDTA 5 mM, Triton X100 1%, SDS 0.1%, sodium deoxycholate 0.5%. After sonication for 15 min at 4°C in a water bath, denatured cytosolic fractions were employed to precipitate Ubp2C745S-Flag. Flag-coupled beads (Sigma-Aldrich) were used for overnight immunoprecipitation and protein elution was performed with Laemmli buffer for 20 min shaking at 40°C. The eluate was split in two and resolved in 8% Tris-glycine gels. After transfer, the nitrocellulose membrane was divided in two: one half of the eluate was immunoblotted with a Flag-specific (Sigma) and the other half with a ubiquitin-specific antibody (P4D1; Cell Signaling).
Analysis of Fzo1 ubiquitylation
Fzo1 ubiquitylation was analyzed as follows: 160 OD600 cell pellets of exponentially growing cultures were used to obtain crude mitochondrial extracts as described (Anton et al., 2013). After solubilization with 0.2 % NG310 (Lauryl Maltose Neopentyl Glycol; Anatrace) for 1 hr rotating at 4°C, samples were centrifuged and 10% of the supernatant was kept as input material. After denaturing in Laemmli buffer for 20 min shaking at 40°C samples were resolved by SDS-PAGE. If necessary, the remaining 90% of the supernatant was incubated with HA-coupled beads (Sigma-Aldrich) overnight rotating at 4°C. Three washes were performed with 0.2 % NG310 in TBS. HA-Fzo1 was eluted in 50 µl of Laemmli buffer for 20 min shaking at 40°C and analyzed by SDS-PAGE. Proteins were transferred onto nitrocellulose membranes and subsequently immunoblotted using an HA-specific antibody (Roche, Switzerland).
Co-immunoprecipitations
Interaction between Ubp12-Flag and Cdc48
160 OD600 of yeast cells grown in complete media to the exponential growth phase were disrupted with glass beads (0.4–0.6 µm) in TBS. After centrifugation at 16000 g for 10 min, the crude membrane fraction was solubilized using 0.5% digitonin for 1 hr rotating at 4°C. Ubp12C372S-Flag was immunoprecipitated using Flag-coupled beads (Sigma-Aldrich) for 2 hr rotating at 4°C. Beads were washed three times with 0.1% digitonin in TBS and Ubp12C372S-Flag was eluted in Laemmli buffer for 20 min shaking at 40°C. 10% of the input and 100% of the eluate fractions were analyzed by SDS-PAGE and immunoblotting using Flag-specific (Sigma) and Cdc48-specific antibodies.
Interaction between HA-Fzo1 and Cdc48
Performed as described above for the Ubp12-Cdc48 interaction, with the following modifications: solubilization was performed with 0.2 % NG310; immunoprecipitation was performed for 2 hr using HA-coupled beads (Sigma-Aldrich) pre-blocked with PVPK30 (Polyvinylpyrrolidone; Fluka); washes were performed with 0.2 % NG310 in TBS. 4% of the input and 50% of the eluate fractions were analyzed by SDS-PAGE and immunoblotting using HA-specific (Roche) and Cdc48-specific antibodies.
Interaction between Ubp2-Flag and Ubp12
Immunoprecipitation of Ubp12C372S was performed as follows: 160 OD600 of yeast cells grown in SCD media to the exponential growth phase were disrupted with glass beads (0.4–0.6 µm) in TBS. After centrifugation at 16000 g for 10 min, the cytosolic fraction was used to precipitate Ubp12C372S by using an Ubp12-specific antibody and the affinity resin with protein G immobilized (Protein G Sepharose 4 Fast Flow; GE Healthcare). After 3 hr rotating at 4°C, beads were washed three times in TBS. Protein elution was performed with Laemmli buffer for 20 min shaking at 40°C. 1% of the input and 100% of the eluate were analyzed by SDS-PAGE and immunoblotting using Flag- and Ubp12-specific antibodies.
Mitochondrial morphology
Yeast strains were transformed with mitochondrial-targeted GFP, grown on YPD or SC media to the exponential phase and analyzed as described (Escobar-Henriques et al., 2006) by epifluorescence microscopy (Axioplan 2; Carl Zeiss MicroImaging, Inc., Germany) using a 100x oil-immersion objective. Images were acquired with a camera (AxioCam MRm, Carl Zeiss MicroImaging, Inc.) and processed with Axiovision 4.7 (Carl Zeiss MicroImaging, Inc.).
Analysis of mtDNA content using RT-PCR
RNA was isolated from 2 OD600 exponentially growing yeast cells using the NucleoSpin RNA kit (Macherey Nagel, Germany). cDNA was synthesized using the SuperScript III First-Strand Synthesis System (Invitrogen, Massachusetts, USA). mtDNA was quantified by the amplification of COX3 and normalized to ACT1 (as housekeeping gene). Essentially, a dilution of 1:100 of the cDNA was used for the amplification of COX3 (fw: TTGAAGCTGTACAACCTACC; rv: CCTGCGATTAAGGCATGATG) and ACT1 (fw: CACCCTGTTCTTTTGACTGA; rv: CGTAGAAGGCTGGAACGTTG) by RT-PCR using the Power SYBR Green Master Mix (AppliedBioSystems) and three technical replicates for each of the six biological replicates. The ∆CT was calculated using the Livak/2-∆∆CT method (Livak and Schmittgen, 2001) and the fold change of COX3 RNA content in ∆fzo1 and cdc48-2 was calculated in relation to wt.
DUB assay
In vitro deubiquitylation assays were performed as described (Hospenthal et al., 2015), Essentially, purified K48 or K63 multi-Ub (BostonBiochem) or di-Ub chains (kindly gifted by Thomas Hermanns) were treated with the DUBs USP2 (BostonBiochem), USP21 (kindly gifted by Selver Altin) or Ubp12. Ubp12 was purified as described above, for the analysis of Ubp12 ubiquitylation, but glycerol to the final concentration of 10% was added, instead of Laemmli. Aliquots of 18 µl, corresponding to 80 OD600 yeast cells, were frozen in liquid nitrogen and stocked at −80°C until further use. For the DUB assay, per reaction, one aliquot of purified Ubp12-flag, 3 µM USP2 or 5 µM USP21 were pre-incubated with 1x DUB dilution buffer (25 mM Tris pH 7.5, 10 mM DTT, 150 mM NaCl) for 10 min at RT.After pre-incubation, the DUBs were mixed with di- or multi-Ub chains to a final concentration of 5 µM in 1x DUB buffer (10x DUB buffer: 500 mMTris pH 7.5, 500 mMNaCl, 50 mM DTT). Different incubation conditions were used: Ubp12 was incubated with the Ub chains for 45 min at 30°C, USP2 and USP21 for 30 min at 37°C. The reactions were stopped by adding 4x Laemmli buffer. These mixtures were incubated for 20 min at 40°C shaking and further run on an 11% Tris-Tricine SDS-PAGE and transferred onto a PVDF membrane. Ponceau S was used to stain the membrane and after destaining with methanol for 5 min, the membrane was incubated in denaturing solution (6M guanidium chloride, 20 mMTris pH 7.5, 1 mM PMSF, 5 mMβ-mercaptoethanol) for 30 min. Extensive washing was done in TBS-T before blocking the membrane over night with 5% milk in TBS. Results were analyzed by immunoblotting using a Ub-specific antibody.In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.Thank you for submitting your article "Cdc48 regulates a deubiquitylase cascade critical for ubiquitin homeostasis and mitochondrial fusion" for consideration by eLife. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by a Guest Reviewing Editor and Vivek Malhotra as the Senior Editor. The reviewers have opted to remain anonymous.The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.Summary:This manuscript investigates the regulation of Fzo1 during mitochondrial fusion. The authors focus specifically on how the conserved AAA ATPase Cdc48 together with two deubiquitinating enzymes (DUBs), Ubp12 and Ubp2, control Fzo1 ubiquitination status and its activity in mitochondrial fusion. It is shown that the two DUBs not only control the activity of Fzo1 but also of each other. In particular, Ubp2 levels are controlled by Ubp12. On the other hand, Cdc48 regulates Ubp12 stability suggesting that a cascade of ubiquitination events finely tunes Fzo1 fusogenic activity.Essential revisions:While all three reviewers find the results potentially interesting the following points must be addressed to solidify the key conclusion of this study.1) The main claims of this manuscript rely on the degradation of DUBs under strong overexpression. Thus, the evaluation of Ubp2 and Ubp12 half-lives should be re-analyzed and characterized under endogenous expression.2) The negative regulation of Ubp2 by Ubp12 is a central point of model proposed but not fully characterized. In principle the removal of ubiquitin from a substrate should increase and not decrease its stability so the authors should clarify how Ubp2 is destabilized by Ubp12.3) The statistical analysis of numerous data should be improved.The comments of the individual reviewers are pasted below. You might want to address the additional concerns of the reviewers in case you can.Reviewer #1:The manuscript by Simões et al. entitled "Cdc48 regulates a deubiquitylase cascade critical for ubiquitin homeostasis and mitochondria fusion" studies the function of the AAA+ Atpase Cdc48 in mitochondrial fusion. Cdc48 is a ubiquitin selective segregase chaperone that assists proteasomal degradation of a myriad of substrates, including proteins localized to the mitochondrial outer membranes. It was previously shown that in Parkin-mediated mitophagy in mammalian cells, the Cdc48 homologue p97 can directly target mitofusin for degradation. This process is required for fragmentation of mitochondrion and subsequent mitophagy. In this study, the authors report a distinct function of Cdc48 in mitochondrial dynamics. In this case, the regulation is executed through two deubiquitynases (DUBs) that appear to form a cascade. The genetic evidence presented are nice and convincing, but there are some technical concerns on the biochemical part of the study. The major issue is that the study relies too much on using overexpressed DUBs as Cdc48 substrate. In addition, the integrity of the proposed model depends on some assumptions that are uncertain.Specific points:1) The conclusions of this study rely heavily on overexpression of tagged deubiquitylases as the substrate of Cdc48. Considering the reported role of Cdc48 in diverse protein quality control processes, the authors need to exclude the possibility that overexpressed Ubp12 and Ubp2 are short-lived because of a potential misfolding issue caused by protein overexpression. One way to address this is to tag these DUBs endogenously and analyze their stability in wild type and Cdc48 mutant cells by cycloheximide chase.2) In Figure 2, the authors show an interaction between Cdc48 and Fzo1 that is dependent on Fzo1 ubiquitination. However, it is unclear what is the functional consequence of this interaction. Is it also unclear whether the interaction is direct or indirect. In the subsection “Cdc48 supports turnover of ubiquitylated Ubp12”, the conclusion that Cdc48 specifically interacts with pro-fusion ubiquitin is not supported by any data.3) In Figure 3, the authors try to demonstrate that Ubp12 is an unstable protein that is degraded in a Cdc48 dependent manner. All the experiments were done with overexpressed Ubp12. The authors should analyze the stability of endogenous Ubp12. In addition, several experiments shown are incomplete (e.g. Figure 3B, also Figure 5B, C). These experiments should include a cdc48 mutant for comparison.4) Figure 6 shows that the stability of Ubp2 is regulated by Ubp12. Once again, only overexpressed Ubp2 was studied. It is also puzzling why loss of Ubp12 can stabilize Ubp2, because DUB deficiency usually leads to increased ubiquitination and turnover. The quality of Figure 5D needs to be improved.5) The authors argue that there are two forms of ubiquitinated Fzo1; one supports mitochondrial fusion while the other mitigates it, but the nature of the pro-fusion ubiquitination is unclear. The authors should consider analyzing the ubiquitin linkages on Fzo1 that is accumulated in Ubp12 mutant cells. This is an important issue because it is a bit hard to understand how Ubp12 can act on two different kinds of ubiquitin signals; the one on Fzo1 is incompetent for degradation, but the one on Ubp2 seems to influence its stability in a way that is counter-intuitive. Thus, in my opinion, to make the model convincing, the authors need to characterize the Ubp2-mediated deubiquitination reaction in more detail. What kind of linkage is preferred by Ubp12? Are Ubp2 and Fzo1 conjugated with the same type of ubiquitin chains preferred by Ubp12? Do these chains increase protein stability as oppose to target them for degradation?6) "Fzo1 ubiquitination requires its lysine 464." If Fzo1 carries two types of ubiquitin chains, are they both attached to lysine 464? If yes, how are these processes coordinated? If not, where is the pro-fusion ubiquitin chain attached?Reviewer #2:The manuscript by Simoes et al. describes a novel function of the evolutionary highly conserved AAA-ATPase Cdc48, which is a potent modulator of neurodegenerative diseases. The authors convincingly demonstrate that Cdc48 controls mitochondrial fusion by a novel deubiquitylase (DUB) cascade at the level of the mitochondrial fusion factor Fzo1. Cdc48 is needed for mitochondrial fusion, and its mutation interferes with the formation of the mitochondrial network. Cdc48 and two DUBs control Fzo1 levels by discrete ubiquitylation patterns: A stable pro-fusion ubiquitylation pattern and an instable pro-degradation ubiquitylation pattern. The pro-fusion ubiquitylation pattern is removed by the DUB, Ubp12, thereby inhibiting mitochondrial fusion. The pro-degradation ubiquitylation pattern is removed by the DUB, Ubp2, thereby stabilizing Fzo1 and promoting mitochondrial fusion. The level of complexity is increased by the fact that Ubp12 is required for UPS-dependent degradation of Ubp2. Thus, high levels of Ubp12 interfere with mitochondrial fusion by two mechanisms: First, the removal of the pro-fusion ubiquitylation pattern from Fzo1, and second the induction of Ubp2 degradation, which results in the degradation of Fzo1. Therefore, controlling Ubp12 activities by Cdc48 enables the fine-tuning of Fzo1-dependent mitochondrial fusion.This study is of outstanding interest for researchers working on mitochondrial dynamics and the UPS-dependent control of mitochondrial activities. Since the human homolog of Cdc48 is a modulator of human disease, this study is potentially also important for the elucidation of novel disease mechanisms. Publication of this very well written manuscript can be recommended after the authors address the concerns outlined below.1) Data in Figure 5 suggest that a DUB, Ubp12, is required for degradation of Ubp2. The authors show that Ubp2 is ubiquitylated and stabilized in the absence of Ubp12. In the presence of Ubp12, the ubiquitylated form of Ubp2 cannot be found and Ubp2 is degraded by the proteasome. In other words, the authors propose a model in which deubiquitylation of Ubp2 by Ubp12 promotes its degradation by the proteasome. It is very surprising that removal of ubiquitin from a substrate, rather than its addition to it, triggers proteasome-dependent degradation. In my eyes, this requires further explanations, ideally with additional experiments. I consider this an essential point, because the negative regulation of Ubp2 by Ubp12 is a central point of the authors' model.2) The term "ubiquitin homeostasis" should be removed from the title, as this has not been addressed in the paper.3) The authors did not use any statistical analysis (like Student's t-test or ANOVA) to substantiate their numerous quantifications. Moreover, they used standard errors instead of standard deviations for error bars. Since standard errors underrepresent the variance of data the authors have to show all their quantitative data with standard deviation. Alternatively, they can keep standard errors as error bars but must then provide appropriate statistical analysis.In particular, the effects shown in Figure 4C, Figure 4—figure supplement 1F and Figure 7C are rather moderate and must be substantiated by a more rigorous statistical analysis. If these results turn out to be not significant, the associated statements and conclusions have to be toned down accordingly.Reviewer #3:In their work entitled “Cdc48 regulates a deubiquitylase cascade critical for ubiquitin homeostasis and mitochondrial fusion", Escabor-Henriques and coworkers investigate the mechanism by which the ATPase Cdc48 regulates Fzo1 mediated mitochondrial fusion. The major claims are that (1) Cdc48 action stabilizes so-called "pro-fusion" ubiquitylation of Fzo1 by promoting the degradation of the deubiquitylase Ubp12. (2) Concomitantly, reduced Ubc12 levels result in a stabilization of Ubp2 which in turn reduces "anti-fusion" ubiquitylation, contributing to Fzo1 stability.The findings presented in this manuscript are certainly interesting as they give more mechanistic detail on the earlier finding by the same group that the two DUBs Ubp2 and Ubp12 regulate mitochondrial fusion (Anton et al. 2013), and provide an explanation for the observation by Esaki and Ogura (2012) that Cdc48 plays a role in mitochondrial fusion.I do have some concerns though that should be addressed before publishing:1) An important finding of this work is that the DUB Ubp12 is degraded in a Cdc48-dependent manner. Data for this is presented in Figure 3. In these experiments (and in others in which a DUB is expressed from a plasmid), Ubp12 is strongly overexpressed from a 2µ plasmid with the strong ADH promoter (as described in Anton et al., 2013). It is possible that degradation occurs because of the overexpression, e.g. because of then sub-stoichiometric amounts of a binding partner that normally stabilizes Ubp12. There are many examples in the literature for the degradation of orphan subunits in the literature, that are otherwise stable proteins (e.g. 1: Braun and Jentsch, 2007, EMBO Rep. 8(12):1176-82; 2: Habeck et al., 2015, JCB 209(2):261-73). I suggest that either this experiment is repeated using a chromosomally tagged version of Ubp12 under its endogenous promoter or that the possibility of an artifact due to overexpression is at least discussed. The latter would suffice in my opinion because the interplay of Cdc48 and Ubp12 is nicely shown in the following Figure 4 and its supplement.2) In Figure 2A, the authors provide evidence that Cdc48 is physically interacting with Fzo1, depending on ubiquitin(-chains) on K464. What is the proposed function of this interaction?3) Cdc48 seems to have other functions in this pathway, apart from regulating Ubp12, since steady state levels of Fzo1 are not restored in cdc48-2/ ubc12Delta cells. Please comment.4) Figure 4—figure supplement 1A-D are insufficiently explained. Especially panel D is difficult to understand since Dnm1 is not introduced and the rationale for the experiment is missing.5) A table providing information on plasmids used in this study would be helpful, especially since information about expression of DUBs (overexpression, ADH promoter) is somewhat hidden by merely referencing Anton et al. (2013).6) The discussion about a role of Cdc48 in membrane fusion remains rather superficial. The proposed mechanism for the role of ubiquitination in Syntaxin 5-mediated fusion is rather different, namely that it prevents SNARE pairing. Here, p97 would mediate deubiquitination of Syn5 and thereby activate Syntaxin 5 (Huang et al. 2016). Furthermore, there is otherwise little evidence for a "general role of Cdc48" in membrane fusion. I suggest rephrasing of this paragraph.[Editors' note: further revisions were requested prior to acceptance, as described below.]Thank you for resubmitting your work entitled "Cdc48 regulates a deubiquitylase cascade critical for mitochondrial fusion" for further consideration at eLife. Your revised article has been favorably evaluated by Vivek Malhotra (Senior Editor), a Guest Reviewing Editor, and three reviewers.The manuscript has been improved but there are some remaining issues that need to be addressed before acceptance, as outlined below:The concerns from Reviewer 1 should be addressed in full. In particular, given the small changes in the turnover of endogenous Ubp2 (Figure 5B) it is important to test whether they are statistically significant. Moreover, the authors should discuss alternative mechanisms of Ubp2 regulation and that may be independent of its proteolysis.Reviewer #1:This is a revised manuscript that addresses the role of Cdc48, an AAA ATPase in mitochondria dynamics using yeast as a model. In the first-round review, a major problem identified by all referees is that the analyses of protein stability are based entirely on overexpressed Usp12 and Usp2. The authors now tagged Ubp12 and Ubp2 endogenously and analyzed their turnover in different genetic backgrounds. However, the newly collected data do not seem to support the authors’ main conclusions.1) Subsection “Cdc48 supports turnover of ubiquitylated Ubp12” – the authors concluded that the stability of endogenous Ubp12 is regulated by Cdc48. However, the phenotype in my opinion is quite weak (Figure 3A). Although the authors provide quantification results, the representative gel does not convince me that endogenous Ubp12 is unstable. Compared to Ubc6, a previously documented Cdc48 substrate, the accumulation of Ubp12 in cdc48-2 mutant cells is marginal, and the turnover is not as obvious as that of overexpressed Ubp12 (Figure 3—figure supplement 1A), suggesting that overexpressed Ubp12 may not be properly folded and thus becomes a Cdc48 substrate. Given that there may be only a small increase in Ubp12 protein level in cdc48-2 mutant cells, I am not convinced that the role of Cdc48 in regulation of mitochondria dynamics is achieved through controlling the stability of Ubp12.2) Another major conclusion of the study is that the two DUBs form a regulatory "cascade" with the stability of Ubp2 being controlled by Ubp12. The new result shown in Figure 5B does show that endogenous Ubp2 is unstable, but intriguingly, although the degradation of Ubp2 appears to be inhibited when Ubp12 gene was deleted, there is no obvious accumulation of Ubp2 in ubp12 deficient cells. Thus, it is unclear how Ubp12 could regulate the stability of Fzo1 in a Ubp2 dependent manner.Other issues:3) Subsection “Cdc48 promotes mitochondrial fusion and prevents Fzo1 turnover” – "Consistent with…". The authors conclude that the levels of Fzo1 were slightly decreased in the cdc48-3 mutant or in cells deleted for the Cdc48 co-factor factors Npl4, Ufd1 and Ufd3/Doa1. Given the huge error bars in these figures, the authors should perform statistical analyses to show whether the difference is significant.Reviewer #2:The authors have responded to my major concerns in an adequate manner, and the quality of the manuscript has been significantly improved.Reviewer #3:In their revised manuscript, Escobar-Henriques and co-workers have addressed all my concerns appropriately. The somewhat counter-intuitive observation that UBP12 deletion stabilises Ubp2p (and Fzo1p) is now sufficiently discussed. Concerns regarding over-expression of DUBs have been addressed. The Discussion is improved. The Materials and methods section now contains the requested tables. For these reasons, I support publication of the manuscript.Essential revisions:While all three reviewers find the results potentially interesting the following points must be addressed to solidify the key conclusion of this study.1) The main claims of this manuscript rely on the degradation of DUBs under strong overexpression. Thus, the evaluation of Ubp2 and Ubp12 half-lives should be re-analyzed and characterized under endogenous expression.We now analyzed the turnover of endogenous Ubp12 and Ubp2. We confirm their instability and show that their degradation depends on Cdc48-for Ubp12 (Figure 3A) and on Ubp12-for Ubp2 (Figure 5B).2) The negative regulation of Ubp2 by Ubp12 is a central point of model proposed but not fully characterized. In principle the removal of ubiquitin from a substrate should increase and not decrease its stability so the authors should clarify how Ubp2 is destabilized by Ubp12.Indeed, Ubp12 does not stabilise Ubp2, Fzo1, Rad23 (Gödderz JCS 2017) and Gpa1 (Wang JBC 2005), i.e. all substrates known so far. We tackled this particularity using Fzo1. We find that Ubp12 recognizes ubiquitylated forms on Fzo1 that only contain a very small number of ubiquitin moieties, which might explain why they do not serve as a good signal for proteasomal degradation (Figure 6F). Consistently, the ubiquitin signals that accumulate in all Ubp12 substrates are composed of a limited number of discrete bands, instead of the high molecular weight smear, typical for polyubiquitylated substrates that are degraded by the proteasome. In the case of the protein Met4, also with short ubiquitin chains, these are shielded and therefore not recognized for degradation. It would be interesting to obtain a crystal structure of Ubp12 to analyse why it cleaves non-degradative ubiquitin signals.3) The statistical analysis of numerous data should be improved.We now show standard deviations in all quantifications and additionally provide statistically analysis when required.New experimental data is provided in Figure 3A, in Figure 5B and in the new Figure 6; Figure 1—figure supplement 1B, Figure 3—figure supplement 1, Figure 4—figure supplement 2A, B and D and Figure 6—figure supplement 1. Moreover, new statistical analysis is presented in Figures 1B, 4C, 8C (old 7C) and in Figure 4—figure supplement 2E (old Figure 4—figure supplement 1F). In addition, we present an extended Figure 2B (old 2C) and improved the quality of Figure 5C (old 5D). Finally, as requested, we have included tables describing the yeast strains, plasmids and antibodies used.The comments of the individual reviewers are pasted below. You might want to address the additional concerns of the reviewers in case you can.Reviewer #1:[…] 1) The conclusions of this study rely heavily on overexpression of tagged deubiquitylases as the substrate of Cdc48. Considering the reported role of Cdc48 in diverse protein quality control processes, the authors need to exclude the possibility that overexpressed Ubp12 and Ubp2 are short-lived because of a potential misfolding issue caused by protein overexpression. One way to address this is to tag these DUBs endogenously and analyze their stability in wild type and Cdc48 mutant cells by cycloheximide chase.Both Ubp12 and Ubp2 have now been genomically tagged. Cycloheximide chase experiments revealed that both Ubp12 and Ubp2 are unstable proteins (Figures 3A and 5B). Moreover, Ubp12 degradation depended on Cdc48 and Ubp2 degradation depended on Ubp12.2) In Figure 2, the authors show an interaction between Cdc48 and Fzo1 that is dependent on Fzo1 ubiquitination. However, it is unclear what is the functional consequence of this interaction.As for the functional consequence of Cdc48-Fzo1 interaction, in the Discussion chapter we propose that a local regulation of Fzo1 by Cdc48 allows to increase the efficiency of the Cdc48-DUB cascade on Fzo1 regulation.Is it also unclear whether the interaction is direct or indirect.In principle, there is no need for another mediator in the co-immunoprecipitation between Cdc48 and Fzo1, because Cdc48 binds ubiquitylated substrates and Fzo1 is ubiquitylated. However, if the physical interaction between Fzo1 and Cdc48 would be indirect, the best candidate to mediate it would be Ubp12. On the new Figure 4—figure supplement 2D, we show that this is not the case. Nevertheless, we cannot exclude an indirect interaction between Cdc48 and Fzo1.In the subsection “Cdc48 supports turnover of ubiquitylated Ubp12”, the conclusion that Cdc48 specifically interacts with pro-fusion ubiquitin is not supported by any data.We show that Cdc48 binds to Fzo1 depending on its pro-fusion forms (Figure 2A) and also show that the additional presence of the anti-fusion forms does not increase binding of Cdc48 (Figure 2B). Moreover, we now show that the exclusive presence of the anti-fusion bands does not allow Cdc48 binding to Fzo1 (Figure 2B – extended from the old Figure 2C). These data support the specificity of Cdc48 for the pro-fusion bands. We have also revised the corresponding text, to make this point clear (subsection “Cdc48 supports turnover of ubiquitylated Ubp12”).3) In Figure 3, the authors try to demonstrate that Ubp12 is an unstable protein that is degraded in a Cdc48 dependent manner. All the experiments were done with overexpressed Ubp12. The authors should analyze the stability of endogenous Ubp12. In addition, several experiments shown are incomplete (e.g. Figure 3B, also Figure 5B, C). These experiments should include a cdc48 mutant for comparison.We now show turnover of endogenous Ubp12 (Figure 3A). We also now included a Cdc48 mutant for comparison (Figure 3A and Figure 3—figure supplement 1A).4) Figure 6 shows that the stability of Ubp2 is regulated by Ubp12. Once again, only overexpressed Ubp2 was studied. It is also puzzling why loss of Ubp12 can stabilize Ubp2, because DUB deficiency usually leads to increased ubiquitination and turnover. The quality of Figure 5D needs to be improved.The stability of genomic Ubp2 in dependence of Ubp12 has now been analyzed (Figure 5B) and the quality of Figure 5D had been improved by providing lower exposed blots. We agree that DUB deficiency usually leads to increased ubiquitylation and turnover. However, this is not the case for any of the four known substrates of Ubp12 – Fzo1, Ubp2, Rad23 (Gödderz JCS 2017) and Gpa1 (Wang JBC 2005). As discussed below, on point 5, we propose that those ubiquitylated forms, recognized by Ubp12, are too short to be a good proteasomal tag.5) The authors argue that there are two forms of ubiquitinated Fzo1; one supports mitochondrial fusion while the other mitigates it, but the nature of the pro-fusion ubiquitination is unclear. The authors should consider analyzing the ubiquitin linkages on Fzo1 that is accumulated in Ubp12 mutant cells. Are Ubp2 and Fzo1 conjugated with the same type of ubiquitin chains preferred by Ubp12?We show now, in Figure 6A and C, that both Fzo1 and Ubp2 accumulate K48-linked chains in Dubp12 cells.This is an important issue because it is a bit hard to understand how Ubp12 can act on two different kinds of ubiquitin signals; the one on Fzo1 is incompetent for degradation, but the one on Ubp2 seems to influence its stability in a way that is counter-intuitive.We apologize that the effect of Ubp12 on Fzo1 and on Ubp2 might have been unclear in the previous version. We now show that the ubiquitin signals that Ubp12 recognizes on Fzo1 resemble the ones that Ubp12 recognizes on Ubp2: in both cases it slows down their turnover (Figures 5B and Figure 6—figure supplement 1). We agree that this is counter-intuitive and therefore have further investigated it. In fact, the ubiquitin signals that accumulate in Fzo1, Ubp2, Rad23 and Gpa1 are all composed of a limited number of discrete bands, instead of the high molecular weight smear, typical for polyubiquitylated substrates. We have explored this for Fzo1 and found it to be composed of a di-ubiquitin chain (Figure 6F). This might explain why accumulation of these chains, in Δubp12 cells, does not increase substrate turnover.Thus, in my opinion, to make the model convincing, the authors need to characterize the Ubp2-mediated deubiquitination reaction in more detail. What kind of linkage is preferred by Ubp12? Are Ubp2 and Fzo1 conjugated with the same type of ubiquitin chains preferred by Ubp12? Do these chains increase protein stability as oppose to target them for degradation?We have performed experiments analyzing the chain preference of Ubp12. Ubp12 revealed to be very active and unspecific, presenting no preference for long vs. short ubiquitin chains, and also equally cutting K48 or K63-linked chains (Figure 6D and E). So, we propose that the presence of short ubiquitin chains on its substrates explains why they are not targeted for the UPS.6) "Fzo1 ubiquitination requires its lysine 464." If Fzo1 carries two types of ubiquitin chains, are they both attached to lysine 464? If yes, how are these processes coordinated? If not, where is the pro-fusion ubiquitin chain attached?Fzo1 is ubiquitylated at lysines 464 and 398. Fzo1 is first ubiquitylated at lysine 464 and then induces the formation of pro-fusion ubiquitin chains on lysine 398. Therefore, upon mutation of lysine 464 all pro-fusion ubiquitylation is lost (Anton 2013 Mol Cell). We have now briefly introduced this in the second chapter of the Results, subsection “Cdc48 binds and regulates ubiquitylated Fzo1”.Reviewer #2:[…] 1) Data in Figure 5 suggest that a DUB, Ubp12, is required for degradation of Ubp2. The authors show that Ubp2 is ubiquitylated and stabilized in the absence of Ubp12. In the presence of Ubp12, the ubiquitylated form of Ubp2 cannot be found and Ubp2 is degraded by the proteasome. In other words, the authors propose a model in which deubiquitylation of Ubp2 by Ubp12 promotes its degradation by the proteasome. It is very surprising that removal of ubiquitin from a substrate, rather than its addition to it, triggers proteasome-dependent degradation. In my eyes, this requires further explanations, ideally with additional experiments. I consider this an essential point, because the negative regulation of Ubp2 by Ubp12 is a central point of the authors' model.We agree that DUB deficiency usually leads to increased ubiquitylation and turnover. In contrast, Ubp12 deficiency decreases turnover of Ubp2 and Fzo1 (Figure 5B and Figure 6—figure supplement 1). We have addressed this point by performing additional experiments on Fzo1. We found that the ubiquitin forms bound by Ubp12 are composed of a di- ubiquitin chain (Figure 6F). Therefore, we propose that they are too short to be a good signal for proteasomal degradation. So far there are 4 substrates known for Ubp12: Fzo1, Ubp2, Rad23 (Gödderz JCS 2017) and Gpa1 (Wang JBC 2005). Importantly, in all these 4 substrates, the ubiquitin signals that accumulate in Δubp12 cells are composed of a limited number of discrete bands, instead of the high molecular weight smear, typical for polyubiquitylated substrates. Consistently, Ubp12 also does not stabilize any of these 4 substrates.Additional experiments analyzing Ubp12 have been performed. First, we show that Ubp12 regulates K48-linked chains on both Fzo1 and Ubp2 (Figure 6A and C). Second, we analyzed the DUB activity of Ubp12 in vitro. Ubp12 revealed to be very active and unspecific, presenting no preference for long vs. short ubiquitin chains, and also equally cutting K48 or K63-linked chains (Figure 6D and E). So, we propose that the presence of short ubiquitin chains on its substrates explains why they are not targeted for the UPS.2) The term "ubiquitin homeostasis" should be removed from the title, as this has not been addressed in the paper.Ubiquitin homeostasis has been deleted from the title.3) The authors did not use any statistical analysis (like Student's t-test or ANOVA) to substantiate their numerous quantifications. Moreover, they used standard errors instead of standard deviations for error bars. Since standard errors underrepresent the variance of data the authors have to show all their quantitative data with standard deviation. Alternatively, they can keep standard errors as error bars but must then provide appropriate statistical analysis.We now present standard deviations in all graphs.In particular, the effects shown in Figure 4C, Figure 4—figure supplement 1F and Figure 7C are rather moderate and must be substantiated by a more rigorous statistical analysis. If these results turn out to be not significant, the associated statements and conclusions have to be toned down accordingly.Statistical analysis has now been provided for these three panels.Reviewer #3:[…] 1) An important finding of this work is that the DUB Ubp12 is degraded in a Cdc48-dependent manner. Data for this is presented in Figure 3. In these experiments (and in others in which a DUB is expressed from a plasmid), Ubp12 is strongly overexpressed from a 2µ plasmid with the strong ADH promoter (as described in Anton et al., 2013). It is possible that degradation occurs because of the overexpression, e.g. because of then sub-stoichiometric amounts of a binding partner that normally stabilizes Ubp12. There are many examples in the literature for the degradation of orphan subunits in the literature, that are otherwise stable proteins (e.g. 1: Braun and Jentsch, 2007, EMBO Rep. 8(12):1176-82; 2: Habeck et al., 2015, JCB 209(2):261-73). I suggest that either this experiment is repeated using a chromosomally tagged version of Ubp12 under its endogenous promoter or that the possibility of an artifact due to overexpression is at least discussed. The latter would suffice in my opinion because the interplay of Cdc48 and Ubp12 is nicely shown in the following Figure 4 and its supplement.This essential point was analyzed and is also now addressed in the Results section. Importantly, we could confirm that genomically expressed Ubp12 is an unstable protein, and that its turnover depends on Cdc48 (Figure 3A).2) In Figure 2A, the authors provide evidence that Cdc48 is physically interacting with Fzo1, depending on ubiquitin(-chains) on K464. What is the proposed function of this interaction?It is true that our Cdc48-Ubp12-Fzo1 regulon does not explain why Cdc48 would need to bind to Fzo1 in order to regulate it. However, we now propose in the Discussion section that a local regulation of Fzo1 by Cdc48 -via Ubp12- allows to increase the efficiency of the Cdc48-DUB cascade on Fzo1 regulation.3) Cdc48 seems to have other functions in this pathway, apart from regulating Ubp12, since steady state levels of Fzo1 are not restored in cdc48-2/ ubc12Delta cells. Please comment.This is absolutely correct and has now been further examined (Figure 4—figure supplement 2D) and clearly stated in the respective Results section (subsection “Cdc48 regulation of Fzo1 depends on Ubp12”, corresponding to Figure 4—figure supplement E).4) Figure 4—figure supplement 1A-D are insufficiently explained. Especially panel D is difficult to understand since Dnm1 is not introduced and the rationale for the experiment is missing.We apologize for this confusion and have now provided an explanation in the Results subsection “Cdc48 regulation of Fzo1 depends on Ubp12”. Briefly, in absence of Fzo1 no hypertubulation has been observed upon deletion of UBP12. However, in Δfzo1 cells mitochondria are no longer tubular. We wanted therefore to exclude that the effect of Ubp12 depends on the shape of mitochondria, rather than on the role of Ubp12 in Fzo1. To this aim, the effect of Ubp12 was tested in Δfzo1 Δdnm1 cells, lacking Fzo1 but resembling wt cells in mitochondrial shape, so that the starting point would be tubular mitochondria. However, deletion of UBP12 did not alter mitochondrial morphology of Δfzo1 Δdnm1 cells (Figure 4—figure supplement 1D). This proves that in absence of FZO1, even tubular mitochondria cannot be altered by Ubp12. So, Ubp12 regulates mitochondrial morphology via Fzo1.5) A table providing information on plasmids used in this study would be helpful, especially since information about expression of DUBs (overexpression, ADH promoter) is somewhat hidden by merely referencing Anton et al. (2013).New tables describing the plasmids, strains and antibodies used are now provided.6) The discussion about a role of Cdc48 in membrane fusion remains rather superficial. The proposed mechanism for the role of ubiquitination in Syntaxin 5-mediated fusion is rather different, namely that it prevents SNARE pairing. Here, p97 would mediate deubiquitination of Syn5 and thereby activate Syntaxin 5 (Huang et al. 2016). Furthermore, there is otherwise little evidence for a "general role of Cdc48" in membrane fusion. I suggest rephrasing of this paragraph.We have proceeded as requested by the reviewer 3 (subsection “Roles of Cdc48 on mitochondrial dynamics”).[Editors' note: further revisions were requested prior to acceptance, as described below.]The manuscript has been improved but there are some remaining issues that need to be addressed before acceptance, as outlined below:The concerns from Reviewer 1 should be addressed in full. In particular, given the small changes in the turnover of endogenous Ubp2 (Figure 5B) it is important to test whether they are statistically significant.Figure 5B has been updated with the statistical analysis, showing that the changes in the turnover of endogenous Ubp2 are statistically significant.Moreover, the authors should discuss alternative mechanisms of Ubp2 regulation and that may be independent of its proteolysis.Possible alternative mechanisms of Ubp2 regulation, independent of its proteolysis, have now been discussed in the subsection “Regulation of DUB activity by ubiquitin”.In brief, besides protecting from degradation, ubiquitylation of Ubp2 could also influence its localization and/or activity by several means, e.g.:- allowing the formation of protein complexes which favor better activity, Cdc48 would be a candidate;- inducing conformational changes favoring binding of Ubp2 to its substrates.As requested, new statistical analysis is presented in Figure 5B and new experimental evidence and corresponding statistical analysis is presented in Figure 1—figure supplement 1A, B and C.Reviewer #1:This is a revised manuscript that addresses the role of Cdc48, an AAA ATPase in mitochondria dynamics using yeast as a model. In the first-round review, a major problem identified by all referees is that the analyses of protein stability are based entirely on overexpressed Usp12 and Usp2. The authors now tagged Ubp12 and Ubp2 endogenously and analyzed their turnover in different genetic backgrounds. However, the newly collected data do not seem to support the authors’ main conclusions.1) Subsection “Cdc48 supports turnover of ubiquitylated Ubp12” – the authors concluded that the stability of endogenous Ubp12 is regulated by Cdc48. However, the phenotype in my opinion is quite weak (Figure 3A). Although the authors provide quantification results, the representative gel does not convince me that endogenous Ubp12 is unstable., The turnover is not as obvious as that of overexpressed Ubp12 (Figure 3—figure supplement 1A), suggesting that overexpressed Ubp12 may not be properly folded and thus becomes a Cdc48 substrate.We agree that the turnover rate is higher for the overexpressed Ubp12 than for the endogenous protein, as shown in the quantifications presented in Figures 3A and Figure 3—figure supplement 1A. Nevertheless, upon Cdc48 impairment, the stabilization of endogenous Ubp12 is much more obvious than the one presented by overexpressed Ubp12. This convinces us that Ubp12 is a Cdc48 substrate, independently of its expression levels.Compared to Ubc6, a previously documented Cdc48 substrate, the accumulation of Ubp12 in cdc48-2 mutant cells is marginal. Given that there may be only a small increase in Ubp12 protein level in cdc48-2 mutant cells, I am not convinced that the role of Cdc48 in regulation of mitochondria dynamics is achieved through controlling the stability of Ubp12.The observation of a smaller increase in Ubp12 endogenous protein level in cdc48-2 mutant cells is expected, given the lower degradation kinetics discussed above. Ubc6 was used here just as a positive control of the CHX chase experiments. We do not intend to compare different Cdc48 substrates, which of course can have very different turnover rates.Moreover, although the turnover rate of Ubp12 is low, as previously pointed out by reviewer 1, we provide strong genetic data demonstrating that Cdc48 depends on Ubp12 for the regulation of mitochondrial morphology and cellular respiration.2) Another major conclusion of the study is that the two DUBs form a regulatory "cascade" with the stability of Ubp2 being controlled by Ubp12. The new result shown in Figure 5B does show that endogenous Ubp2 is unstable, but intriguingly, although the degradation of Ubp2 appears to be inhibited when Ubp12 gene was deleted, there is no obvious accumulation of Ubp2 in ubp12 deficient cells. Thus, it is unclear how Ubp12 could regulate the stability of Fzo1 in a Ubp2 dependent manner.We now present statistical analysis clearly demonstrating that Ubp2 is an unstable protein, and that its turnover is reduced in Δubp12 cells. We would like to point out that the differences in loading of the Ubp2 CHX chase in wt and Δubp12 cells, in Figure 5B, visible from both the Ssc1 and Ubc6 signal intensities, indeed give the impression that Ubp2 does not accumulate in the absence of UBP12.It is correct that Ubp12 only partially affects Ubp2 turnover rates. So, as suggested, we propose now in the Discussion subsection “Regulation of DUB activity by ubiquitin” that ubiquitylation could additionally regulate Ubp2 by proteolysis-independent means. For example, it could increase its activity by favoring further PTMs, consistent with the identification of phosphorylated sites on Ubp2 (Swaney, 2013). Moreover, Ubp2 ubiquitylation could favor allosteric conformational changes. This could occur autocatalytically – supported by the observation that Ubp2 is among the largest yeast DUBs – or as part of a protein complex with Cdc48, in agreement with our observation that Cdc48 and Ubp2 co-immunoprecipitate.Other issues:3) Subsection “Cdc48 promotes mitochondrial fusion and prevents Fzo1 turnover” – "Consistent with…". The authors conclude that the levels of Fzo1 were slightly decreased in the cdc48-3 mutant or in cells deleted for the Cdc48 co-factor factors Npl4, Ufd1 and Ufd3/Doa1. Given the huge error bars in these figures, the authors should perform statistical analyses to show whether the difference is significant.After performing more replicates, we can show now that the differences of Fzo1 levels in the mutant cells for Cdc48 and co-factors Npl4, Ufd1 and Ufd3/Doa1, are statistical significant (Figure 1—figure supplement 1A, B and C). This supports our previous conclusions.
Key resources table
Reagent type (species) or resource
Designation
Source or reference
Identifiers
Additional information
strain (Saccharomyces cerevisiae)
∆fzo1
PMID: 9483801
Escobar_lab_stock_number: FA2
strain (S. cerevisiae)
cdc48-1
PMID: 21441928
Escobar_lab_stock_number: FA230
strain (S. cerevisiae)
cdc48-2
PMID: 21441928
Escobar_lab_stock_number: FA231
strain (S. cerevisiae)
cdc48-3
PMID: 21441928
Escobar_lab_stock_number: FA232
strain (S. cerevisiae)
∆ubp2
PMID: 9483801
Escobar_lab_stock_number: FA260
strain (S. cerevisiae)
∆ubp12
PMID: 9483801
Escobar_lab_stock_number: FA269
strain (S. cerevisiae)
∆fzo1 ∆ubp2
PMID: 23317502
Escobar_lab_stock_number: FA362
strain (S. cerevisiae)
∆ubp2 ∆ubp12
PMID: 23317502
Escobar_lab_stock_number: FA382
strain (S. cerevisiae)
∆ubp12 ∆mdm30
this study
Escobar_lab_stock_number: FA390
UBP12::kanMX4; MDM30::kanMX4;obtained by crossing
strain (S. cerevisiae)
HA-Fzo1int in wt
PMID: 23317502
Escobar_lab_stock_number: FA407
strain (S. cerevisiae)
HA-Fzo1int in ∆ubp2
PMID: 23317502
Escobar_lab_stock_number: FA415
strain (S. cerevisiae)
HA-Fzo1int in ∆ubp2 ∆mdm30
PMID: 23317502
Escobar_lab_stock_number: FA427
strain (S. cerevisiae)
∆fzo1 ∆ubp12
this study
Escobar_lab_stock_number: FA432
FZO1::kanMX4; UBP12::kanMX4;obtained by crossing
strain (S. cerevisiae)
HA-Fzo1-K464Rint in wt
this study
Escobar_lab_stock_number: FA451
HA-Fzo1K464R genomically integrated with NatNT2 into RS140
strain (S. cerevisiae)
wt (BY4741)
PMID: 9483801
Escobar_lab_stock_number: RS140
strain (S. cerevisiae)
cdc48-2 ∆fzo1
this study
Escobar_lab_stock_number: RS430
FZO1::natNT2 in FA231
strain (S. cerevisiae)
cdc48-2 ∆ubp12
this study
Escobar_lab_stock_number: RS466
FZO1::hphNT1 in FA231
strain (S. cerevisiae)
cdc48-2 ∆ubp2 ∆ubp12
this study
Escobar_lab_stock_number: RS499
UBP12::natNT2; UBP2::hphNT1 in FA231
strain (S. cerevisiae)
∆doa1
PMID: 9483801
Escobar_lab_stock_number: RS518
strain (S. cerevisiae)
∆pdr5 ∆snq2
other
Escobar_lab_stock_number: RS527
gift by J. Dohmen (YGA58): MATa, ADE2 his3-D200 leu2-3,112 lys2-801, trp1D63 ura3-52 PDR5::hphNT1 SNQ2::kanMX4
strain (S. cerevisiae)
Ubp12-Flagint in cdc48-2
this study
Escobar_lab_stock_number: RS546
Ubp12-Flag genomically integrated with NatNT2 into FA231
strain (S. cerevisiae)
Ubp12-Flagint in wt
this study
Escobar_lab_stock_number: RS547
Ubp12-Flag genomically integrated with NatNT2 into BY4741
strain (S. cerevisiae)
∆pdr5 ∆snq2
this study
Escobar_lab_stock_number: RS554
PDR5::NatNT2; SNQ2::hphNT1 in RS140
strain (S. cerevisiae)
∆fzo1 ∆dnm1 ∆ubp12
this study
Escobar_lab_stock_number: RS556
UBP12::NatNT2 in TS1028
strain (S. cerevisiae)
∆pdr5 ∆snq2 cdc48-2
this study
Escobar_lab_stock_number: RS559
PDR5::NatNT2; SNQ2::hphNT1 in FA231
strain (S. cerevisiae)
cdc48-2 ∆ubp2
this study
Escobar_lab_stock_number: TS686
UBP2::hphNT1 in FA231
strain (S. cerevisiae)
∆fzo1 ∆dnm1
other
Escobar_lab_stock_number: TS1028
gift by B. Westermann (SB95): FZO1::kanMX4; DNM1::kanMX4; obtained by crossing
strain (S. cerevisiae)
wt (DF5)
PMID: 11007476
Escobar_lab_stock_number: TS1124
strain (S. cerevisiae)
ufd1-2
PMID: 11847109
Escobar_lab_stock_number: TS1125
strain (S. cerevisiae)
npl4-1
PMID: 8930904
Escobar_lab_stock_number: TS1126
strain (S. cerevisiae)
Ubp2-9Mycint in wt
this study
Escobar_lab_stock_number: TS1134
Ubp2-9Myc genomically integrated with NatNT2 into RS140
strain (S. cerevisiae)
Ubp2-3HAint in wt
this study
Escobar_lab_stock_number: TS1144
Ubp2-3HA genomically integrated with hphNT1 in RS140
strain (S. cerevisiae)
Ubp2-3HAint in ∆ubp12
this study
Escobar_lab_stock_number: TS1147
Ubp2-3HA genomically integrated with hphNT1 in FA269
strain (S. cerevisiae)
pGAL-Ubp12-Flagint in wt
this study
Escobar_lab_stock_number: TS1153
pGAL-Ubp12-Flag genomically integratedwith kanMX4 into RS544
recombinant DNA reagent
pRS316 (plasmid)
PMID: 2659436
Escobar_lab_stock_number: p8
recombinant DNA reagent
HA-Fzo1 on pRS316 (plasmid)
PMID: 23317502
Escobar_lab_stock_number: p10
recombinant DNA reagent
HA-Fzo1-K464R on pRS316 (plasmid)
PMID: 23317502
Escobar_lab_stock_number: p14
recombinant DNA reagent
YEplac181 (plasmid)
PMID: 3073106
Escobar_lab_stock_number: p58
recombinant DNA reagent
Ubp2-Flag on YEplac181(plasmid)
PMID: 23317502
Escobar_lab_stock_number: p59
recombinant DNA reagent
Ubp2-C745S-Flag on YEplac181(plasmid)
PMID: 23317502
Escobar_lab_stock_number: p60
recombinant DNA reagent
Ubp12-Flag on YEplac181(plasmid)
PMID: 23317502
Escobar_lab_stock_number: p61
recombinant DNA reagent
Ubp12-C372S-Flag on YEplac181(plasmid)
PMID: 23317502
Escobar_lab_stock_number: p62
recombinant DNA reagent
YEplac195 (plasmid)
PMID: 3073106
Escobar_lab_stock_number: p63
recombinant DNA reagent
Ubp12C372S on YEplac195 (plasmid)
this study
Escobar_lab_stock_number: p65
Ubp12C372S (non-tagged) on YEplac195, 2µ, Ura3
recombinant DNA reagent
mt-GFP on pYX142 (plasmid)
PMID: 11054823
Escobar_lab_stock_number: p70
recombinant DNA reagent
Cdc48 wt on pRS313 (plasmid)
PMID: 22580068
Escobar_lab_stock_number: p75
recombinant DNA reagent
pRS313 (plasmid)
PMID: 2659436
Escobar_lab_stock_number: p79
recombinant DNA reagent
Cdc48-A547T on pRS313 (plasmid)
this study
Escobar_lab_stock_number: p150
Cdc48A547T on pRS313, cen, His3
recombinant DNA reagent
Ub on pKT10 (plasmid)
PMID: 2164637
Escobar_lab_stock_number: p341
recombinant DNA reagent
Ub-K48R on pKT10 (plasmid)
PMID: 2164637
Escobar_lab_stock_number: p342
recombinant DNA reagent
Ub-K63R on pKT10 (plasmid)
PMID: 2164637
Escobar_lab_stock_number: p343
recombinant DNA reagent
Ub-K48R,K63R on pKT10 (plasmid)
PMID: 2164637
Escobar_lab_stock_number: p344
recombinant DNA reagent
Myc-Ub on pRS426 (plasmid)
PMID: 25620559
Escobar_lab_stock_number: p356
recombinant DNA reagent
pRS426 (plasmid)
PMID: 25620559
Escobar_lab_stock_number: p375
Antibody
anti-Cdc48
other
gift by T. Sommer; (1:1,000/1:10,000)
Antibody
anti-Cox2
other
gift by W. Neupert; (1:5,000)
Antibody
anti-Flag M2
Sigma
Sigma: F1804
(1:1,000)
Antibody
anti-Fzo1
this study
Produced by GenScript using the peptide CHGDRKPDDDPYSSS; (1:1,000)
Authors: Stephan Züchner; Irina V Mersiyanova; Maria Muglia; Nisrine Bissar-Tadmouri; Julie Rochelle; Elena L Dadali; Mario Zappia; Eva Nelis; Alessandra Patitucci; Jan Senderek; Yesim Parman; Oleg Evgrafov; Peter De Jonghe; Yuji Takahashi; Shoij Tsuji; Margaret A Pericak-Vance; Aldo Quattrone; Esra Battaloglu; Alexander V Polyakov; Vincent Timmerman; J Michael Schröder; Jeffery M Vance; Esra Battologlu Journal: Nat Genet Date: 2004-04-04 Impact factor: 38.330
Authors: Jin-Mi Heo; Nurit Livnat-Levanon; Eric B Taylor; Kevin T Jones; Noah Dephoure; Julia Ring; Jianxin Xie; Jeffrey L Brodsky; Frank Madeo; Steven P Gygi; Kaveh Ashrafi; Michael H Glickman; Jared Rutter Journal: Mol Cell Date: 2010-11-12 Impact factor: 17.970
Authors: Sokol V Todi; K Matthew Scaglione; Jessica R Blount; Venkatesha Basrur; Kevin P Conlon; Annalisa Pastore; Kojo Elenitoba-Johnson; Henry L Paulson Journal: J Biol Chem Date: 2010-10-13 Impact factor: 5.157
Authors: Evandro A De-Souza; Felipe S A Pimentel; Ana Luiza F V De-Queiroz; Henrique Camara; Mikaella L Felix-Formiga; Caio M Machado; Silas Pinto; Antonio Galina; Marcelo A Mori; Monica Montero-Lomeli; Claudio A Masuda Journal: J Biol Chem Date: 2020-01-29 Impact factor: 5.157
Authors: Vincent Anton; Ira Buntenbroich; Ramona Schuster; Felix Babatz; Tânia Simões; Selver Altin; Gaetano Calabrese; Jan Riemer; Astrid Schauss; Mafalda Escobar-Henriques Journal: Life Sci Alliance Date: 2019-11-18
Authors: Jenna M Goodrum; Austin R Lever; Troy K Coody; Daniel E Gottschling; Adam L Hughes Journal: Mol Biol Cell Date: 2019-05-29 Impact factor: 4.138