Twenty-seven low-copy nuclear primers for Lindera obtusiloba (Lauraceae): A Tertiary relict species in East Asia.

PREMISE OF THE STUDY: To investigate a more detailed evolutionary history of Lindera obtusiloba (Lauraceae) and other Lindera species, polymorphic low-copy nuclear primers were developed. METHODS AND
RESULTS: Unigenes of the L. obtusiloba transcriptome greater than 800 bp in length were randomly chosen for initial design of 168 primers. Agarose gel electrophoresis and Sanger sequencing were used to select low-copy nuclear genes. Twenty-seven primers were obtained and were used to investigate genetic diversity in 90 individuals from 24 populations. The nucleotide diversity ranged from 2.11 × 10-3 to 8.99 × 10-3, and haplotype diversity ranged from 0.57 to 0.97. These primers were also cross-amplified in L. aggregata, L. chunii, L. erythrocarpa, and L. glauca; up to 15 primers were successfully amplified in these related species.
CONCLUSIONS: This methodology is effective for development of low-copy nuclear primers. The 27 primers developed here will be useful for evolutionary studies of L. obtusiloba and other Lindera species.

Lindera obtusiloba Blume (Lauraceae) is a deciduous plant distributed in both northern and southern floral regions of the Tertiary relict flora in East Asia (Donoghue et al., 2001; Milne and Abbott, 2002). These two regions harbor two distinct L. obtusiloba genealogies that were probably triggered by the intermediate arid belt (Ye et al., 2017), providing a perfect system to investigate the floral subdivision of the East Asian Tertiary relict flora and the effect of the west-east–oriented arid belt. Only four chloroplast fragments and six nuclear microsatellites were used in Ye et al. (2017), limiting a detailed evolutionary history inference within each floral region. The nuclear microsatellites used in Ye et al. (2017) were designed for L. melissifolia (Walter) Blume (Echt et al., 2006) or L. benzoin (L.) Blume (Edwards and Niesenbaum, 2007); therefore, in this study, we aimed to design species-specific low-copy nuclear primers for L. obtusiloba.

Transcriptome sequences are widely used in studies of plant evolutionary history (e.g., Ai et al., 2015) and can be used for development of low-copy nuclear primers (Bai and Zhang, 2014). For example, Higashi et al. (2015) developed eight primers using 100 expressed sequence tag (EST) markers of Ericaceae, and the phylogeny of Shortia Raf. was inferred through these primers. In this study, the transcriptome data of L. obtusiloba were used to develop low-copy nuclear primers, and these primers were cross-amplified in other Lindera Thunb. species.

METHODS AND RESULTS

Two L. obtusiloba leaves were collected in the populations XRD and TMSH (Appendix 1) and used for transcriptome sequencing. Total RNA was extracted using the RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany), and the NEBNext Ultra RNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, Massachusetts, USA) was used to generate sequencing libraries. An index code was added to each sample. TruSeq PE Cluster Kit v3-cBot-HS (Illumina, San Diego, California, USA) on a cBot Cluster Generation System was used to cluster the index-coded samples. The Illumina HiSeq 2500 platform was used to sequence the libraries and generate paired-end reads. The raw reads were cleaned by removing reads containing adapters, reads including more than 10% unknown base information, and reads with low quality. All clean reads were assembled by Trinity (v2012-10-05) (Grabherr et al., 2011). The transcriptome data can be accessed in the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) (NCBI Resource Coordinators, 2017) under accession numbers SRR5888830 and SRR5892454. In total, 191,545 unigenes were obtained, and unigenes greater than 800 bp in length were randomly chosen for initial design of 168 primers. We BLASTed these unigenes in nucleotide collection (nr/nt) database using MEGABLAST (optimized for highly similar sequences) in the NCBI database. The exon position, intron length, and putative function were justified by the gene information of the closest gene in the NCBI database. Primer pairs were designed in separate exon regions using Primer Premier 5 (PREMIER Biosoft International, Palo Alto, California, USA) under the following criteria: (i) size of primers 17–23 bp, (ii) annealing temperature (Ta) 45–64°C, (iii) Ta difference between primer pairs less than 4°C, (iv) primer pair score greater than 90, and (v) putative amplified product length less than 1200 bp.

PCRs were performed following the procedure in Ye et al. (2017) with adjusted annealing temperatures (Table 1). Agarose gel electrophoresis was used to select primers that generated only one clear band, and these primers were amplified in eight individuals. The amplicons were sequenced and then read in CodonCode Aligner 3.6.1 (CodonCode Corporation, Centerville, Massachusetts, USA; http://www.codoncode.com/aligner/). The loci with all nucleotide sites that exhibit fewer than two types of nucleotide variants were treated as low-copy nuclear loci. Low-copy nuclear loci were tested in 90 individuals sampled from 24 populations of L. obtusiloba (Appendix 2). After reading in CodonCode Aligner 3.6.1, PHASE function in DnaSP 5.10.01 (Rozas et al., 2003) was used to determine heterozygous and polymorphic sites, determine haplotypes, and to calculate genetic diversities, including nucleotide diversity (π) and haplotype diversity (Hd), of each locus. SPADS 1.0 (Dellicour and Mardulyn, 2014) was used to calculate haplotypes, π, and allelic richness in 24 populations. Genotypic disequilibrium was assessed using all locus pairs in all populations by randomization using FSTAT 2.9.3 with Bonferroni correction (Goudet, 2001). Local BLAST function in BioEdit 7.1.9 (Hall, 1999) was used to determine the intron and exon positions of all low-copy nuclear loci, and the unigenes for primer design were used as database (Appendix S1). Low-copy nuclear genes were cross-amplified in two individuals of four other Lindera species, including L. aggregata (Sims) Kosterm., L. chunii Merr., L. erythrocarpa Makino, and L. glauca (Siebold & Zucc.) Blume (Appendix 1).

Table 1.

Characteristics of the 27 Lindera obtusiloba low-copy nuclear loci.

Locus	Primer sequences (5′–3′)	Length (bp)	Ta (°C)	GenBank accession no.	Exon (bp)	Intron (bp)	Putative function	Closest species	E-value
2AP	R: ACTGGGTTTCATTTGTTG	810	56	MF152421	1–181; 778–810	182–777	CSC1-like protein ERD4 (LOC104588785)	Nelumbo nucifera	0
	F: GCTGTTGGCTTTGTTCC
2DA	R: CAAGCAAAGGGCTCAATG	581	60	MF152429	405–581	1–404	Uncharacterized LOC103717698 (LOC103717698)	Phoenix dactylifera	3E-35
	F: GCCTCGCCTCTTCAGTAA
ACY	R: TCGCTTTGGCAATGTTTC	944	52	MF152435	1–451; 902–944	452–901	Acyl-coenzyme A oxidase 2, peroxisomal (LOC109009398)	Juglans regia	0
	F: GATCTCGCAGATGGCTTT
BAE	R: TGGCAGCAGATTGGTAGT	629	60	MF152452	141–551	1–140; 552–629	Sucrose galactosyltransferase 2 (LOC104597400)	Nelumbo nucifera	0
	F: GTCCTTTGGGTAGAAGTCAT
COD1	R: TGGTGGCAAGACCTGGAT	154	56	MF152461	1–154		Flavanone-3-hydroxylase (F3H) gene	Persea americana	0
	F: GCTGGGTTCTGGAATGTAG
FASP	R: GACTGGTACTGCGGTGAC	626	56	MF152466	71–225	1–70; 226–627	Omega-6 fatty acid desaturase, chloroplastic-like (LOC104603306)	Nelumbo nucifera	0
	F: CCTCTTCCCTCCAAACA
GPN	R: AAAGCCAGTCAGAATAACC	516	48	MF152474	1–23; 203–366; 457–516	24–202; 367–456	hsp70 nucleotide exchange factor FES1 (LOC100266149)	Vitis vinifera	0
	F: TCTGCTAAATCAGCCACA
HET	R: GGGCAGACCCTAAGAAT	612	56	MF152477	580–612	1–579	Heterogeneous nuclear ribonucleoprotein R (LOC109822129)	Asparagus officinalis	2E-114
	F: CAGGTTTAGCAGGAGGTA
HIST	R: ATTGAACCTGCCCTTAC	228	56	MF152485	128–228	1–127	Histone deacetylase 14 (LOC103720526)	Phoenix dactylifera	0
	F: AGATTGTATCCACCTTCC
HPT	R: CTCATCCGTTCTCCTTTT	394	52	MF152490	1–67	68–394	Uncharacterized LOC104604799 (LOC104604799)	Nelumbo nucifera	7E-126
	F: GGTCTTAGCAAACCTTCC
HYPO	R: TCAGCATCCATCCTACGG	305	52	MF152499		1–305	Vesicle-associated protein 1-3-like (LOC103961248)	Pyrus ×bretschneideri	4E-103
	F: CCAGGCAAAACAATACCC
INTE	R: TTGAAGGAACAAGGGAG	324	48	MF152505	1–47; 169–324	48–168	Proton pump-interactor 1-like (LOC109013106)	Juglans regia	4E-85
	F: ATTCATTCTTGGTGTCATA
ISOM	R: AAGAAGGCTAAATCCGTT	341	48	MF152511	313–341	1–312	Protein disulfide-isomerase A6 (LOC105052579)	Elaeis guineensis	0
	F: CGTAGGGTATCCTGTGAC
LEP2	R: GTTCAAGATGGCTGGGTA	391	56	MF152517	1–53; 144–275; 369–391	54–143; 276–368	F-box/LRR-repeat protein 14 (LOC100243795)	Vitis vinifera	0
	F: GACAGCAAAGATGACCCT
LG3	R: GGGTGGTTGAGGATGTTA	472	56	MF152522	191–462	1–190; 463–472	Transcinnamate 4-monooxygenase (LOC104593756)	Nelumbo nucifera	0
	F: CAGGACGTTGTCTTCGTT
LPD	R: GCGGCCAGGTTTAAGAAA	187	56	MF152530	1–187		N-succinyldiaminopimelate aminotransferase DapC (LOC104882468)	Vitis vinifera	0
	F: TCGGAGGTCGTAGGGTGA
MALA	R: GGTTGGACGAGAATAGAGC	328	56	MF152532	93–172; 296–328	1–92; 173–295	Malate dehydrogenase [NADP], chloroplastic-like (LOC104587331)	Nelumbo nucifera	0
	F: TCGCAGGTATCCCACTGAT
MPD	R: CCCCAGCATAAAGGAACT	622	48	MF152537	471–621	1–470; 622	Ankyrin repeat domain-containing protein 2A-like (LOC104592662)	Nelumbo nucifera	0
	F: CTCGACATCACCGACACT
PENT	R: TTGATGCGTATAACACTTTG	456	56	MF152540	1–37; 288–456	38–287	Tetratricopeptide repeat-like superfamily protein	Cinnamomum camphora	0
	F: ATGATTTCGTTGGCTTTG
PORI	R: CTGCAAACCCTGTCGTTA	417	56	MF152544	1–102; 215–417	103–219	Mitochondrial outer membrane protein porin of 34 kDa (LOC108992813)	Juglans regia	3E-159
	F: CCTGGTGTCTACTTCTCCC
PRUP	R: GCACAGACCTCGTGTCGT	586	60	MF152547	1–64; 154–184; 531–586	65–153;185–530	Peroxiredoxin-2F, mitochondrial (LOC18792220)	Prunus persica	5E-96
	F: TGCCCAGCCATTCATAAC
SPT2	R: GTATTGTATGAGATGGGGTCT	497	56	MF152552	1–62; 460–497	63–459	F-box protein SKIP31-like (LOC104610293)	Nelumbo nucifera	3E-175
	F: AACTCGGAGGGAGTGTTC
STOP	R: GGCGGCTCAACAAGAAG	600	60	MF152560	569–600	1–568	Phosphatidylserine decarboxylase proenzyme 2-like (LOC104599579)	Nelumbo nucifera	0
	F: CTGCCAAGAGTCTCACCAC
STP	R: TGTTGCGGTTAAGATATTGG	386	56	MF152569	1–386		Serine/threonine-protein kinase HT1 (LOC104590294)	Nelumbo nucifera	0
	F: GTTCCTGTCTCGGGTGTC
TDM	R: GCATCTTTGCCCTCCTCT	686	56	MF159113	643–677	1–642; 678–686	F-box protein PP2-A15 (LOC104612530)	Nelumbo nucifera	1E-168
	F: CTTCGGTCTTCAATCCCT
TPP	R: AATGGTCCAGGTGGTGAT	614	56	MF152574	140–257; 385–458; 569–614	1–139; 258–384; 459–568;	ATP-dependent Clp protease proteolytic subunit-related protein 2, chloroplastic (LOC104611846)	Nelumbo nucifera	0
	F: TTTGCAGCCAGTTCTTTG
VEST	R: GGTCGAAACAACCCAGAT	592	60	MF152583	47–331; 440–592	1-46; 332–439	Putative glucuronosyltransferase PGSIP8 (LOC105059517)	Elaeis guineensis	1E-165
	F: TGAAGAGCCCAGCAAAT

Note: Ta = annealing temperature.

Ninety-six of the 168 tested primers did not amplify or generated multiple bands, 45 produced messy sequences, and 27 produced clear sequences (Table 1). The product length of the 27 loci ranged from 154 to 944 bp. The number of polymorphic sites and haplotypes ranged from six to 71 and five to 49, respectively, with a mean of 27 and 19, respectively. In addition, π ranged from 2.11 × 10−3 to 8.99 × 10−3 with a mean of 6.06 × 10−3, and Hd ranged from 0.57 to 0.97, with a mean of 0.77 (Table 2). In the 24 populations, the number of haplotypes ranged from 39 to 76, π ranged from 0.76 × 10−3 to 1.80 × 10−3, and allelic richness ranged from 1.43 to 1.94 (Appendix 2). No significant genotypic disequilibrium was observed among 351 locus pairs. Fifteen primers were successfully amplified in L. aggregata and L. erythrocarpa, and 14 primers were successfully amplified in L. chunii and L. glauca (Table 2).

Table 2.

Genetic diversity and cross-amplification of the 27 Lindera obtusiloba low-copy nuclear loci.

Locus	n	V	S	P	H	Hd	π (×10−3)	Lindera aggregata	Lindera erythrocarpa	Lindera chunii	Lindera glauca
2AP	82	41	11	30	31	0.88	8.04	—	—	—	—
2DA	84	44	4	40	19	0.88	8.99	+	+	+	+
ACY	85	71	14	57	49	0.97	8.53	+	—	+	+
BAE	86	36	11	25	28	0.84	6.86	—	+	—	—
COD1	87	10	2	8	13	0.73	8.55	+	—	—	—
FASP	88	44	18	26	23	0.80	6.72	+	+	+	+
GPN	88	28	11	17	17	0.73	4.79	+	+	+	+
HET	87	22	4	18	15	0.77	6.27	+	—	+	+
HIST	85	20	7	13	14	0.79	7.39	—	+	—	—
HPT	86	32	9	23	24	0.84	5.46	—	+	—	—
HYPO	87	16	4	12	15	0.72	6.65	—	—	—	—
INTE	88	23	8	15	15	0.71	8.78	+	+	+	+
ISOM	87	16	5	11	13	0.75	5.39	+	—	+	+
LEP2	81	20	10	10	18	0.68	5.16	+	—	+	+
LG3	86	16	4	12	16	0.84	3.55	+	—	—	—
LPD	89	6	0	6	5	0.57	3.71	—	+	+	+
MALA	88	16	0	16	12	0.71	6.16	+	+	+	+
MPD	86	20	2	18	16	0.82	6.27	+	—	+	+
PENT	88	20	2	18	13	0.57	2.11	—	+	—	—
PORI	88	27	11	19	12	0.68	6.75	+	+	—	—
PRUP	88	22	4	18	21	0.85	4.75	+	—	—	—
SPT2	87	30	8	22	22	0.81	5.24	—	+	+	+
STOP	89	30	9	21	23	0.80	8.56	—	—	—	—
STP	89	12	2	10	15	0.73	3.31	—	+	+	+
TDM	87	40	11	29	21	0.80	5.29	—	+	—	—
TPP	88	35	12	23	21	0.76	6.03	—	+	—	—
VEST	88	28	12	16	28	0.88	4.22	+	—	+	+

Note: — = unsuccessful amplification; + = successful amplification; H = haplotypes; Hd = haplotype diversity; π = nucleotide diversity; P = parsimony informative sites; S = singleton variable sites; V = variable sites.

CONCLUSIONS

Given that information regarding exon position and intron sequence are not included in transcriptome sequencing, the success rate of primer development using transcriptome data would be expected to be low (Bai and Zhang, 2014). In this study, we developed 27 polymorphic primers out of a set of 168 primers, with a ratio of approximately 16%. The success rate is increased twofold compared with that of Higashi et al. (2015). This methodology provides an effective approach for the development of new low-copy nuclear primers.

Twenty-seven novel polymorphic low-copy nuclear primers were developed using transcriptome data from L. obtusiloba. These primers can be used to investigate the evolutionary history of L. obtusiloba and other Lindera species.

Click here for additional data file.

Appendix 1.

Location and voucher information for Lindera species used in this study.

Species	Population	Location	Latitude	Longitude	Voucher no.a
Lindera obtusiloba Blume	ANZH	Anzihe Nature Reserve, Sichuan, China	30.81	103.13	SHM23259
	BDGS	Mt. Badagong, Hunan, China	29.69	109.79	SHM23260
	BHSH	Bukhansan National Park, Seoul City, Korea	37.65	126.99	SHM23261
	BM	Bomi, Xizang, China	29.87	95.73	SHM23262
	DAL	Dalian, Liaoning, China	38.90	121.46	SHM23263
	DBSH	Mt. Daba, Anhui, China	31.01	116.11	SHM23264
	JAP	Tokyo, Japan	35.95	139.30	SHM23074
	JWS	Gariwangsan, Gangwon Province, Korea	37.43	128.56	SHM23265
	KI	Mt. Iizuna, Japan	36.72	138.15	SHM23266
	KYSH	Mt. Kunyu, Shandong, China	37.26	121.73	SHM23267
	LAJ	Lajing, Yunnan, China	26.49	99.28	SHM23073
	LISH	Mt. Li, Shanxi, China	35.43	111.98	SHM23268
	MCSH	Mt. Micang, Shannxi, China	32.69	107.53	SHM23269
	NI	Nikko, Japan	36.75	139.42	SHM23270
	PMA	Pianma, Yunnan, China	25.99	98.66	SHM23271
	TMSH	Mt. Tianmu, Zhejiang, China	30.42	119.41	SHM23070
	UH	Masuda, Japan	34.55	132.04	SHM23272
	WEIX	Weixi, Yunnan, China	27.18	99.29	SHM23273
	WYSH	Mt. Wuyi, Jiangxi, China	27.93	117.69	SHM23274
	XRD	Zhuanghe, Liaoning, China	40.02	122.96	SHM23071
	XYSH	Seoraksan National Park, Gangwon Province, Korea	38.17	128.49	SHM23275
	XZD	Xiaozhongdian, Yunnan, China	27.34	99.84	SHM23276
	YTSH	Mt. Yuntai, Jiangsu, China	34.72	119.44	SHM23277
	ZYSH	Mt. Jiri, South Gyeongsang Province, Korea	35.29	127.49	SHM23278
Lindera aggregata (Sims) Kosterm.	TMSH	Mt. Tianmu, Zhejiang, China	30.42	119.41	SHM22266
Lindera chunii Merr.	DHS	Mt. Dinghu, Guangdong, China	23.17	112.55	SHM23280
Lindera erythrocarpa Makino	KYSH	Mt. Kunyu, Shandong, China	37.26	121.73	SHM23279
Lindera glauca (Siebold & Zucc.) Blume	TMSH	Mt. Tianmu, Zhejiang, China	30.42	119.41	SHM23281

Voucher specimens were deposited in Shanghai Natural History Museum (SHM), Shanghai, China.

Appendix 2.

Genetic diversity in 24 populations of the 27 low-copy nuclear loci in Lindera obtusiloba.

Population	n	No. of haplotypes	π (×10−3)	Allelic richness
ANZH	5	55	0.77	1.58
BDGS	3	61	1.50	1.94
BHSH	3	56	1.23	1.79
BM	3	51	1.08	1.64
DAL	3	41	1.14	1.43
DBSH	5	60	1.25	1.71
JAP	6	76	1.80	1.89
JWS	5	53	1.09	1.51
KI	3	59	1.80	1.92
KYSH	3	52	1.39	1.70
LAJ	5	70	1.48	1.83
LISH	3	50	0.87	1.61
MCSH	3	65	1.44	1.90
NI	2	39	0.76	1.44
PMA	4	56	1.29	1.69
TMSH	5	55	1.25	1.72
UH	6	68	1.10	1.68
WEIX	3	59	1.60	1.85
WYSH	3	49	1.13	1.63
XRD	5	55	1.49	1.66
XYSH	3	47	1.47	1.57
XZD	3	55	1.26	1.73
YTSH	3	47	1.00	1.58
ZYSH	3	51	1.49	1.71

Note: n = number of individuals; π = nucleotide diversity.