Literature DB >> 29293391

A role for 9-lipoxygenases in maize defense against insect herbivory.

Melkamu G Woldemariam1, Kevin Ahern2, Georg Jander2, Vered Tzin3.   

Abstract

Feeding by Spodoptera exigua (beet armyworm) larvae on Zea mays (maize) induces expression of 9-lipoxygenases to a greater extent than 13-lipoxygenases. Whereas 13-lipoxygenases have an established role in the synthesis of jasmonates that serve as defense signaling molecules in many plant species, relatively little is known about the role of 9-lipoxygenases in herbivore defense. Phylogenetic analysis of lipoxygenases from maize inbred lines B73 and W22 shows that, although most Lox genes are present in both lines, Lox12, a 9-lipoxygenase that has been implicated in fungal defense, is truncated and unlikely to encode a functional protein in W22. Two independent Mutator transposon insertions in another 9-lipoxygenase, Lox4, caused improved S. exigua growth on the mutant lines relative to wildtype W22. This observation suggests a function in herbivore defense for metabolic products downstream of maize Lox4, either through direct toxicity or a perhaps an as yet unknown signaling function.

Entities:  

Keywords:  Maize; defense; insect; jasmonate; lipoxygenase

Mesh:

Substances:

Year:  2018        PMID: 29293391      PMCID: PMC5790410          DOI: 10.1080/15592324.2017.1422462

Source DB:  PubMed          Journal:  Plant Signal Behav        ISSN: 1559-2316


Introduction

Plants respond to insect herbivory with a large variety of metabolic changes. Some induced metabolites have toxic or deterrent effects against the herbivores, whereas others act as signaling molecules to induce defense responses in parts of the plant that are not yet under attack. Two well-studied plant metabolic pathways, those of indole glucosinolates in Arabidopsis thaliana and benzoxazinoids in Zea mays (maize),, produce metabolites with both direct defensive properties and defense signaling molecules. Jasmonic acid and its derivatives methyl jasmonate and jasmonate-isoleucine are well-studied components of the defense signaling pathway in many plant species. The first reaction in the synthesis of jasmonic acid from α-linolenic acid is catalyzed by 13-lipoxygenases (Fig. 1). In the sequenced B73 maize genome, six genes are predicted to encode 13-lipoxygenases (Lox7, Lox8, Lox9, Lox10, Lox11, and Lox13; Fig. 2). Lox7 and Lox8, are involved in jasmonate biosynthesis, thereby contributing to inflorescence development and plant defense, respectively., Lox10 activity leads to the release of herbivore-induced plant volatiles.
Figure 1.

9-Lipoxygenase and 13-lipoxygenase oxygenate α-linolenic acid at different positions to produce (10E,12Z)-9-Hydroperoxy-10,12,15-octadecatrienoic acid (9-HPOT and (10E,12Z)-13-hydroperoxy-10,12,15-octadecatrienoic acid (13-HPOT), respectively. 9-HPOT and 13-HPOT serve as precursors for differing sets of bioactive plant metabolites. 10-OPDA = 10-oxophytodienoic acid;12-OPDA = 12-oxophytodienoic acid; DES = divinyl ether synthase; AOS = allene oxide synthase; HPL = hydroperoxide lysase. Modified from Schiller et al. (2015).

Figure 2.

Dendrogram of predicted protein sequences of 27 lipoxygenases from the maize inbred line B73 v4 assembly (Zm00001d numbers) and the inbred line W22 v2 assembly (Zm00004b numbers). The evolutionary history was inferred by using the Maximum Likelihood method based on the JTT matrix-based model. Evolutionary analyses were conducted in MEGA7. The tree with the highest log likelihood is shown. Bootstrap values are based on 1000 replications. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. All positions with less than 80% site coverage were eliminated. There were a total of 835 positions in the final dataset. Proteins that are truncated and likely non-functional in W22 are marked with asterisks.

9-Lipoxygenase and 13-lipoxygenase oxygenate α-linolenic acid at different positions to produce (10E,12Z)-9-Hydroperoxy-10,12,15-octadecatrienoic acid (9-HPOT and (10E,12Z)-13-hydroperoxy-10,12,15-octadecatrienoic acid (13-HPOT), respectively. 9-HPOT and 13-HPOT serve as precursors for differing sets of bioactive plant metabolites. 10-OPDA = 10-oxophytodienoic acid;12-OPDA = 12-oxophytodienoic acid; DES = divinyl ether synthase; AOS = allene oxide synthase; HPL = hydroperoxide lysase. Modified from Schiller et al. (2015). In addition to 13-lipoxygenases, the B73 genome contains seven genes encoding predicted 9-lipoxygenases (Lox1, Lox2, Lox3, Lox4, Lox5, Lox6, and Lox12; Fig. 2), which oxidize 18:3 α-linolenic acid and 18:2 α-linoleic acid to produce 10-oxo-11-phytodienoic acid (10-OPDA; Fig. 1) and 10-oxo-11-phytoenoic acid (10-OPEA), respectively. Fungal infection, mechanical wounding, and feeding by Helicoverpa zea (corn earworm) induce 10-OPEA accumulation in maize., Furthermore, in vitro experiments show that 10-OPEA inhibits the growth of fungal pathogens (Aspergillus flavus and Fusarium verticillioides) and H. zea at physiologically relevant concentrations. Similarly, assays with maize 9-lipoxygenase mutants have demonstrated functions in plant defense. For instance, a lox12 mutation reduced F. verticilloides resistance and Meloidogyne incognita (root-knot nematode) grew better on a lox3 mutant line. Dendrogram of predicted protein sequences of 27 lipoxygenases from the maize inbred line B73 v4 assembly (Zm00001d numbers) and the inbred line W22 v2 assembly (Zm00004b numbers). The evolutionary history was inferred by using the Maximum Likelihood method based on the JTT matrix-based model. Evolutionary analyses were conducted in MEGA7. The tree with the highest log likelihood is shown. Bootstrap values are based on 1000 replications. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. All positions with less than 80% site coverage were eliminated. There were a total of 835 positions in the final dataset. Proteins that are truncated and likely non-functional in W22 are marked with asterisks. In recent research, we investigated the transcriptional and metabolic responses of inbred line B73 to feeding by Spodoptera exigua (beet armyworm) caterpillars. As expected, insect herbivory induced the expression of 13-lipoxygenases (Fig. 3) and increased the accumulation of jasmonic acid and its derivatives. However, S. exigua growth was not affected by a lox8 mutation, suggesting possible redundancy in maize 13-lipoxygenase activity. Compared to 13-lipoxygenases, 9-lipoxygenases were induced to an even greater extent by S. exigua feeding (Fig. 3). Expression of Lox1/2, Lox3, Lox4, and Lox5 was increased up to 100-fold within an hour of caterpillar feeding and remained at a high level for the duration of the 24-hour experiment. In other research, Lox1 and Lox5 expression was induced by Ostrinia furnicalis (Asian corn borer) feeding. Previous experiments using RNA blots to measure induction of gene expression in response to Spodoptera frugiperda (fall armyworm) feeding showed increased expression of Lox5, but not Lox4 after 1, 4, and 8 days of caterpillar feeding. Differences in the observed induction of Lox4 expression (Fig. 3 vs.) could result from the use of different maize lines, different herbivore species, or perhaps a transient expression of Lox4 early during herbivory. Together, these gene expression results suggested that the activity of 9-lipoxygenases might also make significant contributions to maize defense against caterpillar herbivory.
Figure 3.

Caterpillar-induced expression of 9-lipoxygenases (blue bars) and 13-lipoxygenases (orange bars) in maize inbred line B73. Mean +/- s.e. of 4 independent samples. *P value < 0.05, Dunnett's test relative to 0-hour controls. Data are adapted from Tzin et al. 2017.

Caterpillar-induced expression of 9-lipoxygenases (blue bars) and 13-lipoxygenases (orange bars) in maize inbred line B73. Mean +/- s.e. of 4 independent samples. *P value < 0.05, Dunnett's test relative to 0-hour controls. Data are adapted from Tzin et al. 2017.

Results and discussion

Whereas our gene expression analysis was conducted with maize inbred line B73, better genetic resources, in particular, collections of Mutator (Mu), Activator (Ac) and Dissociation (Ds) transposon insertions are available for the W22 inbred line. To facilitate the identification of a 9-lipoxygenase knockout mutation in W22, we first compared the complement of Lox proteins encoded in the B73 genome and the recently assembled W22 genome. The protein sequences of 14 predicted W22 lipoxygenases and 13 predicted B73 lipoxygenases were aligned (Fig. S1). This showed that about the W22 homolog of B73 Lox12 (Zm00004b017105) is truncated by about 50% and is likely to be non-functional. As a Lox12 mutation in the B73 genetic background increases susceptibility to Fusarium verticilloides, W22 might also show susceptibility to this fungal pathogen. Zm00004b008975, a Lox9-like protein that is present in W22 but not in B73 is similarly truncated and likely to be non-functional. A phylogenetic analysis of the B73 and W22 lipoxygenase proteins (Fig. 2) showed that, with the exception of Lox12, there is a full-length W22 homolog for each of the 13 known B73 lipoxygenases (Fig. 2). The two pairs of tandem-duplicated lipoxygenases in B73, Lox1/2 and Lox3/4 are similarly localized as gene pairs in the W22 genome. Analysis of publicly available Mu transposon insertions identified lines UFMu-01831 and UFMu-03303 as having an insertion in the W22 Lox4 gene (Fig. 4A). Homozygous Mu insertions in Lox4 were verified by PCR amplification and DNA sequencing. Both transposon insertions are in coding regions and lead to predicted C-terminal truncations of the conserved lipoxygenase domain of the protein. Analysis of Lox4 gene expression by quantitative PCR using primers that bind upstream of the transposon insertion sites showed reduced transcript levels in UFMu-01831 but not UFMu-03303, with and without caterpillar feeding. It is possible that the two Mu-induced truncations of the gene have differing effects on Lox4 transcript stability. Relative to W22, S. exigua caterpillars gained more mass over a five-day period on both UFMu-01831 and UFMu-03303, indicating that maize defense responses are compromised by the Lox4::Mu mutations that truncate the C-terminus of this protein.
Figure 4.

Analysis of a W22 Lox4 Mu insertion lines (A) Location of the UFMu-01831and UFMu-03303 insertions in the Lox4 gene and positions of primers that were used for quantitative RT-PCR gene expression analysis. (B) Expression level of the Lox4 gene, with and without six hours of S. exigua feeding. Mean +/- s.e. of 5 independent samples. (C) Mass of S. exigua caterpillars after five days of feeding on W22, UFMu-01831, and UFMu-03303seedlings. Mean +/- s.e. of 57 samples. *P value < 0.05, ANOVA followed by Tukey's HSD test.

Analysis of a W22 Lox4 Mu insertion lines (A) Location of the UFMu-01831and UFMu-03303 insertions in the Lox4 gene and positions of primers that were used for quantitative RT-PCR gene expression analysis. (B) Expression level of the Lox4 gene, with and without six hours of S. exigua feeding. Mean +/- s.e. of 5 independent samples. (C) Mass of S. exigua caterpillars after five days of feeding on W22, UFMu-01831, and UFMu-03303seedlings. Mean +/- s.e. of 57 samples. *P value < 0.05, ANOVA followed by Tukey's HSD test. Compared to the extensive research on the role of 13-lipoxygenases for jasmonate-mediated plant defense signaling, there is relatively little published information on the role that 9-lipoxygenases play in defense against insect herbivory. Altered caterpillar performance due to the lox4 mutation could be due to either changes in the production of toxic or deterrent metabolites, e.g. 10-OPEA. or perhaps changes in plant defense signaling. For instance, just as 12-OPDA is a precursor for the production of jasmonic acid, 10-OPDA or 10-OPEA could lead to the formation of mobile signaling molecules that lead to the induction of defense responses in maize. Given the large caterpillar-induced changes in gene expression (Fig. 3) and the improved growth of S. exigua on lox4 mutants (Fig. 4), further research on the role of 9-lipoxygenase in maize defense against insects is warranted. In addition to Lox4::Mu insertion lines that we have investigated, Mu insertions in the W22 genetic background are available for two other 9-lipoxygenases, Lox2 and Lox5, in public collections. Investigation of herbivore resistance, gene expression changes, and metabolite accumulation in these transposon insertion lines likely will identify new pathways of maize defense against insect herbivory.

Methods

Molecular Phylogeny. Protein sequences of the 13 known lipoxygenase proteins (Lox1 – Lox13) in maize inbred line B73 RefGen v4 were downloaded from the Maize Genetics and Genomics Database (www.maizegdb.org). Sequence comparisons of B73 genes from the v2 assembly of the W22 genome identified 14 predicted lipoxygenase genes. Protein sequences of these 27 identified lipoxygenases were aligned with Muscle using the following program parameters: gap penalties – gap open -2.9, gap extend 0, hydrophobicity multiplier 1.2; max iterations 8; clustering method UPGMB; and min diag length 24. A dendrogram of protein sequences was prepared using MEGA7. The evolutionary history was inferred using the Maximum Likelihood method based on the JTT matrix-based model. Initial trees for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using a JTT model, and then selecting the topology with superior log likelihood value. All amino acid positions with less than 80% site coverage among the 27 analyzed proteins were eliminated. There were a total of 835 positions were included in the final dataset. Mu transposon insertions in Lox4. Line UFMu-01831 and UFMu-03303 were obtained from Maize Genetics COOP (http://maizecoop.cropsci.uiuc.edu/). Mu transposon insertions in the Lox4 gene were confirmed by PCR amplification using a Biorad C1000 thermal cycler the gene-specific primer (GGCGACGATAATCCTGGACCATACAAGG) and the transposon-specific primer TIR6 primer (AGAGAAGCCAACGCCAWCGCCTCYATTTCGTC), followed by DNA sequencing. Lox4 expression levels were measured by quantitative RT-PCR using an Applied Biosystems 7900HT instrument and the primers GCTGAACCTGAACATCTACG and GTAGAGCCCAAGGATGTCTT. Insect bioassays. Eggs of S. exigua were obtained from Benzon Research (www.benzonresearch.com). Eggs were hatched at 28ºC and moved to S. exigua artificial diet (Southland Products, http://www.tecinfo.com/∼southland/). After five days, larvae were moved onto 17-day-old maize plants that were grown in a Conviron walk-in growth room at 23ºC with16:8 h light:dark cycle and 180 mmol photons m−2s−1 light intensity. After 5 days on the plants, caterpillars were removed and their mass was measured using a Sartorius precision balance.
  23 in total

1.  Transposon tagging using Activator (Ac) in maize.

Authors:  Thomas P Brutnell; Liza J Conrad
Journal:  Methods Mol Biol       Date:  2003

2.  MUSCLE: multiple sequence alignment with high accuracy and high throughput.

Authors:  Robert C Edgar
Journal:  Nucleic Acids Res       Date:  2004-03-19       Impact factor: 16.971

3.  Distribution of Activator (Ac) throughout the maize genome for use in regional mutagenesis.

Authors:  Judith M Kolkman; Liza J Conrad; Phyllis R Farmer; Kristine Hardeman; Kevin R Ahern; Paul E Lewis; Ruairidh J H Sawers; Sara Lebejko; Paul Chomet; Thomas P Brutnell
Journal:  Genetics       Date:  2004-11-01       Impact factor: 4.562

4.  The rapid generation of mutation data matrices from protein sequences.

Authors:  D T Jones; W R Taylor; J M Thornton
Journal:  Comput Appl Biosci       Date:  1992-06

Review 5.  Plant immunity to insect herbivores.

Authors:  Gregg A Howe; Georg Jander
Journal:  Annu Rev Plant Biol       Date:  2008       Impact factor: 26.379

6.  The B73 maize genome: complexity, diversity, and dynamics.

Authors:  Patrick S Schnable; Doreen Ware; Robert S Fulton; Joshua C Stein; Fusheng Wei; Shiran Pasternak; Chengzhi Liang; Jianwei Zhang; Lucinda Fulton; Tina A Graves; Patrick Minx; Amy Denise Reily; Laura Courtney; Scott S Kruchowski; Chad Tomlinson; Cindy Strong; Kim Delehaunty; Catrina Fronick; Bill Courtney; Susan M Rock; Eddie Belter; Feiyu Du; Kyung Kim; Rachel M Abbott; Marc Cotton; Andy Levy; Pamela Marchetto; Kerri Ochoa; Stephanie M Jackson; Barbara Gillam; Weizu Chen; Le Yan; Jamey Higginbotham; Marco Cardenas; Jason Waligorski; Elizabeth Applebaum; Lindsey Phelps; Jason Falcone; Krishna Kanchi; Thynn Thane; Adam Scimone; Nay Thane; Jessica Henke; Tom Wang; Jessica Ruppert; Neha Shah; Kelsi Rotter; Jennifer Hodges; Elizabeth Ingenthron; Matt Cordes; Sara Kohlberg; Jennifer Sgro; Brandon Delgado; Kelly Mead; Asif Chinwalla; Shawn Leonard; Kevin Crouse; Kristi Collura; Dave Kudrna; Jennifer Currie; Ruifeng He; Angelina Angelova; Shanmugam Rajasekar; Teri Mueller; Rene Lomeli; Gabriel Scara; Ara Ko; Krista Delaney; Marina Wissotski; Georgina Lopez; David Campos; Michele Braidotti; Elizabeth Ashley; Wolfgang Golser; HyeRan Kim; Seunghee Lee; Jinke Lin; Zeljko Dujmic; Woojin Kim; Jayson Talag; Andrea Zuccolo; Chuanzhu Fan; Aswathy Sebastian; Melissa Kramer; Lori Spiegel; Lidia Nascimento; Theresa Zutavern; Beth Miller; Claude Ambroise; Stephanie Muller; Will Spooner; Apurva Narechania; Liya Ren; Sharon Wei; Sunita Kumari; Ben Faga; Michael J Levy; Linda McMahan; Peter Van Buren; Matthew W Vaughn; Kai Ying; Cheng-Ting Yeh; Scott J Emrich; Yi Jia; Ananth Kalyanaraman; An-Ping Hsia; W Brad Barbazuk; Regina S Baucom; Thomas P Brutnell; Nicholas C Carpita; Cristian Chaparro; Jer-Ming Chia; Jean-Marc Deragon; James C Estill; Yan Fu; Jeffrey A Jeddeloh; Yujun Han; Hyeran Lee; Pinghua Li; Damon R Lisch; Sanzhen Liu; Zhijie Liu; Dawn Holligan Nagel; Maureen C McCann; Phillip SanMiguel; Alan M Myers; Dan Nettleton; John Nguyen; Bryan W Penning; Lalit Ponnala; Kevin L Schneider; David C Schwartz; Anupma Sharma; Carol Soderlund; Nathan M Springer; Qi Sun; Hao Wang; Michael Waterman; Richard Westerman; Thomas K Wolfgruber; Lixing Yang; Yeisoo Yu; Lifang Zhang; Shiguo Zhou; Qihui Zhu; Jeffrey L Bennetzen; R Kelly Dawe; Jiming Jiang; Ning Jiang; Gernot G Presting; Susan R Wessler; Srinivas Aluru; Robert A Martienssen; Sandra W Clifton; W Richard McCombie; Rod A Wing; Richard K Wilson
Journal:  Science       Date:  2009-11-20       Impact factor: 47.728

7.  Glucosinolate metabolites required for an Arabidopsis innate immune response.

Authors:  Nicole K Clay; Adewale M Adio; Carine Denoux; Georg Jander; Frederick M Ausubel
Journal:  Science       Date:  2008-12-18       Impact factor: 47.728

8.  Maize 9-lipoxygenase ZmLOX3 controls development, root-specific expression of defense genes, and resistance to root-knot nematodes.

Authors:  Xiquan Gao; James Starr; Cornelia Göbel; Jürgen Engelberth; Ivo Feussner; James Tumlinson; Michael Kolomiets
Journal:  Mol Plant Microbe Interact       Date:  2008-01       Impact factor: 4.171

9.  Phenotype to genotype using forward-genetic Mu-seq for identification and functional classification of maize mutants.

Authors:  Charles T Hunter; Masaharu Suzuki; Jonathan Saunders; Shan Wu; Alexander Tasi; Donald R McCarty; Karen E Koch
Journal:  Front Plant Sci       Date:  2014-01-07       Impact factor: 5.753

10.  Mu-seq: sequence-based mapping and identification of transposon induced mutations.

Authors:  Donald R McCarty; Sue Latshaw; Shan Wu; Masaharu Suzuki; Charles T Hunter; Wayne T Avigne; Karen E Koch
Journal:  PLoS One       Date:  2013-10-23       Impact factor: 3.240

View more
  12 in total

1.  Genome-wide identification and expression profiling of chitinase genes in tea (Camellia sinensis (L.) O. Kuntze) under biotic stress conditions.

Authors:  Kuntala Sarma Bordoloi; Debasish B Krishnatreya; Pooja Moni Baruah; Anuj Kumar Borah; Tapan Kumar Mondal; Niraj Agarwala
Journal:  Physiol Mol Biol Plants       Date:  2021-02-19

2.  Development and application of a quantitative bioassay to evaluate maize silk resistance to corn earworm herbivory among progenies derived from Peruvian landrace Piura.

Authors:  Miriam D Lopez; Tesia S Dennison; Tina M Paque; Marna D Yandeau-Nelson; Craig A Abel; Nick Lauter
Journal:  PLoS One       Date:  2019-04-16       Impact factor: 3.240

3.  Rice defense responses are induced upon leaf rolling by an insect herbivore.

Authors:  Jin-Hua Shi; Ze Sun; Xin-Jun Hu; Huanan Jin; Caroline Ngichop Foba; Hao Liu; Chao Wang; Le Liu; Feng-Feng Li; Man-Qun Wang
Journal:  BMC Plant Biol       Date:  2019-11-25       Impact factor: 4.215

4.  Use of virus-induced gene silencing to characterize genes involved in modulating hypersensitive cell death in maize.

Authors:  Colin Murphree; Saet-Byul Kim; Shailesh Karre; Rozalynne Samira; Peter Balint-Kurti
Journal:  Mol Plant Pathol       Date:  2020-10-10       Impact factor: 5.663

5.  Transcriptomic and volatile signatures associated with maize defense against corn leaf aphid.

Authors:  Lise Pingault; Suresh Varsani; Nathan Palmer; Swayamjit Ray; W Paul Williams; Dawn S Luthe; Jared G Ali; Gautam Sarath; Joe Louis
Journal:  BMC Plant Biol       Date:  2021-03-16       Impact factor: 4.215

6.  Necrotrophic Fungus Pyrenophora tritici-repentis Triggers Expression of Multiple Resistance Components in Resistant and Susceptible Wheat Cultivars.

Authors:  Ethan J Andersen; Madhav P Nepal; Shaukat Ali
Journal:  Plant Pathol J       Date:  2021-04-01       Impact factor: 1.795

7.  Loss of ZmLIPOXYGENASE4 Decreases Fusarium verticillioides Resistance in Maize Seedlings.

Authors:  Alessandra Lanubile; Virginia Maria Grazia Borrelli; Mario Soccio; Paola Giorni; Lorenzo Stagnati; Matteo Busconi; Adriano Marocco
Journal:  Genes (Basel)       Date:  2021-02-25       Impact factor: 4.096

Review 8.  Specific Roles of Lipoxygenases in Development and Responses to Stress in Plants.

Authors:  Priyanka Singh; Yamshi Arif; Edyta Miszczuk; Andrzej Bajguz; Shamsul Hayat
Journal:  Plants (Basel)       Date:  2022-04-04

9.  Generalist and Specialist Mite Herbivores Induce Similar Defense Responses in Maize and Barley but Differ in Susceptibility to Benzoxazinoids.

Authors:  Huyen Bui; Robert Greenhalgh; Alice Ruckert; Gunbharpur S Gill; Sarah Lee; Ricardo A Ramirez; Richard M Clark
Journal:  Front Plant Sci       Date:  2018-08-21       Impact factor: 5.753

10.  Transcriptional Responses of Resistant and Susceptible Wheat Exposed to Wheat Curl Mite.

Authors:  Mahnaz Kiani; Becky Bryan; Charles Rush; Adrianna Szczepaniec
Journal:  Int J Mol Sci       Date:  2021-03-08       Impact factor: 5.923

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.