Shlesha Richhariya1, Gaiti Hasan1. 1. National Centre for Biological Sciences, Tata Institute of Fundamental Research, Bangalore, India.
Abstract
Ral is a small GTPase of the Ras superfamily that is important for a number of cellular functions. Recently, we found that expression of Ral is regulated by store-operated calcium entry (SOCE) in Drosophila neurons. In this study, through genetic and behavioural experiments, we show that Ral function is required in differentiated muscles for flight. Reducing Ral function in muscles, specifically reduced duration of flight bouts but not other motor functions, like climbing. Interestingly, unlike in the nervous system, Ral expression in the muscle is not regulated by SOCE. Moreover, either knockdown or genetic inhibition of SOCE in muscles does not affect flight. These findings demonstrate that a multiplicity of signalling mechanisms very likely regulate Ral expression in different tissues.
Ral is a small GTPase of the Ras superfamily that is important for a number of cellular functions. Recently, we found that expression of Ral is regulated by store-operated calcium entry (SOCE) in Drosophila neurons. In this study, through genetic and behavioural experiments, we show that Ral function is required in differentiated muscles for flight. Reducing Ral function in muscles, specifically reduced duration of flight bouts but not other motor functions, like climbing. Interestingly, unlike in the nervous system, Ral expression in the muscle is not regulated by SOCE. Moreover, either knockdown or genetic inhibition of SOCE in muscles does not affect flight. These findings demonstrate that a multiplicity of signalling mechanisms very likely regulate Ral expression in different tissues.
Ral GTPases, members of the Ras superfamily regulate a variety of cellular processes including vesicle trafficking, cell polarity, and even oncogenesis. In mammals, two Ral GTPase genes are present — RalA and RalB[3] and they interact with the exocyst complex.[4] Ral function in various cell types has been studied, neuronal RalA and RalB regulate neurotransmitter release and neurite branching. RalA is critical for insulin secretion from pancreatic cells.[7] Besides secretion, Ral proteins are also important in membrane targeting of proteins, like the Glut transporter in adipocytes. [8]In the genetic model system Drosophila, there exists a single homolog for Ral.[9] Like the mammalianRal proteins, Drosophila Ral also mediates its functions through the exocyst complex.[10] It has several functions in development , including membrane transport[13] and receptor trafficking.[14] In a recent study, we identified Ral, as a regulator of Drosophila flight. Reduction of either Ral levels or function, across all neurons led to significant flight defects. However, Ral mutant flies were almost flightless [15], suggesting that Ral function might be required in tissues other than the nervous system, to regulate flight. In Drosophila, like most insects, the duration of flight bouts is regulated primarily by neuronal activity and muscle function.[16-18]
Ral is expressed in and functions in multiple tissues besides the nervous system. Thus, in this study we have investigated whether Ral function in muscles is required for flight.Store-operated Calcium Entry (SOCE) is a mode of calcium entry in the cell that is triggered by emptying of endoplasmic reticular calcium stores by extracellular stimuli [20], and is involved in a variety of cellular processes like regulating gene transcription , muscle contraction [22] and cell migration.[23] SOCE is mediated primarily by the endoplasmic reticular calcium sensor STIM [24] and the plasma membrane calcium channel Orai.[25] Knockdown of either of these components in Drosophila neurons results in flight defects.[26] In the previous study, we identified Ral expression to be regulated by SOCE [15] in neurons and thus we have tested for similar regulation in the muscle in this paper.
Results
A dominant negative form of Ral, which harbours a single point mutation Ral in the GTP binding domain of Ral (henceforth referred to as Ral) reduces Ral function. Flies in which UAS-Ral expression was driven using a muscle-specific Mef2-GAL4
[27] were tested for their ability to fly using the single flight assay.[15] Flies with reduced Ral function in muscles had significantly lower flight durations than the corresponding controls (Fig. 1A). Reduction in Ral levels in muscles using an RNAi against Ral (Ral) also significantly reduced the flight duration as compared with controls (Fig. 1A). This reduction in flight was not due to altered wing morphology because wings of flies, with Ral perturbations in muscles, appeared normal (Fig. 1A). A muscle requirement for Ral in the context of flight was further tested with another muscle driver, Mhc-GAL4, which expresses exclusively in differentiated muscles [28] as compared with Mef2-GAL4 which also expresses in myoblasts. Mhc-GAL4 control flies themselves had slightly impaired flight bout durations as compared to the Mef2-GAL4 control (Fig. 1A and 1B) indicating an effect of the genetic background on flight. Still, flies with expression of Ral using Mhc-GAL4 had significantly reduced flight bout durations as compared to controls with no effect on wing morphology (Fig. 1B). Taken together, these data demonstrate that the small GTPase Ral is also required in differentiated muscles for regulating the duration of Drosophila flight.
Figure 1.
Ral function is required in the muscle for flight but not climbing. (A and B) Representative images of flies from the indicated genotypes. Wing posture is normal for all genotypes tested (top). A box plot of flight durations of flies measured by single flight assay of the indicated genotypes is shown below. In the box plots, centre lines show the medians; crosses indicate the means; box limits indicate the 25th and 75th percentiles; whiskers extend 1.5 times the interquartile range from the 25th and 75th percentiles, individual data points are represented as open circles and the numbers below represent “n” for each box. Flies from two crosses were used in these experiments. (C) Number of flies, out of ten that could climb 8cm in 12 seconds of the indicated genotypes are shown as bar graphs of mean values and standard errors of mean. Alphabets over the box plots/ bar graphs represent statistically indistinguishable groups (one-way ANOVA with a post hoc Tukey's test p < 0.05). Pairwise comparisons were performed by unpaired, two-tailed Student's t-test and the exact p-values are indicated. (D) Confocal images of thoracic indirect flight muscles of the indicated genotypes. The upper and lower panels show representative images of dorsal ventral muscles (DVMs) and dorsal longitudinal muscles (DLMs) respectively. Muscle membranes are marked by mRFP allowing visualization of the fibres. BF indicates brightfield image. Orientation of the thorax is indicated by A (anterior) and P (posterior). Scale bar indicates 10µm.
Ral function is required in the muscle for flight but not climbing. (A and B) Representative images of flies from the indicated genotypes. Wing posture is normal for all genotypes tested (top). A box plot of flight durations of flies measured by single flight assay of the indicated genotypes is shown below. In the box plots, centre lines show the medians; crosses indicate the means; box limits indicate the 25th and 75th percentiles; whiskers extend 1.5 times the interquartile range from the 25th and 75th percentiles, individual data points are represented as open circles and the numbers below represent “n” for each box. Flies from two crosses were used in these experiments. (C) Number of flies, out of ten that could climb 8cm in 12 seconds of the indicated genotypes are shown as bar graphs of mean values and standard errors of mean. Alphabets over the box plots/ bar graphs represent statistically indistinguishable groups (one-way ANOVA with a post hoc Tukey's test p < 0.05). Pairwise comparisons were performed by unpaired, two-tailed Student's t-test and the exact p-values are indicated. (D) Confocal images of thoracic indirect flight muscles of the indicated genotypes. The upper and lower panels show representative images of dorsal ventral muscles (DVMs) and dorsal longitudinal muscles (DLMs) respectively. Muscle membranes are marked by mRFP allowing visualization of the fibres. BF indicates brightfield image. Orientation of the thorax is indicated by A (anterior) and P (posterior). Scale bar indicates 10µm.Both the muscle GAL4s used, also express in muscles other than flight muscles. Therefore, next we tested if Ral function is specific to flight muscles or required more generally. For this, we tested the ability to climb 8 cm in 12 seconds. Flies with Mef2-GAL4 driven expression of either Ral or Ral in muscles could climb at a rate that was statistically indistinguishable from controls (Fig. 1C) suggesting that Ral function is very likely specific to flight muscles. If Ral function is important in the development of the indirect flight muscles, this could reflect in their morphology in adults.[29] Thus, we looked at the morphology of the indirect flight muscles in the thorax which consist of dorsal longitudinal muscles (DLMs) and dorsal ventral muscles (DVMs).[30] Mutations in genes required for formation of these muscle fibres can lead to malformed muscle fibres.[31] However, expression of Ral with Mef2-GAL4 in all muscles through development and in adults resulted in muscle fibres that look identical to control (Fig. 1D).SOCE in neurons regulates flight [32] and expression of Ral.[15] Calcium dynamics in the muscle, mediated by Sarco-Endoplasmic Reticulum Calcium ATPase (SERCA) are important for muscle function.[33] SERCA interacts with SOCE components in Drosophila neurons.[32] Having identified a role for Ral in flight muscles, we therefore tested whether SOCE-regulates Ral expression in muscles. We knocked down levels of dStim, a calcium sensor on the endoplasmic reticulum that initiates SOCE upon store-depletion [24] in muscles with an RNAi against dStim (dStim) and Mef2-GAL4. Flies with dStim knockdown in muscles had normal wings and flight durations, no different from controls (Fig. 2A) despite significant reduction in dStim levels (Fig. 3A). Next, we tested the role of another molecule that mediates SOCE, the calcium release-activated calcium (CRAC) channel, Orai.[25] Expression of the dominant-negative form of dOrai, dOrai results in abrogation of SOCE.[34] Flies with UAS-dOrai without any GAL4 by itself had lower flight durations than other controls (Fig. 2B compared to Fig. 2A and Fig. 1A). Expression of dOrai in the muscle using the Mef2-GAL4 however, resulted in no difference in flight times compared to the corresponding control (Fig. 2B). These data indicate that flight muscles do not require SOCE through the STIM/Orai pathway, and suggest that Ral expression in flight muscles is independent of SOCE. This idea was tested next by measuring Ral mRNA levels by qRT-PCR from dissected thoraces, in which the predominant tissues are flight muscles. Ral expression was the same between RNA from thoraces with knockdown of dStim and controls (Fig 3A and 3B) confirming that Ral levels in muscles are not regulated by SOCE.
Figure 2.
SOCE function in muscle is not required for flight. Representative images of flies from the indicated genotypes showing normal wing posture (top) and a box plot of flight durations of flies measured by single flight assay (bottom) from flies with dStim knockdown in the muscle (A) or dOrai dominant negative expression in the muscle (B). Box plot symbols are as described for Figure 1. All flies tested were from the same cross. Pairwise comparisons were performed by unpaired, two-tailed Student's t-test and the exact p-values are indicated.
Figure 3.
SOCE does not regulate Ral expression in the muscle. Change in the levels of dStim (A) and Ral (B) in the indicated genotypes, normalized to tubulin as measured by qRT-PCR. Flies used were from the same cross as that for Fig. 2. Bars represent means and error bars, standard errors of mean of the fold change. Pairwise comparisons were performed by unpaired, two-tailed Student's t-test and the exact p-values are indicated.
SOCE function in muscle is not required for flight. Representative images of flies from the indicated genotypes showing normal wing posture (top) and a box plot of flight durations of flies measured by single flight assay (bottom) from flies with dStim knockdown in the muscle (A) or dOrai dominant negative expression in the muscle (B). Box plot symbols are as described for Figure 1. All flies tested were from the same cross. Pairwise comparisons were performed by unpaired, two-tailed Student's t-test and the exact p-values are indicated.SOCE does not regulate Ral expression in the muscle. Change in the levels of dStim (A) and Ral (B) in the indicated genotypes, normalized to tubulin as measured by qRT-PCR. Flies used were from the same cross as that for Fig. 2. Bars represent means and error bars, standard errors of mean of the fold change. Pairwise comparisons were performed by unpaired, two-tailed Student's t-test and the exact p-values are indicated.
Discussion
In this study, we have identified a role for Ral in flight muscles of Drosophila flight. We also find that in muscles, unlike the nervous system, Ral expression is not regulated by store-operated calcium entry (SOCE).Perturbation of Ral function with both Mef2-GAL4 and Mhc-GAL4 resulted in flight defects. However, Mef2-GAL4 is expressed predominantly in developing muscles whereas Mhc-GAL4 is expressed mostly in differentiated muscles.[28] Therefore, Ral function maybe required in developing as well as differentiated flight muscles. Based on the similar flight deficits observed in Mef2>Ral and Mhc>Ral (Figure 1 A and B) it is more likely that Ral function is primarily in differentiated flight muscles. Moreover, although Mef2-GAL4 expresses in myoblasts, the gross anatomy of the adult thoracic flight muscles was not affected upon expression of Ral supporting the idea that Ral function is not required for development of the flight muscles. However, our data does not rule out the possibility that loss of Ral function might affect the ultrastructure of these muscles. The requirement of Ral in differentiated muscles supports a role for Ral in muscle physiology. Further experiments are required to identify the temporal requirement of Ral in flight muscles which might help understand its function in this cell type better. Ral function in regulating the addition of post-synaptic membranes in differentiated muscles has been demonstrated earlier [13], and may be the underlying cause for the observed flight deficits. This previous study had also demonstrated a role for Ca2+ in activation of Ral but because perturbing SOCE in muscles did not lead to observed flight deficits, calcium through SOCE is unlikely to activate Ral.Ral expression in neurons is down-regulated by knockdown of dSTIM.[15] However, in muscles, Ral levels were unaffected upon dStim knockdown. Concurrently, perturbations of SOCE in muscles did not alter flight durations. SOCE mediated by STIM and Orai has been documented in mammalian muscles [36] but so far has not been shown in Drosophila muscles. Expression of dStim in Drosophila thoracic muscles (Fig. 3), indicates the presence of SOCE. Thus, Ral expression is differentially regulated in the two tissues — neurons and muscles. The functional significance of this differential regulation needs further investigation.
Materials and methods
Fly rearing and stocks
Flies were reared on media containing cornmeal supplemented with yeast extract. Fly crosses were set up and allowed to lay eggs at 25°C, vials containing larvae were moved to 29°C and were maintained at the elevated temperature until testing. Fly strains used are as follows: Mef2-GAL4 (BL27390), Mhc-GAL4 (BL55133), UAS-Ral (BL32094), UAS-Ral (BL29580) and UAS-mcd8RFP (BL32219) from Bloomington Drosophila Stock Centre; dStim (v47073) from Vienna Drosophila Resource Centre and UAS-dOrai .[34]
Fly images
Fly images were acquired using a Pro-Series camera attached to a stereo-microscope and images were obtained at the same zoom and image acquisition settings for all flies.
Single flight assay
In order to measure the ability of the flies to initiate and sustain flight, single flight assay was performed as described in.[15] Briefly, 2—5 days old flies of either sex were anaesthetized on ice for about a minute and then tethered on to a thin metal wire between the head and thorax. After allowing a short duration of recovery, a gentle, mouth blow air-puff was given as a stimulus to initiate flight, and the duration of time from initiation to cessation of flight was noted at flight duration. Flight duration observation was capped at fifteen minutes.
Climbing assay
Flies were tested for their climbing ability using an assay described in.[34] Briefly, a batch of ten 2—5 day old flies of either sex were dropped in a graduated glass cylinder, and tapped to collect them at the bottom. The number of flies that crossed the 8cm mark after this, in 12 seconds were noted as climbers. At least 3 independent batches of flies were used for this assay per genotype.
Preparation of thoracic flight muscles and microscopy
DVMs were dissected from adults of corresponding genotypes in ice cold 1x phosphate buffered saline (PBS) and fixed with 4% Paraformaldehyde (PFA) for an hour on ice. For visualizing DLMs, the thoraces were fixed with 4% PFA on ice for an hour and then cut longitudinally using a sharp blade. Both were mounted in 60% glycerol. The samples were imaged using a Leica SP5 confocal microscope using a 20x objective under similar image acquisition settings. Complete z-projects were obtained using Fiji [37] and no post-acquisition processing was performed.
RNA isolation and qRT-PCR
RNA was isolated from thoraces of adult female flies. Four thoraces were used per sample to isolate RNA using TRIzol (Invitrogen), following manufacturer's protocol. Approximately 500ng of total RNA was treated with DNAseI (Invitrogen) and reverse transcribed to cDNA using M-MLV (Invitrogen) as described in.[34] For quantitative PCR, Kapa SYBR Fast qPCR kit (KAPA Biosystems) was used in a 10µl reaction on a ABI QuantStudio3 system. Three biological replicates from independently isolated RNA samples were used for each experiment. A melt curve was performed to ensure a single product. Fold changes were calculated using the ΔΔCt method.[38]
β-Tubulin was used as an internal control. Primer sequences used are as follows (5′-3’):β-Tub(F) — CCAAGGGTCATTACACAGAGG, β-Tub(R)—ATCAGCAGGGTTCCCATACCdStim(F) — GAAGCAATGGATGTGGTTCTG, dStim(R) — CCGAGTTCGATGAACTGAGAGRal(F) — GACTACGAGCCCACCAAG, Ral(R) — CGGCATAATCCTCCTGGC
Data representation and statistics
Flight data is represented as box plots generated using BoxPlotR.[39] Otherwise, data is represented as bar graphs representing means and error bars, standard errors of mean. For analyses with more than two test conditions, One-way Analysis of Variance (ANOVA), followed by pairwise Tukey's test was used. Statistical significance post ANOVA is denoted with small alphabets, where different alphabets indicate statistical significance at p < 0.05 whereas same alphabet indicates statistically indistinguishable groups. For analyses comparing two conditions, unpaired, two-tailed Student's t-test was used and the exact p-values are indicated within the figures.
Authors: F Bernard; A Lalouette; M Gullaud; A Y Jeantet; R Cossard; A Zider; J F Ferveur; J Silber Journal: Dev Biol Date: 2003-08-15 Impact factor: 3.582
Authors: Anton L Bryantsev; Phillip W Baker; TyAnna L Lovato; MaryAnn S Jaramillo; Richard M Cripps Journal: Dev Biol Date: 2011-10-10 Impact factor: 3.582
Authors: Rita O Teodoro; Gulçin Pekkurnaz; Abdullah Nasser; Misao E Higashi-Kovtun; Maria Balakireva; Ian G McLachlan; Jacques Camonis; Thomas L Schwarz Journal: EMBO J Date: 2013-06-28 Impact factor: 11.598