A facile duplex-hairpin interconversion through a cruciform intermediate in a linear DNA fragment.

The duplex of d(GGTACGCGCGTGCGCGATGG) and d(CCATCGCGCGTGCGCGTACC) containing an inverted repeat has been studied by spectroscopic and electrophoretic techniques. Prior to melting this DNA fragment, like many other palindromes, transforms into hairpin structures but with four non-self-complementary bases ("dangling ends") at their termini. Most surprisingly, it is found that these dangling ends promote an unusually facile hairpin-duplex interconversion in contrast to very slow ones found in all the "blunt end" palindromes studied so far. Kinetic studies provide evidence, for the first time in a linear DNA fragment, that a cruciform intermediate is involved in the hairpin to duplex interconversion.