David Milewski1, David Balli1,2, Vladimir Ustiyan1, Tien Le1, Hendrik Dienemann3, Arne Warth4, Kai Breuhahn4, Jeffrey A Whitsett1, Vladimir V Kalinichenko1, Tanya V Kalin1. 1. Division of Pulmonary Biology, the Perinatal Institute of Cincinnati Children's Research Foundation, Cincinnati, Ohio, United States of America. 2. Abramson Family Cancer Research Institute, Perelman School of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania, United States of America. 3. Thoracic Hospital at Heidelberg University, Heidelberg, Germany. 4. Institute of Pathology, University Hospital Heidelberg, Heidelberg, Nationales Centrum für Tumorerkrankungen (NCT) Heidelberg, Im Neuenheimer Feld, Heidelberg Germany.
Abstract
Lung cancer remains one of the most prominent public health challenges, accounting for the highest incidence and mortality among all human cancers. While pulmonary invasive mucinous adenocarcinoma (PIMA) is one of the most aggressive types of non-small cell lung cancer, transcriptional drivers of PIMA remain poorly understood. In the present study, we found that Forkhead box M1 transcription factor (FOXM1) is highly expressed in human PIMAs and associated with increased extracellular mucin deposition and the loss of NKX2.1. To examine consequences of FOXM1 expression in tumor cells in vivo, we employed an inducible, transgenic mouse model to express an activated FOXM1 transcript in urethane-induced benign lung adenomas. FOXM1 accelerated tumor growth, induced progression from benign adenomas to invasive, metastatic adenocarcinomas, and induced SOX2, a marker of poorly differentiated tumor cells. Adenocarcinomas in FOXM1 transgenic mice expressed increased MUC5B and MUC5AC, and reduced NKX2.1, which are characteristics of mucinous adenocarcinomas. Expression of FOXM1 in KrasG12D transgenic mice increased the mucinous phenotype in KrasG12D-driven lung tumors. Anterior Gradient 2 (AGR2), an oncogene critical for intracellular processing and packaging of mucins, was increased in mouse and human PIMAs and was associated with FOXM1. FOXM1 directly bound to and transcriptionally activated human AGR2 gene promoter via the -257/-247 bp region. Finally, using orthotopic xenografts we demonstrated that inhibition of either FOXM1 or AGR2 in human PIMAs inhibited mucinous characteristics, and reduced tumor growth and invasion. Altogether, FOXM1 is necessary and sufficient to induce mucinous phenotypes in lung tumor cells in vivo.
Lung cancer remains one of the most prominent public health challenges, accounting for the highest incidence and mortality among all humancancers. While pulmonary invasive mucinous adenocarcinoma (PIMA) is one of the most aggressive types of non-small cell lung cancer, transcriptional drivers of PIMA remain poorly understood. In the present study, we found that Forkhead box M1 transcription factor (FOXM1) is highly expressed in human PIMAs and associated with increased extracellular mucin deposition and the loss of NKX2.1. To examine consequences of FOXM1 expression in tumor cells in vivo, we employed an inducible, transgenicmouse model to express an activated FOXM1 transcript in urethane-induced benign lung adenomas. FOXM1 accelerated tumor growth, induced progression from benign adenomas to invasive, metastatic adenocarcinomas, and induced SOX2, a marker of poorly differentiated tumor cells. Adenocarcinomas in FOXM1transgenic mice expressed increased MUC5B and MUC5AC, and reduced NKX2.1, which are characteristics of mucinous adenocarcinomas. Expression of FOXM1 in KrasG12Dtransgenic mice increased the mucinous phenotype in KrasG12D-driven lung tumors. Anterior Gradient 2 (AGR2), an oncogene critical for intracellular processing and packaging of mucins, was increased in mouse and human PIMAs and was associated with FOXM1. FOXM1 directly bound to and transcriptionally activated humanAGR2 gene promoter via the -257/-247 bp region. Finally, using orthotopic xenografts we demonstrated that inhibition of either FOXM1 or AGR2 in human PIMAs inhibited mucinous characteristics, and reduced tumor growth and invasion. Altogether, FOXM1 is necessary and sufficient to induce mucinous phenotypes in lung tumor cells in vivo.
Lung cancers are classified into small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC). Adenocarcinoma, the most common subtype of NSCLC, is a complex disease harboring activating mutations in KRAS (30%), EGFR (15%), or ALK (5%) genes [1]. Recently, specific and effective receptor tyrosine kinase inhibitors have been generated to treat patients with EGFR and ALK mutations. Efforts to pharmacologically inhibit oncogenic KRAS, however, have been largely unsuccessful and developing targeted therapies for KRAS-driven lung cancer remains a significant challenge. While the majority of human NSCLCs have robust expression of NKX2.1, a homeobox transcription factor which is routinely used as a marker of NSCLC [2], a subset of the KRAS-driven tumors was identified with reduced expression of NKX2.1 [3, 4] associated with mucinous characteristics and poor prognosis in NSCLCpatients [5]. NKX2.1 functions as a tumor suppressor in KRAS-driven mucinous adenocarcinomas, but has an oncogenic role in EGFR mutated lung tumors[3]. Haploinsufficiency of Nkx2.1 in mice induced KrasG12D-mediated lung tumorigenesis and increased production of mucins in KrasG12D-driven lung tumors [3]. While NKX2.1 represses mucinous differentiation in NSCLCs, transcriptional activators of mucinous phenotype remain unknown.Forkhead Box M1 (FOXM1) is a transcription factor activated by the RAS/ERK signaling pathway [6-8]. Activation of RAS-ERK drives cell cycle progression by regulating the temporal expression of cyclin regulatory subunits that bind to and activate their corresponding cyclin-dependent kinases (CDK). CDK2/Cyclin E and CDK1/Cyclin B complexes phosphorylate a variety of cell cycle regulatory proteins, including FOXM1, promoting G1/S and G2/M transitions [9, 10]. Activated ERK1/2, PLK1, CDK4 and CDK6 also phosphorylate FOXM1 and are required for full transcriptional competency of the FOXM1 protein [11, 12]. FOXM1 transcriptionally activates cell cycle regulatory genes critical for DNA replication and progression into mitosis, including Cyclin B1, PLK1, JNK1, CDC25B, TOPO2 and Aurora B [13-16]. FOXM1 is required for KRAS/ERK signaling during lung morphogenesis, since deletion of Foxm1 prevented defects in branching lung morphogenesis caused by Kras [6]. Deletion of Foxm1 from respiratory epithelial cells blocked tumorigenesis by oncogenic Kras [8], and decreased the tumor initiation and growth of Kras-mutations-associated chemically-induced mouselung tumors [17] [18]. In humans, increased FOXM1 was correlated with higher grades of lung cancers and poor patient survival [19]. While the role of FOXM1 in lung tumor initiation and growth is well established, it is unclear whether FOXM1 enhances progression from adenomas to adenocarcinomas and regulates metastasis of lung tumors in vivo.In the present study, we used a doxycycline-inducible transgenicmouse model to express an activated FOXM1 transcript in pre-existing, benign lung adenomas. FOXM1 caused progression of lung adenomas into invasive, metastatic adenocarcinomas with a mucinous phenotype. Inhibition of FOXM1 in humanmucinous adenocarcinoma cells inhibited mucinous characteristics and reduced tumor invasion in an orthotopic xenograft mouse model. We have demonstrated that FOXM1 is sufficient to drive progression of adenomas to adenocarcinomas and is required for maintainance of the mucinous phenotype.
Results
FOXM1 causes progression to invasive adenocarcinomas
To examine the role of FOXM1 in pulmonary carcinogenesis, we used a urethane-induced lung cancer model. Mice containing Spc-rtTA and tetO-GFP-FoxM1-ΔN transgenes were generated. Treatment with doxycycline (Dox) expresses an activated form of FOXM1, the FoxM1-ΔN, tagged with GFP [20]. To induce lung adenomas, the Spc-rtTA/tetO-GFP-FoxM1-ΔN double transgenic mice (epiFoxM1-ΔN) were treated with urethane (Fig 1A). Low-grade lung adenomas were present 14 weeks after initiation of urethane [16, 21], at which time epiFoxM1-ΔN mice were treated with Dox to express the FoxM1-ΔN transgene in SP-C-expressing cells and lung epithelial cells. Lungs were harvested 10 weeks later for tumor assessment. Expression of activated FOXM1 increased the number and size of tumors (Fig 1B) and led to histologically less differentiated tumors shown with H&E (Fig 1C). qRT-PCR analysis of micro-dissected tumors demonstrated human (transgenic) FOXM1 mRNA in epiFoxM1-ΔN lungs (Fig 1D). FoxM1-ΔN protein was detected in epithelial cells in the tumors by immunostaining (Fig 1E).
Fig 1
FOXM1 causes progression from benign lung adenomas to invasive adenocarcinomas.
To induce lung adenomas, the Spc-rtTA/tetO-GFP-FoxM1-ΔN double transgenic (epiFoxM1-ΔN, n = 9) and control single transgenic (n = 6) mice were treated with six IP injections of urethane. At 14 weeks after the first urethane injection, when early low-grade lung adenomas were already present, epiFoxM1-ΔN mice were treated with Dox to induce FOXM1-ΔN transgene in SP-C-expressing tumor cells and epithelial type II cells. Mouse lungs were harvested at 24 weeks after the first urethane injection. (A). Schematic of lung tumor induction and FoxM1-ΔN expression. (B) Average number (top) and size (bottom) of lung tumors following urethane treatment in control (n = 6 mice) and epiFoxM1-∆N (n = 9 mice) mice. (C) Representative H&E staining of lung tumors from control and epiFoxM1-ΔN mice demonstrates invasive and less differentiated phenotype of epiFoxM1-ΔN tumors compared to controls. (D) Efficient expression of FOXM1-ΔN mRNA in microdissected epiFoxM1-ΔN tumors (n = 5) compared to control tumors (n = 5) shown by qRT-PCR. mRNA levels were normalized to β-actin mRNA. (E) Efficient expression of transgenic FOXM1 protein in epiFoxM1-ΔN tumors shown by immunochistochemictry (IHC) using an anti-GFP antibody (top panels) and anti-FoxM1 antibody (bottom panels). (F) Schematic diagrams of the tumor grades distribution in control and epiFoxM1-ΔN mouse lungs. 25 tumors were analyzed from 9 epiFoxM1-ΔN mice, and 23 tumors from 6 control lungs. 10 images from each mouse lung were used for analysis. A p-value <0.05 is marked with a single asterik (*) and a p-value <0.01 is marked with a double asterik (**).
FOXM1 causes progression from benign lung adenomas to invasive adenocarcinomas.
To induce lung adenomas, the Spc-rtTA/tetO-GFP-FoxM1-ΔN double transgenic (epiFoxM1-ΔN, n = 9) and control single transgenic (n = 6) mice were treated with six IP injections of urethane. At 14 weeks after the first urethane injection, when early low-grade lung adenomas were already present, epiFoxM1-ΔN mice were treated with Dox to induce FOXM1-ΔN transgene in SP-C-expressing tumor cells and epithelial type II cells. Mouse lungs were harvested at 24 weeks after the first urethane injection. (A). Schematic of lung tumor induction and FoxM1-ΔN expression. (B) Average number (top) and size (bottom) of lung tumors following urethane treatment in control (n = 6 mice) and epiFoxM1-∆N (n = 9 mice) mice. (C) Representative H&E staining of lung tumors from control and epiFoxM1-ΔN mice demonstrates invasive and less differentiated phenotype of epiFoxM1-ΔN tumors compared to controls. (D) Efficient expression of FOXM1-ΔN mRNA in microdissected epiFoxM1-ΔN tumors (n = 5) compared to control tumors (n = 5) shown by qRT-PCR. mRNA levels were normalized to β-actin mRNA. (E) Efficient expression of transgenicFOXM1 protein in epiFoxM1-ΔN tumors shown by immunochistochemictry (IHC) using an anti-GFP antibody (top panels) and anti-FoxM1 antibody (bottom panels). (F) Schematic diagrams of the tumor grades distribution in control and epiFoxM1-ΔN mouse lungs. 25 tumors were analyzed from 9 epiFoxM1-ΔN mice, and 23 tumors from 6 control lungs. 10 images from each mouse lung were used for analysis. A p-value <0.05 is marked with a single asterik (*) and a p-value <0.01 is marked with a double asterik (**).Consistent with published studies [21-23], the majority of tumors in control urethane-treated mice were classified as low grades 1 and 2 non-small lung tumors (72%). Only 14% of tumors were high grades 3 and 4 lung adenocarcinomas (Fig 1F and S1 Fig). Expression of FoxM1-ΔN in low-grade adenomas increased the frequency of highgrade 4 tumors (23% vs. 7%), and caused progression into poorly differentiated adenocarcinomas (7%) which were not detected in the controls (Fig 1F and S1 Fig). All tumors in control and epiFoxM1-ΔN mice were positive for proSP-C (Fig 2A), which is consistent with previous studies and confirms the type II alveolar epithelial origin of tumor cells [16, 24]. EpiFoxM1-ΔN tumors often invaded the airways as shown by proSP-C stained tumor cells in the bronchial lumen stained with CCSP (CC10) (Fig 2A). Peritoneal lymph node metastasis were found in epiFoxM1-ΔN mice which expressed lung-specific NKX2.1 (TTF-1) protein (Fig 2B, right panel), indicating that the metastases were derived from FoxM1-ΔN-positive tumors that expressed stabilized humanFOXM1 transgene [20]. Metastases were not present in control mice. Altogether, expression of activated FoxM1-ΔN in benign lung adenomas caused tumor progression into poorly differentiated, metastatic adenocarcinomas.
Fig 2
Expression of FOXM1 drives tumor invasion and metastasis.
(A) Tumor invasion into the conducting airways was shown by immunofluorescence staining for pro-SPC (tumor cells, red) and CCSP (CC10, bronchiolar epithelium, green). (B) Frequency of peritoneal lymph node metastases (left panel). None of the control mice (n = 6) developed metastasis. Metastases were found in two epiFoxM1-ΔN mice (n = 9). H&E staining and NKX2.1 immunostaining of epiFoxM1-ΔN peritoneal metastasis are shown in right panels.
Expression of FOXM1 drives tumor invasion and metastasis.
(A) Tumor invasion into the conducting airways was shown by immunofluorescence staining for pro-SPC (tumor cells, red) and CCSP (CC10, bronchiolar epithelium, green). (B) Frequency of peritoneal lymph node metastases (left panel). None of the control mice (n = 6) developed metastasis. Metastases were found in two epiFoxM1-ΔN mice (n = 9). H&E staining and NKX2.1 immunostaining of epiFoxM1-ΔN peritoneal metastasis are shown in right panels.
FOXM1 increases cellular proliferation in epiFoxM1-ΔN tumors
Since FOXM1 is often expressed in proliferating cells and activates cell cycle regulatory genes, we used immunostaining for Ki-67 to visualize proliferating cells. Tumors from epiFoxM1-ΔN mice had increased numbers of Ki-67-positive cells (Fig 3A). No differences were observed in the frequency of apoptosis, as assessed by cleaved-caspase 3 immunostaining (Fig 3B). SOX2, a marker of stem-like and less differentiated NSCLC tumor cells [25, 26] and a known transcriptional target of FOXM1 [27], was increased in the epiFoxM1-ΔN tumors (Fig 3C, left panels). Sox2 mRNA was increased in micro-dissected lung tumors from epiFoxM1-ΔN mice (Fig 3C, right panel). Thus, expression of activated FoxM1-ΔN in lung adenomas increased tumor cell proliferation and induced SOX2.
Fig 3
FOXM1 increases cellular proliferation in epiFoxM1-ΔN tumors.
(A) Increased number of Ki67-positive cells in epiFoxM1-ΔN tumors is shown by immuno staining (left panels). Numbers of Ki67-positive cells were counted in ten random fields of control and epiFoxM1-ΔN tumors at 200x magnification (right graph). (B) No changes in apoptosis were found in epiFoxM1-ΔN tumors compared to controls. Tumors were stained with antibodies specific to cleaved caspase 3 (arrows, left panels) and the number of positive cells were counted (right graph). The number of cleaved caspase 3-positive cells was counted using ten random fields at 200x magnification. (C) Expression of FOXM1 in lung adenomas increased the number of SOX2-positive cells. The increased SOX2 protein is shown with immunohistochemistry using antibodies against SOX2 (left panels). Increased Sox2 mRNA is demonstrated by qRT-PCR (right graph). β-actin mRNA was used for normalization. A p-value <0.01 is marked with a double asterik (**).
FOXM1 increases cellular proliferation in epiFoxM1-ΔN tumors.
(A) Increased number of Ki67-positive cells in epiFoxM1-ΔN tumors is shown by immuno staining (left panels). Numbers of Ki67-positive cells were counted in ten random fields of control and epiFoxM1-ΔN tumors at 200x magnification (right graph). (B) No changes in apoptosis were found in epiFoxM1-ΔN tumors compared to controls. Tumors were stained with antibodies specific to cleaved caspase 3 (arrows, left panels) and the number of positive cells were counted (right graph). The number of cleaved caspase 3-positive cells was counted using ten random fields at 200x magnification. (C) Expression of FOXM1 in lung adenomas increased the number of SOX2-positive cells. The increased SOX2 protein is shown with immunohistochemistry using antibodies against SOX2 (left panels). Increased Sox2 mRNA is demonstrated by qRT-PCR (right graph). β-actin mRNA was used for normalization. A p-value <0.01 is marked with a double asterik (**).
Mucinous characteristics of epiFoxm1-∆N tumors
NKX2.1 is often used as a diagnostic marker of human NSCLCs [28], and its expression is decreased in mucinous tumor subtypes [3, 4]. While lung tumors from control mice maintained robust expression of NKX2.1, the NKX2.1 staining was decreased in epiFoxM1-ΔN tumors (Fig 4A, brown nuclei) and associated with decreased Nkx2.1 mRNA (Fig 4B). NKX2.1 was absent in a majority of FoxM1-ΔN-expressing tumor cells (Fig 4C) and associated with increased extracellular mucus deposition as shown by Alcian Blue staining (Fig 4A). Expression of mucins MUC5B and MUC5AC were increased in epiFoxM1-ΔN tumors (Fig 4D). We also tested whether FOXM1 induced mucinous adenocarcinomas in a Kras model of lung cancer. Mice co-expressing both the Kras and the FoxM1-ΔN transgenes (SPC-rtTA/ TetO- Kras/ TetO-FoxM1-ΔN, [20]) developed mucinous lung adenocarcinomas compared to mice expressing Kras alone (Fig 4E). Taken together, our data demonstrate that FOXM1 expression in lung tumors suppresses NKX2.1 and causes progression of lung adenomas into poorly differentiated, mucinous, metastatic lung adenocarcinomas.
Fig 4
Expression of FOXM1 promotes mucinous characteristics in mouse lung tumors induced either by urethane or KrasG12D.
(A) Lung sections form urethane-treated mice (control n = 6 and epiFoxM1-ΔN n = 9 mice) were stained with antibodies against Nkx2-1 and Alcian blue. Tumors in epiFoxM1-ΔN mice were highly positive for mucus (blue) and had low Nkx2-1 protein levels (brown). (B)
Nkx2-1 mRNA was decreased in microdissected epiFoxM1-ΔN tumors (n = 5) compared to control tumors (n = 5) as shown by qRT-PCR. β-actin mRNA was used for normalization. Data represent mean ± SD of three independent determinations using micro-dissected lung tumors from n = 6 control mice and n = 9 epiFoxM1-ΔN mice. (C) Co-localization studies demonstrated decreased Nkx2-1 in FoxM1-ΔN-positive tumor cells. (D) Tumors from epiFoxM1-ΔN mice stained positive for Muc5B and Muc5Ac as shown by immunofluorescence staining. (E) Parafin section from Kras-induced lung tumors (SPC-rtTA/TetO-Kras mice, n = 3) and Kras; epiFoxM1-ΔN mice (SPC-rtTA/TetO-Kras/TetO-FoxM1-ΔN mice, n = 3) were stained with Alcian blue. FoxM1-ΔN caused mucus depositions in lung tumors induced with Kras. A p-value <0.05 is marked with an asterik (*).
Expression of FOXM1 promotes mucinous characteristics in mouse lung tumors induced either by urethane or KrasG12D.
(A) Lung sections form urethane-treated mice (control n = 6 and epiFoxM1-ΔN n = 9 mice) were stained with antibodies against Nkx2-1 and Alcian blue. Tumors in epiFoxM1-ΔN mice were highly positive for mucus (blue) and had low Nkx2-1 protein levels (brown). (B)
Nkx2-1 mRNA was decreased in microdissected epiFoxM1-ΔN tumors (n = 5) compared to control tumors (n = 5) as shown by qRT-PCR. β-actin mRNA was used for normalization. Data represent mean ± SD of three independent determinations using micro-dissected lung tumors from n = 6 control mice and n = 9 epiFoxM1-ΔN mice. (C) Co-localization studies demonstrated decreased Nkx2-1 in FoxM1-ΔN-positive tumor cells. (D) Tumors from epiFoxM1-ΔN mice stained positive for Muc5B and Muc5Ac as shown by immunofluorescence staining. (E) Parafin section from Kras-induced lung tumors (SPC-rtTA/TetO-Krasmice, n = 3) and Kras; epiFoxM1-ΔN mice (SPC-rtTA/TetO-Kras/TetO-FoxM1-ΔN mice, n = 3) were stained with Alcian blue. FoxM1-ΔN caused mucus depositions in lung tumors induced with Kras. A p-value <0.05 is marked with an asterik (*).
FOXM1 regulates AGR2 in mouse and human lung adenocarcinomas
FOXM1 staining was increased in tumor cells in humanpulmonary invasive mucinous adenocarcinomas (PIMAs) compared to adjacent normal lung tissue, where FOXM1 was not detected (Fig 5A, upper panels). FOXM1 staining in human PIMAs was associated with abundant deposition of mucins (Fig 5A, middle panels), loss of NKX2.1 (Fig 5A middle panels) and increased expression of AGR2 (Fig 5A bottom panels), an ER chaperone critical for the posttranslational processing of mucins and associated with various oncogenic functions, [29, 30]. AGR2 was co-locolized with FOXM1 in human PIMA cells (Fig 6A). In mice, expression of FoxM1-ΔN in urethane-induced or KrasG12D-driven lung tumors led to increased AGR2 staining and Agr2 mRNA expression (Fig 6B and 6C). Thus, FOXM1 induces AGR2 in mouse and humanmucinous lung adenocarcinomas.
Fig 5
FOXM1 and AGR2 are highly expressed in human pulmonary invasive mucinous adenocarcinomas (PIMAs).
Representative images of lung tissue sections from patients with PIMAs (n = 12 patients, S2 Table). Images include adjacent normal lung tissue (left panels) and tumor lesions (right panels) in matched patients. Tissue sections were stained with antibodies against FOXM1, AGR2, NKX2.1 or stained for mucus using Alcian blue (left panels). Image J software was used to quantify intensity of staining (right graphs). A minimum of 5 random 20x field images per patient were quantified. Increased FOXM1 staining in PIMAs was associated with abundant Alcian blue staining, loss of NKX2.1 and increased expression of AGR2 in tumor cells.
Fig 6
FOXM1 induces AGR2 in human and mouse lung adenocarcinomas.
(A) In human PIMAs, immunofluorescence co-localization studies demonstrated that FOXM1-positive tumor cells were highly positive for AGR2. (B) In mouse urethane-induced lung cancer model, AGR2 was induced in epiFoxM1-ΔN tumors. Immunofluorescence staining for AGR2 in control and epiFoxM1-ΔN lung tumors (left panels, n = 6 control mice and n = 9 epiFoxM1-∆N mice, ten images per each mouse lung) and qRT-PCR of Agr2 mRNA using RNA from microdissected control (n = 5) and epiFoxM1-ΔN (n = 5) lung tumors (right panel). β-actin mRNA was used for normalization. A p-value <0.01 is marked with a double asterik (**). (C) In mouse KrasG12D –induced lung cancer models, AGR2 was induced in lung tumors of Kras/ epiFoxM1-ΔN mice (n = 3) compared to control Kras mice (n = 3). (D) FoxM1 is required for AGR2 expression in PIMAs. Human PIMA cell lines A549 and H2122 were stable transduced with control (scramble) or shRNAs against human FoxM1 (shFoxM1 #1 or shFoxM1 #2). Efficient inhibition of FoxM1 decreased Agr2 expression in both A549 (top) and H2122 (bottom) PIMA cells, shown with qRT-PCR. β-actin mRNA was used for normalization. A p-value <0.01 is marked with a double asterik (**). (E) Western blot shows the correlation of the loss of FOXM1 and AGR2 in the A549 (top) and H2122 (bottom) cell lines.
FOXM1 and AGR2 are highly expressed in human pulmonary invasive mucinous adenocarcinomas (PIMAs).
Representative images of lung tissue sections from patients with PIMAs (n = 12 patients, S2 Table). Images include adjacent normal lung tissue (left panels) and tumor lesions (right panels) in matched patients. Tissue sections were stained with antibodies against FOXM1, AGR2, NKX2.1 or stained for mucus using Alcian blue (left panels). Image J software was used to quantify intensity of staining (right graphs). A minimum of 5 random 20x field images per patient were quantified. Increased FOXM1 staining in PIMAs was associated with abundant Alcian blue staining, loss of NKX2.1 and increased expression of AGR2 in tumor cells.
FOXM1 induces AGR2 in human and mouse lung adenocarcinomas.
(A) In human PIMAs, immunofluorescence co-localization studies demonstrated that FOXM1-positive tumor cells were highly positive for AGR2. (B) In mouseurethane-induced lung cancer model, AGR2 was induced in epiFoxM1-ΔN tumors. Immunofluorescence staining for AGR2 in control and epiFoxM1-ΔN lung tumors (left panels, n = 6 control mice and n = 9 epiFoxM1-∆N mice, ten images per each mouse lung) and qRT-PCR of Agr2 mRNA using RNA from microdissected control (n = 5) and epiFoxM1-ΔN (n = 5) lung tumors (right panel). β-actin mRNA was used for normalization. A p-value <0.01 is marked with a double asterik (**). (C) In mouseKrasG12D –induced lung cancer models, AGR2 was induced in lung tumors of Kras/ epiFoxM1-ΔN mice (n = 3) compared to control Krasmice (n = 3). (D) FoxM1 is required for AGR2 expression in PIMAs. Human PIMA cell lines A549 and H2122 were stable transduced with control (scramble) or shRNAs against humanFoxM1 (shFoxM1 #1 or shFoxM1 #2). Efficient inhibition of FoxM1 decreased Agr2 expression in both A549 (top) and H2122 (bottom) PIMA cells, shown with qRT-PCR. β-actin mRNA was used for normalization. A p-value <0.01 is marked with a double asterik (**). (E) Western blot shows the correlation of the loss of FOXM1 and AGR2 in the A549 (top) and H2122 (bottom) cell lines.To determine whether FOXM1 regulates AGR2, we used shRNA lentiviral vectors to inhibit FOXM1 expression in A549 cells, a humanmucinous lung cancer cell line with a KrasG12S mutation. Inhibition of FOXM1 reduced expression of AGR2 (Fig 6D and 6E) and was associated with decreased expression of proliferation-specific Cyclins B1, E1, A1 and D1 (S2A Fig). FOXM1 depletion reduced mRNAs of goblet cell associated genes MUC5AC, MUC5B, MUC1 and SPDEF (S2B Fig), the latter is a critical transcriptional regulator of mucinous phenotype [31]. To demonstrate that the FOXM1 regulation of the mucinous phenotype is not limited to one cell line, we also inhibited FOXM1 in H2122 cells, another humanmucinous lung adenocarcinoma with an activating mutation in Kras (KrasG12C). Similar to findings in A549 cells, inhibition of FOXM1 reduced AGR2 mRNA and protein in H2122 cells (Fig 6D and 6E). Thus, FOXM1 is essential for AGR2 expression and the mucinous phenotype in humanmucinous lung adenocarcinoma cell lines.
FOXM1 induces transcription of AGR2
Since AGR2 was increased in FoxM1-ΔN expressing mouselung tumors and human PIMAs (Fig 6), we tested whether FOXM1 directly activates the transcription of the AGR2 gene. A potential FOXM1-binding site was found within the -257/-247 bp region of the humanAGR2 gene promoter (Fig 7A). Chromatin immunoprecipation (ChIP) in A549 cells demonstrated that FOXM1 directly bound to the -257/-247 bp region of the AGR2 promoter (Fig 7A). Next we cloned a -2.0 kb fragment of the humanAGR2 promoter into luciferase (LUC)-expressing vector and co-transfected the -2.0 kb AGR2-LUC plasmid with a CMV-FOXM1 expression vector into A549 cells. FOXM1 increased the transcriptional activity of the AGR2 promoter (Fig 7B). Site-directed mutagenesis of the FOXM1 binding site blocked the ability of CMV-FOXM1 to activate the AGR2 promoter, indicating that the -257/-247 bp AGR2 region was required for FOXM1-mediated activation of AGR2 (Fig 7B). Thus, AGR2 is a direct transcriptional target of FOXM1.
Fig 7
FOXM1 increases transcription of AGR2 and is required to maintain mucinous phenotype in PIMAs.
(A) Schematic of a potential FOXM1 binding site in the AGR2 promoter (left panel). ChIP shows binding of FOXM1 to the AGR2 promoter in A549 cells (right panel). A549 cells were fixed, lysed, sonicated, and used for immunoprecipitation with an antibody against FOXM1 or rabbit control IgG. PCR was performed encompassing a predicted FOXM1 binding site from -257bp to -247bp of the human AGR2 promoter. DNA region located at –6.0 kb of Agr2 promoter was used as a negative control. (B) FOXM1 transcriptionally activates AGR2 promoter. Sequence denotes the predicted binding motif and the sequencing results following mutagenesis (top). Dual luciferase assay in Hek293T cells transfected with the WT (AGR2-Luc) or mutated -2.0kb AGR2 (mut AGR2-Luc) promoter and an empty (CMV-Empty) or human FoxM1 expression (CMV-FoxM1) vectors is shown (bottom). A p-value <0.01 is marked with a double asterik (**). (C) Depletion of FOXM1 in human invasive mucinous A549 adenocarcinoma cells decreased lung tumor growth in the orthotopic xenograft model of lung cancer. A549 cells were inoculated into tracheas of immunocompromised mice. Representative images of H&E staining (5–8 images per mouse lung) and photographs of mouse lungs after eight weeks post tumor inoculation are shown (left panels). Tumor numbers and sizes in the two groups (n = 6 control (Scramble) and n = 6 shFoxM1 mice) are shown (right panel). (D-E) FoxM1 is required to maintain mucinous phenotype in human PIMAs shown in orthotopic xenograft model of lung cancer (n = 6 control mice and n = 6 shFoxM1 mice). (D) Inhibition of FOXM1 reduces mucus depositions shown with Alcian Blue, and (E) reduces AGR2 and MUC5AC expression in A549 orthotopic xenografts. AGR2 co-localizes with MUC5Ac in the orthotopic A549 xenografts. 5–8 images per mouse lung were used. (F) Frequency of observed mediastinal lymph node and liver metastases in control (Scramble) mice (n = 6) and shFoxM1 mice (n = 6). (G) Control (Scramble) orthotopic A549 xenograft tumors (green) invade airways (purple). No invasion of tumor cells into airways was found in FOXM1-deficient tumors.
FOXM1 increases transcription of AGR2 and is required to maintain mucinous phenotype in PIMAs.
(A) Schematic of a potential FOXM1 binding site in the AGR2 promoter (left panel). ChIP shows binding of FOXM1 to the AGR2 promoter in A549 cells (right panel). A549 cells were fixed, lysed, sonicated, and used for immunoprecipitation with an antibody against FOXM1 or rabbit control IgG. PCR was performed encompassing a predicted FOXM1 binding site from -257bp to -247bp of the humanAGR2 promoter. DNA region located at –6.0 kb of Agr2 promoter was used as a negative control. (B) FOXM1 transcriptionally activates AGR2 promoter. Sequence denotes the predicted binding motif and the sequencing results following mutagenesis (top). Dual luciferase assay in Hek293T cells transfected with the WT (AGR2-Luc) or mutated -2.0kb AGR2 (mut AGR2-Luc) promoter and an empty (CMV-Empty) or humanFoxM1 expression (CMV-FoxM1) vectors is shown (bottom). A p-value <0.01 is marked with a double asterik (**). (C) Depletion of FOXM1 in humaninvasive mucinous A549 adenocarcinoma cells decreased lung tumor growth in the orthotopic xenograft model of lung cancer. A549 cells were inoculated into tracheas of immunocompromised mice. Representative images of H&E staining (5–8 images per mouse lung) and photographs of mouse lungs after eight weeks post tumor inoculation are shown (left panels). Tumor numbers and sizes in the two groups (n = 6 control (Scramble) and n = 6 shFoxM1 mice) are shown (right panel). (D-E) FoxM1 is required to maintain mucinous phenotype in human PIMAs shown in orthotopic xenograft model of lung cancer (n = 6 control mice and n = 6 shFoxM1 mice). (D) Inhibition of FOXM1 reduces mucus depositions shown with Alcian Blue, and (E) reduces AGR2 and MUC5AC expression in A549 orthotopic xenografts. AGR2 co-localizes with MUC5Ac in the orthotopic A549 xenografts. 5–8 images per mouse lung were used. (F) Frequency of observed mediastinal lymph node and liver metastases in control (Scramble) mice (n = 6) and shFoxM1 mice (n = 6). (G) Control (Scramble) orthotopic A549 xenograft tumors (green) invade airways (purple). No invasion of tumor cells into airways was found in FOXM1-deficient tumors.Interestingly, overexpression of AGR2 in FOXM1-defecient A459 cells rescued mRNA and protein levels of Cyclin D1, but was not able to rescue expression of other cyclins and mucinoius genes (Supplemental S3 Fig). Depletion of AGR2 alone was sufficient to decrease expression of proliferation-specific and mucin-specific genes (S3 Fig) and reduce the growth of A549 cell in vitro (S4A Fig). These data demonstrate that both FOXM1 and AGR2 are critical for cell growth and maintenance of the mucinous phenotype in PIMA cells in vitro.
FOXM1 and AGR2 maintain mucinous characteristics of lung adenocarcinomas in vivo
We used lentiviral shRNA to stably inhibit FOXM1 in A549 cells in an orthotopic xenograft tumor model. Single cell suspensions of control and FOXM1-deficient A549 cells were delivered into the tracheas of immunocompromised mice. Eight weeks after inoculation, control A549 cells formed numerous tumors while FOXM1-deficient cells formed smaller and fewer tumors (Fig 7C). FOXM1-deficient xenografts were also less mucinous, with substantially reduced cytoplasmic swelling and reduced staining with Alcian blue (Fig 7C and 7D) and associated with decreased staining of AGR2 and MUC5AC (Fig 7E). Interestingly, parental A549 cells frequently metastasized into the mediastinal lymph nodes (6 out of n = 6 mice, 100% incidence of lymph node metastasis) and into the liver (2 out of n = 6 mice, 33% incidence of liver metastasis) (Fig 7F). In contrast, FOXM1-depleted tumors did not develop liver metastasis (0 out of n = 6 mice, 0%) and had decreased metastatic potential for mediastinal lymph nodes (1 out of n = 6 mice, 17%) (Fig 7F). In addition, control A549 tumors were locally invasive, infiltrating the pulmonary bronchioles and alveolar regions, whereas FOXM1-deficient A549 tumors were non-invasive (Fig 7G). Similar to intra-tracheal administration, a direct inoculation of FOXM1-deficient A549 cells into the left lung lobe inhibited the tumor growth and metastasis into the liver and mediastinal lymph nodes (S4B and S4C Fig). Similar effect was found after inhibition of AGR2 (S4B and S4C Fig). Thus, knockdown of FOXM1 or AGR2 reduced tumor invasion and inhibited mucinous phenotype of humanlung A549 adenocarcinomas in vivo.
Discussion
Activating KRAS mutations are associated with poor prognosis in patients with non-small cell lung cancers (NSCLCs), and KRAS mutant NSCLC tumors are often resistant to common anti-cancer drugs. Several KRAS-regulated kinases, including ERK1/2, PLK1, CDK1, CDK2, CDK4 and CDK6 phosphorylate FOXM1, contributing to its transcriptional activation. While FOXM1 alone was insufficient to induce lung tumors in transgenic mice [32], genetic deletion of Foxm1 from mouse respiratory epithelium inhibited the initiation of lung tumorigenesis by KrasG12D [8]. These results indicate that FOXM1 functions downstream of oncogenic KRAS to induce lung tumorgenesis. Deletion of Foxm1 from fetal mouse lungs prevented the effects of activated KrasG12D during lung development [6], demonstrating an important role for FOXM1 downstream of the KRAS/ ERK signaling cascade. In the present study, we found that FOXM1 is necessary and sufficient to induce mucinous characteristics in lung adenocarcinomas induced by either urethane or KrasG12D. The FoxM1-ΔN-expressing mousetumors resembled humanpulmonary invasive mucinous adenocarcinomas (PIMAs), an aggressive subtype of NSCLC associated with activating mutations in KRAS [1]. Consistent with these findings, we detected robust expression of FOXM1 in human PIMAs. Since FOXM1 is required for KRAS/ERK signaling in mousetumor models, our studies provide a rationale for pharmacological targeting FOXM1 in PIMA tumors with activating KRAS mutations.We found that transgenic expression of activated FoxM1-ΔN increased cell proliferation and tumor growth, findings consistent with the known role of FOXM1 in activation of cell cycle regulatory genes [13, 14]. Expression of FOXM1 in Rosa26-FoxM1transgenic mice accelerated proliferation of tumor cells and increased the number and size of lung adenomas after tumor initiation/ promotion with 3-methylcholanthrene (MCA)/butylated hydroxytoluene (BHT) [15, 32]. Likewise, genetic deletion of the Foxm1 gene from adult mouse respiratory epithelium inhibited tumorigenesis caused by MCA/BHT or urethane [17]. In the present study, we observed abundant extracellular mucin and reduced NKX2.1 expression in FoxM1-ΔN-expressing tumors, features characteristic of human PIMAs [5]. This unexpected finding was further investigated using PIMA cell lines in which FOXM1 expression was required for expression of MUC5AC, MUC5B, MUC1, and the mucin-associated disulfide isomerase, AGR2 in vitro and in an orthotopic xenograft mouse model. Our data are consistent with published studies demonstrating that deletion of Foxm1 from respiratory epithelial cells or pharmacological inhibition of FOXM1 by RCM-1 compound reduces MUC5AC and prevents differentiation of mucin-producing goblet cells in mouseasthma models [33, 34].AGR2 is an ER chaperone which functions as a proto-oncogene in breast, colon, and esophageal adenocarcinoma [30, 35–37]. Since AGR2 was highly expressed in the Kras-LSL; Nkx2.1-/+ mucinous lung carcinomas [3, 38], we investigated AGR2 expression in a carcinogen-induced FoxM1-ΔN transgenicmouse model and human PIMAs. We identified AGR2 was highly expressed in both PIMAs and FoxM1-ΔN-expressing mouselung tumors, as a result of direct transcriptional activation by FOXM1. Although the oncogenic functions of AGR2 remain largely unknown, AGR2 expression was demonstrated to be prognostic in humanlung cancer [39]. In normal goblet cells, AGR2 is required for folding and processing of secreted (MUC5AC) and membranous mucins (MUC1, MUC2, MUC5B;) which have also been implicated in various tumor-promoting processes [30, 40]. AGR2 was also shown to interact with reptin an inhibitor of p53, which may contribute to tumor cell proliferation and survival [41]. These molecular interactions may promote the mucinous and aggressive nature of PIMA tumors. Consistent with important role of FOXM1 and AGR2 in PIMAs, inactivation of either AGR2 or FOXM1 was sufficient to inhibit the tumor growth, invasion and metastasis in orthotopic mouse model. Altogether, our studies support a model in which FOXM1 functions downstream of KRAS and stimulates expression of AGR2 and other proliferation-specific and mucinous genes (Fig 8). Both FOXM1 and AGR2 induce tumor growth, progression, invasiveness and maintain mucinous characteristics in PIMAs. Since PIMA is a particularly aggressive cancer subtype without specific therapeutic options, our findings suggest that pharmacological inhibition of either AGR2 or its upstream regulator, FOXM1, may be beneficial for PIMA patients.
Fig 8
FOXM1 stimulates progression of lung adenomas into mucinous adenocarcinomas.
Schematic drawing shows that FOXF1 induces expression of cell-cycle regulatory and mucinous genes, including Agr2, causing increased tumor cell proliferation and mucinous phenotype. FOXM1 directly activates transcription of Agr2. Both FOXM1 and AGR2 are critical for PIMA growth, invasion and progression of lung adenomas into aggressive mucinous adenocarcinomas.
FOXM1 stimulates progression of lung adenomas into mucinous adenocarcinomas.
Schematic drawing shows that FOXF1 induces expression of cell-cycle regulatory and mucinous genes, including Agr2, causing increased tumor cell proliferation and mucinous phenotype. FOXM1 directly activates transcription of Agr2. Both FOXM1 and AGR2 are critical for PIMA growth, invasion and progression of lung adenomas into aggressive mucinous adenocarcinomas.Modeling mucinous lung adenocarcinomas in mice requires both activation of oncogenic KRAS and downregulation of Nkx2.1 [3]. Neither KRAS activation nor reduction of NKX2.1 alone is sufficient for carcinoma development or mucin production, indicating context specific crosstalk between these two genes. In the present study, expression of FoxM1-ΔN in urethane-induced lung adenomas decreased NKX2.1 and increased tumor progression and mucin production. Since urethane generates activating mutations in Kras, FOXM1 may regulate genetic interactions between Kras and Nkx2.1 during development of mucinous lung adenocarcinomas. Interestingly, FoxM1-ΔN-expressing lung tumors contained many SOX2 expressing cells [27]. Since SOX2 is a marker of stem-like and dedifferentiated tumor cells [42], activation of SOX2 can contribute to increased invasiveness of lung tumors in FoxM1-ΔN transgenic mice.In summary, activation of FOXM1 in pre-existed lung adenomas caused progression to invasive, metastatic adenocarcinomas. FOXM1 enhanced mucinous characteristics in lung tumors and transcriptionally activated Agr2, a mucin-associated oncogene. We have developed a mouse model of mucinous, metastatic lung adenocarcinomas and demonstrated that FOXM1 is necessary and sufficient to induce mucinous phenotype in lung tumor cells.
Materials and methods
Ethics statement
The cohort consisted of an independent lung adenocarcinomapatients who underwent lung cancer resection at the Department of Thoracic Surgery of the Thoraxklinik at the University Hospital Heidelberg. All samples were obtained with the informed consent of the patients and the approval of the local Ethics Committee of the University of Heidelberg (protocols 270/2001 and 206/2005). All animal studies were reviewed and approved by the Cincinnati Children's Hospital Medical Center Institutional Animal Care and Use Committee (protocol number IACUC2016-0070). We followed the guidelines outlined in CITI Training Program for Animal Care and Use (The Collaborative Institutional Training Initiative (CITI) and Association for Assessment and Accreditation of laboratory Animal Care (AAALAC).
Animal models
SPC-rtTA mice harboring a 3.7kb fragment of the humanSPC promoter was used to drive expression of an rtTA cassette as previously described [43]. (TetO)-CMV-GFP-FoxM1-ΔN mice possessed a stabilized humanFOXM1 cDNA cassette fused to GFP as previously described [20]. SPC-rtTA mice were bred to (TetO)-CMV-GFP-FoxM1-ΔN to generate SPC-rtTA;TetO-FoxM1-ΔN mice as previously described [20]. Mice with single or no transgenes were used as controls. SPC-rtTA;TetO-FoxM1-ΔN mice without doxycycline were also used as controls. 6–8 week old male mice received six intraperitoneal (I.P.) injections of urethane at a dose of 1 gram per kilogram of body weight. 14 weeks after the first injection, mice were maintained on chow containing doxycycline, except for SPC-rtTA;TetO-FoxM1-ΔN control mice. The SPC-rtTA/ TetO- Kras/ TetO-FoxM1-ΔN mousetumor model was used as previously described [20]. For A549 orthotopic xenograft experiments, 2.5x105 A549 cells were inoculated into the tracheas or left lung lobes of 8 week old male NOD.Cg-Prkdc;Il2rg/SzJ (NSG) immunocompromised mice.
RNA isolation and real-time qRT-PCR
Total mRNA was isolated from microdissected lung tumors or cell lines using RNA Stat60 according to the manufacturer’s instructions. Isolated total mRNA was treated with DNASE I (Promega) according to the manufacturer’s instructions. DNASE treated RNA was reverse transcribed into cDNA using the High Capacity cDNA Reverse Transcription Kit (Invitrogen). Real time PCR was performed using the TaqMan Gene Expression Assays and a StepOnePlus Real-Time PCR System (Invitrogen) as described previously [44]. Inventoried TaqMan mouse gene assays are summarized in S1 Table. All reactions were performed in triplicate and normalized to β-actin mRNA.
Lung histology, immunohistochemistry, and immunofluorescence
Mouse and human lung tissue paraffin sections (5μm) were stained with the following antibodies: anti-FOXM1 (Santa Cruz), anti-GFP (Abcam), anti-SPC (Seven Hills Bioreagents), anti-CC10 (Santa Cruz), anti-NKX2.1 (Seven Hills Bioreagents), anti-AGR2 (Cell Signaling), anti-MUC5Ac, anti-MUC5B (Abcam), anti-Ki67 (ThermoFisher Scientific), anti-Cleaved Caspase 3 (R&D Systems), anti-SOX2 (Santa Cruz). H&E Staining and Alcian Blue staining were performed according to the manufacturer’s protocol and as previously described [33, 45, 46]. Human lung tissue samples were provided by the tissue bank of the National Center of Tumor Diseases (NCT, Heidelberg, Germany) in accordance with the regulations of the tissue bank and the approval of the Ethics Committee of the Heidelberg University. Image J software was used for quantification of staining intensity in human lung tissue samples. Mean positive signal was quantified on 8-bit images with the following thresholds (low/high): FOXM1 (22/176), AGR2 (41/165), and NKX2.1 (58/160). For quantification of Alcian blue staining, the blue hue was quantified on color images using the following threshold settings: hue 136/143 pass, saturation 0/255 pass, and brightness 200/255 pass. A minimum of 5 random 20x field images per patient were quantified. Adjacent normal lung tissue was included only if clearly discernable in the patient sample.
Generation of A549 and H2122 cell lines with stable knockdown of FOXM1
Plasmids expressing shRNA specific to human shFOXM1 #1 (5’-GCCAATCGTTCTCTGACAGAA-3’), human shFOXM1 #2 (5’-GCAAGAAGAAATCCTGGTTAA-3’), or shRNA control (5’-CAACAAGATGAAGAGCACCAA-3’) were used to generate lentiviruses. The stable knockdown of FOXM1 was achieved by transducing humanlung adenocarcinomas A549 and H2122 with lentiviruses followed by puromycin selection as previously described [47].
Western blot
Protein lysates were prepared from A549 and H2122 cell lines 48 hours after puromycin selection using RIPA buffer (Abcam) supplemented with 1mM PMSF (Sigma) and protease inhibitor cocktail (Roche). Western blot analysis was done as described previously [48, 49]. Primary antibodies were incubated overnight at 4°C in 1% nonfat, dry milk. β-actin was used as loading control. The following antibodies were used for Western blot: FOXM1 (Santa Cruz), AGR2 (Cell Signaling), or β-actin (Santa Cruz).
Chromatin immunoprecipitation
A549humanlung adenocarcinoma cells were harvested, cross-linked using formaldehyde, sonicated to produce fragments approximately 500–1000 bp in size and immunoprecipitated using FOXM1 antibody or rabbit IgG antibody as previously described [50]. Revers cross-linked ChIP DNA samples were subjected to qPCR using oligonucleotides specific to promoter regions of humanAGR2: -257/-247 (Fwd. 5’-TTGACAGGAGCAGGGAAGTATTGTAGA-3’; Rev.5’-CATTTGATTTGCCTGAAGGCTGATTTGT-3’). PCR products (expected size 211bp) were visualized by gel electrophoresis. A negative control region 6.0kb upstream of the AGR2 transcriptional start site was selected for amplification (expected size 111bp) with the following primers: (Fwd. 5’-AGACCTCACCTTTTGTGTGC-3’; Rev. 5’-ACAAGCACAAGCCCATTCAC-3’).
Cloning of the human AGR2 promoter and dual luciferase assay
The humanAGR2 promoter region -1827bp to +197bp was amplified from A549human genomic DNA using the following PCR primers: Forward-5’ CCTTGCCATCCGTCAGCCACTA 3’; Reverse- 5’TGCTGTCAGGAGCCTTACCTGG 3’. The PCR product was cloned into pCR2.1 TOPO and verified by DNA sequencing. The promoter fragment was subcloned into pGL2-Basic luciferase vector (LUC) by double digestion with Acc651 and XhoI restriction enzymes (New England Biolabs). For site-directed mutagenesis of the putative FOXM1 binding site, primers containing a 4 base pair change were used with the Site-Directed Mutagenesis kit (Invitrogen): Forward-5’ TGTGTGTCTTCAAGTATAGGCAATCTGCCCACGGA 3’; Reverse-5’ TCCGTGGGCAGATTGCCTATACTTGAAGACACACA 3’. Hek293T cells were transfected with a CMV-Empty or CMV-humanFOXM1b plasmids, as well as with LUC reporter driven by -2.0 kb AGR2 promoter region (AGR2-LUC) WT or mutated AGR2-LUC promoter region. CMV-Renilla was used as an internal control to normalize transfection efficiency (relative luciferase activity). A dual luciferase assay (Promega) was performed 24 hours after transfection, as described previously [51, 52]. The standard error of the mean was calculated using the mean relative luciferase activity for each of the three wells in each group. All values were normalized to cells transfected with AGR2-LUC + CMV-Empty plasmids.
Cloning of the human AGR2 cDNA
The humanAGR2 cDNA was cloned from total RNA from A549 cells. RNA was isolated and reverse-transcribed into cDNA using random primers, as described above. For amplification of the AGR2 cDNA, we used Q5 High-Fidelity Polymerase (New England Biolabs) and the following primers: Forward-5’ ATGGAGAAAATTCCAGTGTCAG 3’; Reverse-5’ CTTTACAATTCAGTCTTCAGCAAC 3’. The 530bp band corresponding to the AGR2 cDNA was gel digested, cloned into PCR2.1 TOPO (Invitrogen) and sequence verified. The AGR2 cDNA was subcloned into BamHI and XhoI restriction sites in the retroviral plasmid MIEG3.
Statistical analysis
Statistical analysis was performed using Prism software. ANOVA and Student’s T-test were used to determine statistical significance. Right skewed measurements were log-transformed to meet normality assumption prior to analysis. P values less than 0.05 were considered significant. Values for all measurements were expressed as the mean ± standard deviation (SD). Data were graphically displayed using GraphPad Prism v.5.0 for Windows (GraphPad Software, Inc., La Jolla, CA, USA).
FOXM1 induces lung tumor progression.
Representative H&E images depicting tumors of each grade observed in the lungs of control (n = 6) and epiFoxM1-ΔN (n = 9) mice. Scale bar = 500μM.(TIF)Click here for additional data file.
FOXM1 is essential for the expression of cell cycle regulatory genes and markers of mucinous tumors.
mRNA isolated from control A549 (scramble) or shFoxM1 A549 stable cell lines were used for qRT-PCR. Knockdown of FOXM1 decreased mRNAs of cell cycle regulators (A) and mucinous characteristics (B) in A549humanpulmonary invasive mucinous adenocarcinoma. mRNA expression is normalized to β-actin mRNA. A p-value <0.05 is marked with a single asterik (*) and a p-value <0.01 is marked with a double asterik (**).(TIF)Click here for additional data file.
Expression AGR2 in FOXM1-deficient tumor cells does not restore the expression of cell cycle-regulatory genes and mucinous genes.
(A) Western blot shows efficient overexpression of humanAgr2 gene in Hek293T cells. (B) qRT-PCR analysis of proliferation-specific genes in stably transduced A549 cells. Only Ccnd1 mRNA was restored to the control level after overexpression of AGR2. mRNA expression is normalized to β-actin mRNA. (C) Western blot shows the efficient knockdown of FOXM1 (shFoxM1) and overexpression of AGR2 in A549 cells. (D) qRT-PCR analysis of mucin markers. mRNA expression was determined by qRT-PCR and normalized to β-actin mRNA (n = 3 independent cell cultures). A p-value <0.05 is marked with a single asterik (*).(TIF)Click here for additional data file.
Deletion of FOXM1 or AGR2 decreased tumor cells growth in vitro and in orthotopic mouse model.
(A) Growth of H2122humanmucinous lung adenocarcinoma cells was determined by MTT assay after knockdown of FOXM1 or AGR2. (B) Bioluminescent imaging of mice 35 days after orthotopic transplantation of A549 cells in the left lung lobe. Location of metastases are shown with arrows. (C) Tumor incidence and frequency of macroscopic metastases were determined 35 days after inoculation of A549 cells in the left lung lobe (n = 6 mice in each group).(TIF)Click here for additional data file.
List of mouse and human Taqman probes used for experiments.
(TIF)Click here for additional data file.
Clinical information of mucinous lung adenocarcinoma patient samples used in this study.
Authors: Il-Man Kim; Sneha Ramakrishna; Galina A Gusarova; Helena M Yoder; Robert H Costa; Vladimir V Kalinichenko Journal: J Biol Chem Date: 2005-04-06 Impact factor: 5.157
Authors: Craig Bolte; Xiaomeng Ren; Tatiana Tomley; Vladimir Ustiyan; Arun Pradhan; April Hoggatt; Tanya V Kalin; B Paul Herring; Vladimir V Kalinichenko Journal: J Biol Chem Date: 2015-01-28 Impact factor: 5.157
Authors: Yutaka Maeda; Tomoshi Tsuchiya; Haiping Hao; David H Tompkins; Yan Xu; Michael L Mucenski; Lingling Du; Angela R Keiser; Takuya Fukazawa; Yoshio Naomoto; Takeshi Nagayasu; Jeffrey A Whitsett Journal: J Clin Invest Date: 2012-11-12 Impact factor: 14.808
Authors: Vladimir Ustiyan; Susan E Wert; Machiko Ikegami; I-Ching Wang; Tanya V Kalin; Jeffrey A Whitsett; Vladimir V Kalinichenko Journal: Dev Biol Date: 2012-08-02 Impact factor: 3.582
Authors: Il-Man Kim; Timothy Ackerson; Sneha Ramakrishna; Maria Tretiakova; I-Ching Wang; Tanya V Kalin; Michael L Major; Galina A Gusarova; Helena M Yoder; Robert H Costa; Vladimir V Kalinichenko Journal: Cancer Res Date: 2006-02-15 Impact factor: 12.701
Authors: Tanya V Kalin; Lucille Meliton; Angelo Y Meliton; Xiangdong Zhu; Jeffrey A Whitsett; Vladimir V Kalinichenko Journal: Am J Respir Cell Mol Biol Date: 2008-04-17 Impact factor: 6.914
Authors: David Milewski; Arun Pradhan; Xinjian Wang; Yuqi Cai; Tien Le; Brian Turpin; Vladimir V Kalinichenko; Tanya V Kalin Journal: Oncogene Date: 2016-07-18 Impact factor: 9.867
Authors: Samriddhi Shukla; David Milewski; Arun Pradhan; Nihar Rama; Kathryn Rice; Tien Le; Matthew J Flick; Sara Vaz; Xueheng Zhao; Kenneth D Setchell; Elsa Logarinho; Vladimir V Kalinichenko; Tanya V Kalin Journal: Mol Cancer Ther Date: 2019-04-30 Impact factor: 6.261
Authors: Vladimir Ustiyan; Craig Bolte; Yufang Zhang; Lu Han; Yan Xu; Katherine E Yutzey; Aaron M Zorn; Tanya V Kalin; John M Shannon; Vladimir V Kalinichenko Journal: Dev Biol Date: 2018-08-25 Impact factor: 3.582
Authors: Alison K Bauer; Misha Umer; Vanessa L Richardson; Amber M Cumpian; Anna Q Harder; Nasim Khosravi; Zoulikha Azzegagh; Naoko M Hara; Camille Ehre; Maedeh Mohebnasab; Mauricio S Caetano; Daniel T Merrick; Adrie van Bokhoven; Ignacio I Wistuba; Humam Kadara; Burton F Dickey; Kalpana Velmurugan; Patrick R Mann; Xian Lu; Anna E Barón; Christopher M Evans; Seyed Javad Moghaddam Journal: JCI Insight Date: 2018-08-09
Authors: Craig Bolte; Vladimir Ustiyan; Xiaomeng Ren; Andrew W Dunn; Arun Pradhan; Guolun Wang; Olena A Kolesnichenko; Zicheng Deng; Yufang Zhang; Donglu Shi; James M Greenberg; Alan H Jobe; Tanya V Kalin; Vladimir V Kalinichenko Journal: Am J Respir Crit Care Med Date: 2020-07-01 Impact factor: 21.405
Authors: Bingqiang Wen; Enhong Li; Vladimir Ustiyan; Guolun Wang; Minzhe Guo; Cheng-Lun Na; Gregory T Kalin; Veronica Galvan; Yan Xu; Timothy E Weaver; Tanya V Kalin; Jeffrey A Whitsett; Vladimir V Kalinichenko Journal: Am J Respir Crit Care Med Date: 2021-02-15 Impact factor: 21.405
Authors: Olena A Kolesnichenko; Jeffrey A Whitsett; Tanya V Kalin; Vladimir V Kalinichenko Journal: Am J Respir Cell Mol Biol Date: 2021-11 Impact factor: 6.914