Literature DB >> 29256862

Distinct SoxB1 networks are required for naïve and primed pluripotency.

Andrea Corsinotti1,2, Frederick Ck Wong1, Tülin Tatar1, Iwona Szczerbinska1, Florian Halbritter1, Douglas Colby1, Sabine Gogolok1, Raphaël Pantier1, Kirsten Liggat1, Elham S Mirfazeli1, Elisa Hall-Ponsele1, Nicholas P Mullin1, Valerie Wilson1, Ian Chambers1.   

Abstract

Deletion of Sox2 from mouse embryonic stem cells (ESCs) causes trophectodermal differentiation. While this can be prevented by enforced expression of the related SOXB1 proteins, SOX1 or SOX3, the roles of SOXB1 proteins in epiblast stem cell (EpiSC) pluripotency are unknown. Here, we show that Sox2 can be deleted from EpiSCs with impunity. This is due to a shift in the balance of SoxB1 expression in EpiSCs, which have decreased Sox2 and increased Sox3 compared to ESCs. Consistent with functional redundancy, Sox3 can also be deleted from EpiSCs without eliminating self-renewal. However, deletion of both Sox2 and Sox3 prevents self-renewal. The overall SOXB1 levels in ESCs affect differentiation choices: neural differentiation of Sox2 heterozygous ESCs is compromised, while increased SOXB1 levels divert the ESC to EpiSC transition towards neural differentiation. Therefore, optimal SOXB1 levels are critical for each pluripotent state and for cell fate decisions during exit from naïve pluripotency.

Entities:  

Keywords:  Embryonic stem cells; Epiblast stem cells; Pluripotency; Sox; developmental biology; mouse; stem cells; transcription factors

Mesh:

Substances:

Year:  2017        PMID: 29256862      PMCID: PMC5758114          DOI: 10.7554/eLife.27746

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.140


Introduction

Pluripotent cells have the unique ability to differentiate into every cell type of an adult organism (Nichols and Smith, 2009). During mouse development, the embryo contains pluripotent cells in the epiblast until the onset of somitogenesis (Osorno et al., 2012; Chambers and Tomlinson, 2009). Distinct pluripotent cell types can be isolated in culture from the preimplantation and postimplantation epiblast. Embryonic stem cells (ESCs) (Evans and Kaufman, 1981; Martin, 1981) from preimplantation embryos are termed ‘naïve’ pluripotent cells. Epiblast stem cells (EpiSCs) (Tesar et al., 2007; Brons et al., 2007), commonly isolated from the post-implantation epiblast, are known as ‘primed’ pluripotent cells. Naïve and primed cells differ dramatically in responses to extracellular signals (Nichols and Smith, 2009). ESCs self-renew in response to a combination of leukaemia inhibitory factor (LIF) and either foetal calf serum (FCS), bone morphogenic protein (BMP) or Wnt (Smith et al., 1988; Ying et al., 2003a; ten Berge et al., 2011) and differentiate in response to fibroblast growth factor (FGF) (Kunath et al., 2007; Stavridis et al., 2007). In contrast, FGF together with Nodal/Activin A are required for EpiSCs self-renewal (Vallier et al., 2009; Guo et al., 2009). Pluripotency is regulated by a pluripotency gene regulatory network (PGRN) (Chambers and Tomlinson, 2009; Festuccia et al., 2013; Wong et al., 2016). While some transcription factors such as Esrrb and T (Brachyury) are associated more closely with naïve or primed pluripotent states respectively (Festuccia et al., 2012; Osorno et al., 2012; Tsakiridis et al., 2014), the core TFs of the PGRN, Nanog, Sox2 and Oct4 (the Pou5f1 gene product, also referred as Oct3/4) are expressed in both naïve and primed pluripotent cells (Niwa et al., 2000; Masui et al., 2007; Avilion et al., 2003; Chambers et al., 2003; Karwacki-Neisius et al., 2013; Osorno et al., 2012; Festuccia et al., 2012; Brons et al., 2007; Tesar et al., 2007). While the role of Sox2 has been extensively characterised in naïve cells (Wong et al., 2016), its role in primed pluripotency is less well known. Sox2 is a member of a family of twenty Sox TFs (Pevny and Lovell-Badge, 1997; Kamachi and Kondoh, 2013). All SOX proteins contain a High-Mobility-Group (HMG) box DNA-binding domain closely related to the founding member of the Sox family, SRY (Kondoh and Lovell-Badge, 2016). While some SOX proteins contain a transcriptional activation domain, others contain repression domains (Uchikawa et al., 1999; Bowles et al., 2000; Ambrosetti et al., 2000). The paradigm of action for SOX proteins is that they bind to target gene sequences through a DNA-mediated interaction with a partner protein, to specify target gene selection (Kamachi et al., 1999; Reményi et al., 2003; Williams et al., 2004; Kamachi and Kondoh, 2013). In pluripotent cells the principal interaction of SOX2 with OCT4 (Ambrosetti et al., 1997, 2000) is considered to positively regulate expression of many pluripotency-specific genes including Nanog, Oct4 and Sox2 (Tomioka et al., 2002; Chew et al., 2005; Okumura-Nakanishi et al., 2005; Rodda et al., 2005; Kuroda et al., 2005). Loss of SOX2 in ESCs induces trophoblast differentiation, phenocopying OCT4 loss and supporting the idea of a mutually dependent mode of action (Niwa et al., 2000; Masui et al., 2007). Analysis of sequence conservation within the HMG box has divided the Sox family into eight groups that can be further divided into subgroups based on homology outside the HMG box (Kondoh and Lovell-Badge, 2015; Kamachi, 2016). SOX1SOX2 and SOX3 belong to the SOXB1 group and also contain transcriptional activation domains (Uchikawa et al., 1999; Ambrosetti et al., 2000; Bowles et al., 2000; Kondoh and Kamachi, 2010; Ng et al., 2012; Kamachi and Kondoh, 2013). SOXB1 proteins bind the same DNA sequence in vitro (Kamachi et al., 1999; Kamachi, 2016). Previous studies demonstrated that SOXB1 factors are co-expressed during embryonic development and can substitute for each other in different biological systems, both in vitro and in vivo (Wood and Episkopou, 1999; Niwa et al., 2016; Adikusuma et al., 2017). Here, we investigate the requirements of naïve and primed pluripotent states for SOXB1 expression. Our results indicate that the essential requirement of SOXB1 function for naïve pluripotent cells extends to primed pluripotent cells. SOX3, which is highly expressed in primed pluripotent cells, functions redundantly with SOX2, rendering SOX2 dispensable in these cells. We further provide evidence that critical SOXB1 levels are required to specify the identity of cells exiting the naïve pluripotent state.

Results

A fluorescent reporter of SOX2 protein expression

To investigate the expression of Sox2 in pluripotent cells, a live cell reporter that retained Sox2 function was prepared by replacing the Sox2 stop codon with a T2A-H2B-tdTomato cassette (Figure 1A; Figure 1—figure supplement 1A). Correctly targeted cells were identified by Southern analysis and are referred to as E14Tg2a-Sox2-tdTomato (TST) cells (Figure 1—figure supplement 1B). Fluorescence microscopy of targeted cells showed a close correlation between SOX2 and tdTomato levels (Figure 1—figure supplement 2). Moreover, tdTomato expression recapitulated the SOX2 expression pattern in chimeric embryos (Figure 1—figure supplement 3). Targeted cells also showed the expected morphological differences when cultured in a combination of LIF plus inhibitors of MEK and GSK3β (LIF/2i), in LIF/FCS, in LIF/BMP or after passaging in Activin/FGF (Figure 1A). These results indicate that TST cells behave normally and provide a useful live cell report of Sox2 expression levels.
Figure 1.

Different roles of Sox2 in preimplantation and postimplantation pluripotency.

(A) Expression of the Sox2-T2A-H2b-tdTomato (Sox2::HT) reporter from the endogenous Sox2 allele in targeted TST18 cells. TST18 cells cultured in LIF/FCS/GMEMβ were replated in LIF/2i/N2B27 or LIF/BMP4/N2B27 for four passages or in Activin/FGF/N2B27 (Activin/FGF) for nine passages, examined microscopically (top) and assessed by flow cytometry (bottom); E14Tg2a cells were represented as a grey dashed line. (B) Three gates (A, B, C) were used to purify cells for microarray analysis. Gate C captured the Sox2::HT level in LIF/2i cultured ESCs. Gate B captured the overlapping Sox2::HT level in LIF/FCS, LIF/BMP and Activin/FGF cultured cells. Gate A captured the lower Sox2::HT level in Activin/FGF. (C) Principal component analysis of cells in different culture conditions, either unsorted or sorted using the gates indicated by brackets. (D) Despite similar Sox2::HT levels, no differentially expressed genes (DEGs, FDR = 0.1) were common to LIF/FCS-low and Activin/FGF-high cell populations. (E) RT-qPCR analysis of the indicated transcripts in ESCs (LIF/FCS, red bars) and EpiSCs (Activin/FGF, cultured for 16 passages, blue bars). Transcript levels were normalized to Tbp and plotted relative to ESCs. Error bars represent standard error of the mean (n = 3 to 4).

The Sox2 ORF is represented by a blue box and the Sox2 UTRs by beige boxes; homology arms are shown (red line). The Sox2::HT ORF is followed by GtxIRES-Neo and an FRT-flanked PGK-Neo-pA (PNpA)/MC1-TK-pA (MTpA) selection cassette. The FRT sites (cyan triangles), EcoRI sites (E), HindIII sites (H) and probes (black boxes) used for Southern analysis are shown. Sizes of relevant fragments produced before and after targeting and excision of the FRT-flanked cassette are indicated. (B) Southern analysis of TST cell lines expanded after G418 selection. FNF denotes lines prior to excision of the FRT-flanked cassette.

Scale bar, 100 μm. Trend line was plotted between Sox2 and Sox2::HT average nuclear intensity (ANI) distributions of TST18 cells. Correlation coefficient (PMCC, r2) is indicated for the trend line.

Transverse cryostat-sectioning of E9.5 chimeric embryos showed appropriate restriction of Sox2::HT expression. Non-specific auto-fluorescence (cyan) was captured in the far-red (647 nm) channel. Scale bar, 100 μm.

DEGs listed in descending order of fold-change between LIF/FCS-high and LIF/FCS-low cells.

Sample legend and culture conditions refer to Figure 1C.

Figure 1—figure supplement 1.

(A) Targeting T2A-H2b-tdTomato to the Sox2 locus stop codon yields the Sox2::HT fluorescent reporter allele.

The Sox2 ORF is represented by a blue box and the Sox2 UTRs by beige boxes; homology arms are shown (red line). The Sox2::HT ORF is followed by GtxIRES-Neo and an FRT-flanked PGK-Neo-pA (PNpA)/MC1-TK-pA (MTpA) selection cassette. The FRT sites (cyan triangles), EcoRI sites (E), HindIII sites (H) and probes (black boxes) used for Southern analysis are shown. Sizes of relevant fragments produced before and after targeting and excision of the FRT-flanked cassette are indicated. (B) Southern analysis of TST cell lines expanded after G418 selection. FNF denotes lines prior to excision of the FRT-flanked cassette.

Figure 1—figure supplement 2.

Imaging of E14Tg2a and TST18 ESCs for SOX2 by immunofluorescence (green) and of Sox2::HT fluorescence (red); DAPI is grey.

Scale bar, 100 μm. Trend line was plotted between Sox2 and Sox2::HT average nuclear intensity (ANI) distributions of TST18 cells. Correlation coefficient (PMCC, r2) is indicated for the trend line.

Figure 1—figure supplement 3.

TST18 cells transfected with a CAG-GFP constitutive reporter were aggregated with isolated morulae and chimeric embryos assessed at the indicated stages for contribution of TST18 cells.

Transverse cryostat-sectioning of E9.5 chimeric embryos showed appropriate restriction of Sox2::HT expression. Non-specific auto-fluorescence (cyan) was captured in the far-red (647 nm) channel. Scale bar, 100 μm.

Different roles of Sox2 in preimplantation and postimplantation pluripotency.

(A) Expression of the Sox2-T2A-H2b-tdTomato (Sox2::HT) reporter from the endogenous Sox2 allele in targeted TST18 cells. TST18 cells cultured in LIF/FCS/GMEMβ were replated in LIF/2i/N2B27 or LIF/BMP4/N2B27 for four passages or in Activin/FGF/N2B27 (Activin/FGF) for nine passages, examined microscopically (top) and assessed by flow cytometry (bottom); E14Tg2a cells were represented as a grey dashed line. (B) Three gates (A, B, C) were used to purify cells for microarray analysis. Gate C captured the Sox2::HT level in LIF/2i cultured ESCs. Gate B captured the overlapping Sox2::HT level in LIF/FCS, LIF/BMP and Activin/FGF cultured cells. Gate A captured the lower Sox2::HT level in Activin/FGF. (C) Principal component analysis of cells in different culture conditions, either unsorted or sorted using the gates indicated by brackets. (D) Despite similar Sox2::HT levels, no differentially expressed genes (DEGs, FDR = 0.1) were common to LIF/FCS-low and Activin/FGF-high cell populations. (E) RT-qPCR analysis of the indicated transcripts in ESCs (LIF/FCS, red bars) and EpiSCs (Activin/FGF, cultured for 16 passages, blue bars). Transcript levels were normalized to Tbp and plotted relative to ESCs. Error bars represent standard error of the mean (n = 3 to 4).

(A) Targeting T2A-H2b-tdTomato to the Sox2 locus stop codon yields the Sox2::HT fluorescent reporter allele.

The Sox2 ORF is represented by a blue box and the Sox2 UTRs by beige boxes; homology arms are shown (red line). The Sox2::HT ORF is followed by GtxIRES-Neo and an FRT-flanked PGK-Neo-pA (PNpA)/MC1-TK-pA (MTpA) selection cassette. The FRT sites (cyan triangles), EcoRI sites (E), HindIII sites (H) and probes (black boxes) used for Southern analysis are shown. Sizes of relevant fragments produced before and after targeting and excision of the FRT-flanked cassette are indicated. (B) Southern analysis of TST cell lines expanded after G418 selection. FNF denotes lines prior to excision of the FRT-flanked cassette.

Imaging of E14Tg2a and TST18 ESCs for SOX2 by immunofluorescence (green) and of Sox2::HT fluorescence (red); DAPI is grey.

Scale bar, 100 μm. Trend line was plotted between Sox2 and Sox2::HT average nuclear intensity (ANI) distributions of TST18 cells. Correlation coefficient (PMCC, r2) is indicated for the trend line.

TST18 cells transfected with a CAG-GFP constitutive reporter were aggregated with isolated morulae and chimeric embryos assessed at the indicated stages for contribution of TST18 cells.

Transverse cryostat-sectioning of E9.5 chimeric embryos showed appropriate restriction of Sox2::HT expression. Non-specific auto-fluorescence (cyan) was captured in the far-red (647 nm) channel. Scale bar, 100 μm.

Common differentially expressed genes (DEGs, FDR = 0.1) enriched in LIF/FCS-high, LIF/BMP-high and DEGs positively correlated to Sox2 (r2 ≥0.9).

DEGs listed in descending order of fold-change between LIF/FCS-high and LIF/FCS-low cells.

Microarray signal intensity of Sox family members in all sorted populations.

Sample legend and culture conditions refer to Figure 1C. TST ESCs were next assessed by fluorescence microscopy and FACS. In LIF/2i, tdTomato expression was high and unimodal (Figure 1A). In LIF/FCS or LIF/BMP the same predominant high-expressing population was present but with a shoulder of reduced expression and a small number of tdTomato-negative cells, which appeared to coincide with morphologically differentiated cells (Figure 1A). In continuous culture in Activin/FGF, tdTomato expression was bimodal with the highest expression levels overlapping the lower expression levels seen in ESCs cultured in LIF/FCS or LIF/BMP (Figure 1A,B).

Gene expression in ESCs and EpiSCs expressing distinct Sox2 levels

ESCs and EpiSCs expressing distinct Sox2 levels were separated by FACS according to the tdTomato level (Figure 1B). Microarray analysis was then used to compare gene expression in cells from different culture conditions expressing similar Sox2 levels and in cells from the same cultures expressing distinct Sox2 levels (Supplementary file 1). Cells expressing the highest tdTomato levels in LIF/2i, LIF/FCS or LIF/BMP cultures were purified using gate C. The mid-level expression gate B enabled purification of the Sox2-low fraction of ESCs cultured in LIF/FCS or LIF/BMP as well as the highest Sox2-expressing EpiSCs. EpiSCs were also purified using the lower expression gate A. Re-sorting confirmed effective purification prior to RNA extraction and analysis (Figure 1B). Compared to the Sox2-high population, Sox2-low EpiSCs had upregulated differentiation markers. Transcripts expressed by Sox2-low EpiSCs differed from those expressed by Sox2-low ESCs (Figure 1—figure supplement 4; Supplementary file 1) suggesting that ESCs and EpiSCs have distinct differentiation propensities. ESCs from both LIF/BMP and LIF/FCS cultures sorted for highest tdTomato expression (gate C) were enriched for naïve pluripotency transcripts with mRNAs common to both (including Nr5a2, Tbx3 and Tcl1) positively correlating to Sox2 in all samples (Figure 1—figure supplement 5). Moreover, principal component analysis indicated that these Sox2-high ESCs cluster together and separately from ESCs cultured in LIF/2i (Figure 1C) as seen by others (Boroviak et al., 2015). More importantly, principal component analysis also showed that EpiSCs and ESCs expressing the same Sox2 level (gate B) were transcriptionally distinct (Figure 1C) and shared no commonly enriched mRNAs (Figure 1D). Thus, Sox2 levels alone do not dictate the distinction between ESC and EpiSC states.
Figure 1—figure supplement 4.

Differentially expressed genes common to LIF/FCS-low and Activin/FGF-low were not associated with any gene ontology (GO) terms using high-stringency GO term clustering analysis.

Figure 1—figure supplement 5.

Common differentially expressed genes (DEGs, FDR = 0.1) enriched in LIF/FCS-high, LIF/BMP-high and DEGs positively correlated to Sox2 (r2 ≥0.9).

DEGs listed in descending order of fold-change between LIF/FCS-high and LIF/FCS-low cells.

Microarray and quantitative transcript analyses highlighted changes in Sox gene expression levels (Figure 1E, Figure 1—figure supplement 6). Although other Sox gene expression changes occurred, the ability of SOXB1 proteins to function redundantly in ESC self-renewal (Niwa et al., 2016) prompted us to assess the capacity of SOXB1-related proteins to function more widely in pluripotent cells.
Figure 1—figure supplement 6.

Microarray signal intensity of Sox family members in all sorted populations.

Sample legend and culture conditions refer to Figure 1C.

A subset of SOX family proteins can functionally replace Sox2 in ESC self-renewal

Recently, Niwa et al. (2016) reported that ESC self-renewal could be maintained in the absence of SOX2 by expression of other SOXB1 and SOXG proteins (Niwa et al., 2016). We addressed the question of functional redundancy with Sox2 in ESCs using an independent Sox2 conditional knockout (SCKO) ESC line (Favaro et al., 2009; Gagliardi et al., 2013). SCKO ESCs have one Sox2 allele replaced by β-geo, the second allele flanked by loxP sites and constitutively express a tamoxifen-inducible Cre recombinase (CreERT2) (Figure 2A). SCKO ESCs were transfected with a plasmid in which constitutive Sox cDNA expression was linked to hygromycin B resistance and were either left untreated or were simultaneously treated with tamoxifen to excise Sox2 (Figure 2A). ESC self-renewal was assessed after 8–10 days of hygromycin selection. Transfection of plasmids encoding transcriptional activator proteins of the SOXB1 family (SOX1, SOX2 or SOX3) enabled similar levels of ESC colony formation in the absence of Sox2 (Figure 2B,C). In contrast, the SOXB2 proteins (SOX14 and SOX21), in which the SOXB DNA-binding domain is linked to transcriptional repression domains, did not direct undifferentiated ESC colony formation (Figure 2C). Of the other SOX proteins tested, only SOX15 showed any capacity to direct undifferentiated ESC colony formation (Figure 2C), as previously described (Niwa et al., 2016), possibly because it has the most similar DNA-binding domain to SOXB proteins (Kamachi and Kondoh, 2013). These results indicate that ESC self-renewal requires the function of a SOX protein with a SOXB-like DNA-binding domain coupled to a transcriptional activating function.
Figure 2.

The ESC function of Sox2 can be substituted by SOXB1 and SOXG proteins.

(A) Strategy for testing the ability of candidate Sox cDNAs to rescue ESC self-renewal upon Sox2 deletion. Sox2 (SCKO) ESCs were treated with 4-hydroxy-tamoxifen (4OHT) to induce nuclear localisation of CreERT2 and consequent loxP-mediated Sox2 excision. Simultaneous transfection of test cDNAs linked to hygromycin phosphotransferase via an IRES (i) were tested for Sox2 complementation activity. (B) SCKO ESCs transfected with the indicated cDNAs were cultured in the presence of hygromycin B and in the absence (−4OHT) or presence (+4 OHT) of 4-hydroxyl-tamoxifen for 8 days before being fixed and stained for alkaline phosphatase (AP) activity. (C) Stained colonies were scored based on AP+ (undifferentiated), mixed or AP− (differentiated) morphology. Error bars represent standard error mean (n = 3). (D) RT-qPCR analysis of the rescuing transgenes in Sox1-, Sox2- and Sox3-rescued (S1R, S2R, S3R) ESC populations grown in the presence of 4-hydroxyl-tamoxifen as described in Figure 2A,B. RT-qPCR was performed using common primers designed across the CAG intron upstream of the rescuing transgene. Values were normalised over Tbp and expressed relative to S2R cells. Error bars represent the standard error of the mean (n = 3).

Primers a and b flank the position of the loxP site 5’ to Sox2; primer c flanks the loxP site 3’ to Sox2. Amplification of wild-type (WT) and βgeo targeted alleles produces a 250 bp band whereas the loxP-flanked Sox2 allele (flox) produces a 400 bp band. Upon Cre-mediated recombination, the deleted (Δ) allele produces a 550 bp band amplified by primers a + c. (BOTTOM) Wild-type E14Tg2a ESCs (E14) exhibited only the 250 bp band. SCKO ESCs exhibited both 250 bp and 400 bp bands whereas Sox2 S1R, S2R and S3R ESCs retained the 250 bp band and exhibited the 550 bp band corresponding to the deleted allele.

Scale bar, 100 μm.

The ESC function of Sox2 can be substituted by SOXB1 and SOXG proteins.

(A) Strategy for testing the ability of candidate Sox cDNAs to rescue ESC self-renewal upon Sox2 deletion. Sox2 (SCKO) ESCs were treated with 4-hydroxy-tamoxifen (4OHT) to induce nuclear localisation of CreERT2 and consequent loxP-mediated Sox2 excision. Simultaneous transfection of test cDNAs linked to hygromycin phosphotransferase via an IRES (i) were tested for Sox2 complementation activity. (B) SCKO ESCs transfected with the indicated cDNAs were cultured in the presence of hygromycin B and in the absence (−4OHT) or presence (+4 OHT) of 4-hydroxyl-tamoxifen for 8 days before being fixed and stained for alkaline phosphatase (AP) activity. (C) Stained colonies were scored based on AP+ (undifferentiated), mixed or AP− (differentiated) morphology. Error bars represent standard error mean (n = 3). (D) RT-qPCR analysis of the rescuing transgenes in Sox1-, Sox2- and Sox3-rescued (S1R, S2R, S3R) ESC populations grown in the presence of 4-hydroxyl-tamoxifen as described in Figure 2A,B. RT-qPCR was performed using common primers designed across the CAG intron upstream of the rescuing transgene. Values were normalised over Tbp and expressed relative to S2R cells. Error bars represent the standard error of the mean (n = 3).

(TOP) Strategy for genotyping the Sox2 deletion by PCR.

Primers a and b flank the position of the loxP site 5’ to Sox2; primer c flanks the loxP site 3’ to Sox2. Amplification of wild-type (WT) and βgeo targeted alleles produces a 250 bp band whereas the loxP-flanked Sox2 allele (flox) produces a 400 bp band. Upon Cre-mediated recombination, the deleted (Δ) allele produces a 550 bp band amplified by primers a + c. (BOTTOM) Wild-type E14Tg2a ESCs (E14) exhibited only the 250 bp band. SCKO ESCs exhibited both 250 bp and 400 bp bands whereas Sox2 S1R, S2R and S3R ESCs retained the 250 bp band and exhibited the 550 bp band corresponding to the deleted allele.

Immunofluorescence staining of SOX2, NANOG and OCT4 in SCKO, S1R, S2R and S3R ESCs.

Scale bar, 100 μm. To further assess the ability of SOX proteins to sustain ESC self-renewal, we attempted to expand transfected cell populations. PCR analysis confirmed deletion of the Sox2 conditional allele (400 bp) from expanded cell populations expressing SOX1, SOX2 or SOX3 (Figure 2—figure supplement 1). Furthermore, SoxB1-rescued (S1R and S3R) SKO ESCs retained OCT4 and NANOG expression, similar to SCKO and Sox2-rescued SKO (S2R) ESCs (Figure 2—figure supplement 2). The transgene expression levels in ESC populations rescued by Sox1, 2 or 3 were assessed by quantitative transcript analysis using common primers across the CAG intron. This demonstrated that the Sox3 transgene mRNA was expressed at a higher level than the Sox1 or Sox2 transgenes (Figure 2D). These results confirm the findings of Niwa et al. in an independent cell line (Niwa et al., 2016).
Figure 2—figure supplement 1.

(TOP) Strategy for genotyping the Sox2 deletion by PCR.

Primers a and b flank the position of the loxP site 5’ to Sox2; primer c flanks the loxP site 3’ to Sox2. Amplification of wild-type (WT) and βgeo targeted alleles produces a 250 bp band whereas the loxP-flanked Sox2 allele (flox) produces a 400 bp band. Upon Cre-mediated recombination, the deleted (Δ) allele produces a 550 bp band amplified by primers a + c. (BOTTOM) Wild-type E14Tg2a ESCs (E14) exhibited only the 250 bp band. SCKO ESCs exhibited both 250 bp and 400 bp bands whereas Sox2 S1R, S2R and S3R ESCs retained the 250 bp band and exhibited the 550 bp band corresponding to the deleted allele.

Figure 2—figure supplement 2.

Immunofluorescence staining of SOX2, NANOG and OCT4 in SCKO, S1R, S2R and S3R ESCs.

Scale bar, 100 μm.

Sox3 is dispensable for both naïve and primed pluripotency

Sox3 transcripts are present in ESCs at lower levels than Sox2 (Figure 3—figure supplement 1) and a previous report has suggested that Sox3 is dispensable for ESC self-renewal (Rizzoti et al., 2004; Rizzoti and Lovell-Badge, 2007). To directly assess this possibility, and as a first step to determining whether Sox3 is required in EpiSCs, CRISPR/Cas9 was used to delete the Sox3 gene from male E14Tg2a ESCs (Hooper et al., 1987; Doetschman et al., 1987) using two small guide RNAs (sgRNA1 and sgRNA2) (Figure 3A). After targeting, E14Tg2a ESCs were plated at low density and single clones were isolated. PCR genotyping using primers flanking the predicted Cas9 cut sites (Figure 3A) identified two clones (S3KO8 and S3KO35) in which Sox3 had been deleted (Figure 3B). Replating at clonal density indicated that both clones retained an efficient self-renewal ability (Figure 3C). Moreover, both clones had unchanged levels of Nanog, Oct4 and Sox2 mRNAs (Figure 3D). These findings indicate that Sox3 is dispensable for ESC self-renewal, confirming previously unpublished data (Rizzoti et al., 2004).
Figure 3—figure supplement 1.

RT-qPCR analysis of the indicated transcripts in E14Tg2a and SCKO ESCs.

mRNA levels were normalised over Tbp. Error bars represent standard error of the mean (n = 3).

Figure 3.

Sox3 is dispensable for pluripotent cell maintenance.

(A) Schematic representation of the Sox3 locus on the mouse X chromosome showing the CRISPR/Cas9 strategy for the generation and genotyping of Sox3 knockout ESCs. The positions of sgRNA1 and sgRNA2 used for the deletion of the Sox3 locus are indicated alongside the positions of PCR primers used for genotyping. (B) PCR genotyping of parental ESCs (E14Tg2a), a wild-type clone (37) and two Sox3 knockout clones (S3KO8, S3KO35) after CRISPR/Cas9 targeting of the Sox3 locus. Band sizes for the WT (~2 kb) and targeted (~600 bp) alleles are shown. (C) Alkaline phosphatase staining in S3KO8, S3KO35 and WT (Clone 37 and E14Tg2a) ESCs grown at clonal density for 7 days. (D–E) RT-qPCR analysis of the indicated transcripts in wild-type E14Tg2a and Sox3 (S3KO8, S3KO35) ESCs (D) and EpiSCs (E) derived by serial passaging (>10 passages) in Activin/FGF conditions. Error bars represent standard error of the mean (n = 3). (F-G) Immunofluorescence staining of SOX2 (F), SOX3 (G) and OCT4 proteins in E14Tg2a and Sox3 EpiSCs (S3KO8, S3KO35). Scale bar, 100 μm.

mRNA levels were normalised over Tbp. Error bars represent standard error of the mean (n = 3).

Sox3 is dispensable for pluripotent cell maintenance.

(A) Schematic representation of the Sox3 locus on the mouse X chromosome showing the CRISPR/Cas9 strategy for the generation and genotyping of Sox3 knockout ESCs. The positions of sgRNA1 and sgRNA2 used for the deletion of the Sox3 locus are indicated alongside the positions of PCR primers used for genotyping. (B) PCR genotyping of parental ESCs (E14Tg2a), a wild-type clone (37) and two Sox3 knockout clones (S3KO8, S3KO35) after CRISPR/Cas9 targeting of the Sox3 locus. Band sizes for the WT (~2 kb) and targeted (~600 bp) alleles are shown. (C) Alkaline phosphatase staining in S3KO8, S3KO35 and WT (Clone 37 and E14Tg2a) ESCs grown at clonal density for 7 days. (D–E) RT-qPCR analysis of the indicated transcripts in wild-type E14Tg2a and Sox3 (S3KO8, S3KO35) ESCs (D) and EpiSCs (E) derived by serial passaging (>10 passages) in Activin/FGF conditions. Error bars represent standard error of the mean (n = 3). (F-G) Immunofluorescence staining of SOX2 (F), SOX3 (G) and OCT4 proteins in E14Tg2a and Sox3 EpiSCs (S3KO8, S3KO35). Scale bar, 100 μm.

RT-qPCR analysis of the indicated transcripts in E14Tg2a and SCKO ESCs.

mRNA levels were normalised over Tbp. Error bars represent standard error of the mean (n = 3). Next, the requirement of SOX3 for primed pluripotency was determined by examining the ability of the above Sox3 knockout ESC clones, together with parental E14Tg2a ESCs, to be converted to EpiSCs by serial passaging in Activin and FGF (Guo et al., 2009). Quantitative transcript analysis at passage 12 indicated similar levels of Sox2, Oct4 and Nanog mRNA expression in wild-type and Sox3 knockout EpiSCs (Figure 3E). In contrast, Sox1 mRNA levels were reduced in both Sox3 knockout clones (Figure 3E) and T (Brachyury) was more variably expressed (Figure 3E). The ability of EpiSCs to self-renew in the absence of SOX3 was maintained over 25 passages without affecting SOX2 and OCT4 protein expression or EpiSC morphology (Figure 3F,G). These data demonstrate that both naïve and primed pluripotent cells can self-renew in the absence of Sox3.

Sox2 is dispensable for the maintenance of primed pluripotency

To investigate whether primed pluripotency can be maintained in the absence of SOX2, SCKO EpiSCs were derived by in vitro culture of SCKO ESCs (Guo et al., 2009). SCKO EpiSCs were then transfected with a plasmid encoding both Cre recombinase and tdTomato (Figure 4A), since the CAG CreERT2 transgene (Figure 2A) had been silenced during the EpiSC transition. After 12–24 hr, tdTomato-positive EpiSCs were sorted by FACS and re-plated at low cell density to allow expansion of single clones. PCR genotyping of expanded EpiSC clones revealed that the loxP-flanked Sox2 allele had been excised generating Sox2 (SKO) clones (Figure 4A). Immunoblot analysis confirmed that these SKO clones did not express SOX2 protein and that Sox2 EpiSCs expressed SOX2 at 50% the level of Sox2 EpiSCs (Figure 4B). Moreover, NANOG protein levels were similar to parental SCKO EpiSCs or wild-type E14Tg2a EpiSCs (Figure 4B). Sox2-/- EpiSCs retained an undifferentiated morphology (Figure 4C) and immunostaining confirmed the absence of SOX2 and continued OCT4 expression compared to parental SCKO EpiSCs (Figure 4D). Quantitative transcript analysis of Oct4, Nanog and Sox2 , indicated that, while Sox2 mRNA was absent from Sox2 EpiSCs, both Oct4 and Nanog mRNA levels were unaffected (Figure 4E). This suggests that the core pluripotency gene regulatory network remains active even in the absence of SOX2 and that, in contrast to the situation with naïve pluripotency, primed pluripotency is not critically dependent upon Sox2.
Figure 4.

Sox2 is dispensable for the maintenance of EpiSCs.

(A) Strategy for Sox2 deletion in EpiSCs. Sox2 (SCKO) EpiSCs were transfected with pCMV-tdTomato-T2A-Cre. After 12–24 hours, cells were sorted for tdTomato expression and re-plated in the presence of ROCK inhibitor. Clones were picked and expanded before genotyping by PCR as indicated in Figure 2—figure supplement 1 . SCKO EpiSCs were also transfected with pCMV-tdTomato (lacking Cre). Expanded clones were numbered as indicated. (B) Immunoblot analysis of E14Tg2a, Sox2 (SCKO) and Sox2 (SKO) EpiSCs showing that SOX2 protein (red) is reduced in SCKO and absent in SKO EpiSCs. NANOG protein levels (green) were unaffected. Protein levels (normalized to the βactin level) are graphed below. (C) Bright-field morphology of E14Tg2a and SKO4 EpiSCs after 2 weeks (8 passages) in culture. Scale bar, 100 μm. (D) Immunofluorescence staining of SOX2 and OCT4 in SCKO and SKO6 EpiSCs. Scale bar, 100 μm. (E) RT-qPCR analysis of the indicated transcripts in E14Tg2a, Sox2 (SCKO) and Sox2 (SKO) EpiSCs. Clone numbers are indicated. Error bars represent the standard error of the mean (n = 2 to 3).

Sox2 is dispensable for the maintenance of EpiSCs.

(A) Strategy for Sox2 deletion in EpiSCs. Sox2 (SCKO) EpiSCs were transfected with pCMV-tdTomato-T2A-Cre. After 12–24 hours, cells were sorted for tdTomato expression and re-plated in the presence of ROCK inhibitor. Clones were picked and expanded before genotyping by PCR as indicated in Figure 2—figure supplement 1 . SCKO EpiSCs were also transfected with pCMV-tdTomato (lacking Cre). Expanded clones were numbered as indicated. (B) Immunoblot analysis of E14Tg2a, Sox2 (SCKO) and Sox2 (SKO) EpiSCs showing that SOX2 protein (red) is reduced in SCKO and absent in SKO EpiSCs. NANOG protein levels (green) were unaffected. Protein levels (normalized to the βactin level) are graphed below. (C) Bright-field morphology of E14Tg2a and SKO4 EpiSCs after 2 weeks (8 passages) in culture. Scale bar, 100 μm. (D) Immunofluorescence staining of SOX2 and OCT4 in SCKO and SKO6 EpiSCs. Scale bar, 100 μm. (E) RT-qPCR analysis of the indicated transcripts in E14Tg2a, Sox2 (SCKO) and Sox2 (SKO) EpiSCs. Clone numbers are indicated. Error bars represent the standard error of the mean (n = 2 to 3). The ability of SOXB1 proteins to substitute for one another in ESCs raised the hypothesis that functional redundancy between SOX2 and SOX3 may be responsible for the maintenance of pluripotency in primed EpiSCs. Expression of both Sox1 and Sox3 mRNAs was increased in EpiSCs compared to ESCs (Figure 1E). Examination of Sox2-/- EpiSCs showed that while Sox1 mRNA expression was reduced, Sox3 mRNA levels were elevated compared to control cells (Figure 4E). This suggests that Sox3 expression might functionally compensate for the lack of Sox2 in Sox2 EpiSCs, as is the case in Sox2-null E14.5 forebrain, where a 2-fold increase in Sox3 mRNA was detected (Miyagi et al., 2008). Alternatively, SOXB1 proteins may be irrelevant for EpiSC self-renewal. To distinguish between these possibilities we developed an approach to gene disruption using CRISPR/Cas9.

Testing the functional effects of Sox ORF disruption using CRISPR/Cas9

To examine the functional dependence of cells on Sox genes, a CRISPR/Cas9 approach was developed and tested initially using Sox2. Insertions or deletions (indels) into the Sox2 open reading frame (ORF) were introduced immediately upstream of the sequence encoding the SOX2 HMG domain (Figure 5—figure supplement 1A). Out-of-frame indels in this position are expected to abolish the DNA-binding ability of any aberrant protein that might still be produced. The frequency and length of indels induced by CRISPR/Cas9-mediated targeting of the endogenous Sox2 locus were investigated by TIDE (Tracking of Indels by Decomposition) analysis (Brinkman et al., 2014). Sox2 SCKO ESCs that constitutively express Sox1, Sox3 or GFP (generated in Figure 2B in the absence of tamoxifen) were analysed. If, as expected, Sox1 or Sox3 can rescue self-renewal, then such cells would carry both in-frame and out-of-frame (deleterious) indels (Figure 5—figure supplement 1B). In contrast, if ESC self-renewal relies on the remaining Sox2 allele, as anticipated in the case of SCKO ESCs constitutively expressing GFP, then cells carrying deleterious indels should be eliminated from the population. In this case, the only modifications present would be non-deleterious in-frame indels (Figure 5—figure supplement 1B). SCKO ESCs expressing Sox1, Sox3 or GFP were transfected with a plasmid encoding the sgRNA and eCas9. Cells were selected, genomic DNA isolated, PCR amplified, sequenced and analysed by TIDE. The population of SCKO ESCs expressing GFP contained Sox2 loci with no out-of-frame indels detected (Figure 5—figure supplement 2). In contrast, SCKO ESCs constitutively expressing Sox1 or Sox3 tolerated out-of-frame, deleterious indels at Sox2 (size +1,–10, −13) (Figure 5—figure supplement 2). These results show that indel analysis can be applied to study functional redundancy between SOXB1 group members in the maintenance of pluripotent cells.
Figure 5—figure supplement 1.

(A) Schematic representation of the Sox2 ORF showing the N-terminal domain (N, pink), the HMG box (dark blue), two transactivation domains (TAD1/2, yellow) and the serine-rich domain (green) (Gagliardi et al., 2013). The amino-acid positions of each domain relative to the start (ATG) codon of the ORF are shown. The position of the sgRNA used is represented as a black bar. (B) Experimental rationale for the expected Sox2 indel pattern in Sox2 ESCs (SCKO).

Figure 5—figure supplement 2.

Indel analysis performed using the TIDE tool (https://tide-calculator.nki.nl/) in SCKO ESCs expressing either Sox1, Sox3 or GFP transgenes.

Histograms represent indel frequency and size. Black bars indicate the frequency of unmodified (WT) alleles; grey bars indicate significant in frame indels and red bars indicate significant out of frame indels (p<0.001). Non-significant (n/s, p≥0.001) indels are not shown.

Sox2 and Sox3 are functionally redundant for the maintenance of EpiSCs

Having established the utility of CRISPR/Cas9-mediated indel induction for gene function analysis, a similar strategy was applied to Sox2 EpiSCs to determine whether SOXB1 proteins operate in a functionally redundant way to maintain EpiSCs. Since Sox2 EpiSCs showed an increase in Sox3 mRNA expression upon deletion of the second Sox2 allele, we focussed on Sox3, which is X-linked and thus present in only one copy in these male EpiSCs (Sox3). Two sgRNAs (sgRNA1 and 2) were designed to independently target the Sox3 ORF immediately upstream of the sequence encoding the HMG DNA-binding domain and tested individually (Figure 5A). TIDE analysis (Figure 5B) showed that in control EpiSCs expressing endogenous Sox2 (E14Tg2a and SCKO) both in frame and out of frame indels within Sox3 were detected using either sgRNA (Figure 5C). In contrast, two independent Sox2 EpiSC lines (SKO1, SKO6) retained only in frame deletions that did not disrupt the SOX3 HMG box (Figure 5C). Together with earlier results on Sox2 EpiSCs (Figure 4) and Sox3 EpiSCs (Figure 3), these data indicate that EpiSCs lacking either Sox2 or Sox3 alone can be maintained, while cells lacking both SOX2 and SOX3 proteins are lost. Therefore, EpiSC self-renewal requires SOXB1 function, and this can be provided by the expression of either endogenous Sox2 or Sox3.
Figure 5.

Sox3 indel analysis in Sox2 EpiSCs.

(A) Schematic representation of the Sox3 ORF with the HMG box highlighted in dark blue. The amino-acid positions of the HMG box relative to the start (ATG) codon of the ORF are shown. The positions of the sgRNAs 1 and 2 used are represented as black bars. (B) Experimental design for Sox3 indel analysis in Sox2 EpiSCs. (C) Indel analysis performed using the TIDE tool (https://tide-calculator.nki.nl/) in two Sox2 EpiSC lines (SKO1 and SKO6), in the parental Sox2 (SCKO) EpiSCs and in control E14Tg2a EpiSCs using Sox3 sgRNAs 1 and 2. Histograms represent indel frequency and size. Black bars indicate the frequency of unmodified (WT) alleles; grey bars indicate significant in frame indels and red bars indicate significant out of frame indels (p<0.001). Non-significant (n/s, p≥0.001) indels are not shown.

(A) Schematic representation of the Sox2 ORF showing the N-terminal domain (N, pink), the HMG box (dark blue), two transactivation domains (TAD1/2, yellow) and the serine-rich domain (green) (Gagliardi et al., 2013). The amino-acid positions of each domain relative to the start (ATG) codon of the ORF are shown. The position of the sgRNA used is represented as a black bar. (B) Experimental rationale for the expected Sox2 indel pattern in Sox2 ESCs (SCKO).

Histograms represent indel frequency and size. Black bars indicate the frequency of unmodified (WT) alleles; grey bars indicate significant in frame indels and red bars indicate significant out of frame indels (p<0.001). Non-significant (n/s, p≥0.001) indels are not shown.

Sox3 indel analysis in Sox2 EpiSCs.

(A) Schematic representation of the Sox3 ORF with the HMG box highlighted in dark blue. The amino-acid positions of the HMG box relative to the start (ATG) codon of the ORF are shown. The positions of the sgRNAs 1 and 2 used are represented as black bars. (B) Experimental design for Sox3 indel analysis in Sox2 EpiSCs. (C) Indel analysis performed using the TIDE tool (https://tide-calculator.nki.nl/) in two Sox2 EpiSC lines (SKO1 and SKO6), in the parental Sox2 (SCKO) EpiSCs and in control E14Tg2a EpiSCs using Sox3 sgRNAs 1 and 2. Histograms represent indel frequency and size. Black bars indicate the frequency of unmodified (WT) alleles; grey bars indicate significant in frame indels and red bars indicate significant out of frame indels (p<0.001). Non-significant (n/s, p≥0.001) indels are not shown. (A) Schematic representation of the Sox2 ORF showing the N-terminal domain (N, pink), the HMG box (dark blue), two transactivation domains (TAD1/2, yellow) and the serine-rich domain (green) (Gagliardi et al., 2013). The amino-acid positions of each domain relative to the start (ATG) codon of the ORF are shown. The position of the sgRNA used is represented as a black bar. (B) Experimental rationale for the expected Sox2 indel pattern in Sox2 ESCs (SCKO).

Indel analysis performed using the TIDE tool (https://tide-calculator.nki.nl/) in SCKO ESCs expressing either Sox1, Sox3 or GFP transgenes.

Histograms represent indel frequency and size. Black bars indicate the frequency of unmodified (WT) alleles; grey bars indicate significant in frame indels and red bars indicate significant out of frame indels (p<0.001). Non-significant (n/s, p≥0.001) indels are not shown.

Modulating SOXB1 levels affects differentiation and can prevent capture of primed pluripotency

Since Sox2 and Sox3 transcript levels change during ESC to EpiSC differentiation, this raised the question of their importance for attainment of a primed pluripotent state. ESCs that delete Sox2 differentiate to trophectoderm (Masui et al., 2007), while ESCs that continue expressing high SOX2 protein levels during differentiation are biased towards neural fates (Zhao et al., 2004). To assess the effect of increasing the SOXB1 concentration upon differentiation, we examined three clones overexpressing either SOX2 (Figure 6) or SOX3 (Figure 6—figure supplement 1), generated using the approach outlined in Figure 2A. When placed in an EpiSC differentiation protocol, both SOX2- and SOX3-overexpressing clones showed reduced expression of Oct4, Nanog and Nr5a2 transcripts as well as increased expression of Sox1, Mash1 (the Ascl1 gene product) and Pax6 transcripts (Figure 6A; Figure 6—figure supplement 1). Examination of SOX2-overexpressing clones in Activin/FGF showed neural-like cellular morphology (Figure 6B) and βIII-tubulin-positive axonal processes (Figure 6C). These findings indicate that while high SOXB1 levels are tolerated by ESCs, a decreased dosage of SOXB1 is essential for ESCs to transit effectively to an EpiSC state and avoid ectopic neural differentiation.
Figure 6.

Increased SOXB1 levels skew ESC differentiation towards the neural lineage.

(A) Schematic diagram showing the experimental plan. RT-qPCR analysis of the indicated transcripts in SCKO cells stably transfected and rescued with a Sox2 transgene (12–24 hr prior to a 24 hr treatment with 4OHT) (termed Sox2-rescued, S2R cells). Cells were grown in LIF/FCS conditions or differentiated in Activin/FGF conditions for 13 days (P2). Transcript levels were normalized to Tbp and plotted relative to SCKO ESCs. Error bars represent standard error of the mean (n = 3 to 5). (B) Bright field images of the indicated cells maintained in LIF/FCS or differentiated in Activin/FGF conditions (P2) . Scale bar, 100 μm. (C) Immunofluorescence staining of the neural marker βIII-tubulin (cyan) in cells differentiated in Activin/FGF conditions (P2); DAPI represented in grey. Scale bar, 100 μm.

Transcript levels were normalized to Tbp and plotted relative to SCKO ESCs. Error bars represent standard error of the mean (n = 3 to 5).

Figure 6—figure supplement 1.

RT-qPCR analysis of the indicated transcripts in E14Tg2a cells, Sox2 cells (SCKO), and Sox2 Sox3-rescued (S3R) cells maintained in LIF/FCS or differentiated in Activin/FGF conditions (P2) .

Transcript levels were normalized to Tbp and plotted relative to SCKO ESCs. Error bars represent standard error of the mean (n = 3 to 5).

Increased SOXB1 levels skew ESC differentiation towards the neural lineage.

(A) Schematic diagram showing the experimental plan. RT-qPCR analysis of the indicated transcripts in SCKO cells stably transfected and rescued with a Sox2 transgene (12–24 hr prior to a 24 hr treatment with 4OHT) (termed Sox2-rescued, S2R cells). Cells were grown in LIF/FCS conditions or differentiated in Activin/FGF conditions for 13 days (P2). Transcript levels were normalized to Tbp and plotted relative to SCKO ESCs. Error bars represent standard error of the mean (n = 3 to 5). (B) Bright field images of the indicated cells maintained in LIF/FCS or differentiated in Activin/FGF conditions (P2) . Scale bar, 100 μm. (C) Immunofluorescence staining of the neural marker βIII-tubulin (cyan) in cells differentiated in Activin/FGF conditions (P2); DAPI represented in grey. Scale bar, 100 μm.

RT-qPCR analysis of the indicated transcripts in E14Tg2a cells, Sox2 cells (SCKO), and Sox2 Sox3-rescued (S3R) cells maintained in LIF/FCS or differentiated in Activin/FGF conditions (P2) .

Transcript levels were normalized to Tbp and plotted relative to SCKO ESCs. Error bars represent standard error of the mean (n = 3 to 5). The SoxB1 requirements during neural differentiation of ESCs were next assessed. Initially, we compared Sox2 ESCs previously cultured in LIF/FCS or LIF/2i during neural differentiation induced by culture in N2B27 medium (Ying and Smith, 2003; Ying et al., 2003a). Our results indicate a more rapid induction of a Sox1-GFP reporter (Aubert et al., 2003) and Sox1 mRNA from LIF/FCS cultures than from LIF/2i cultures (Figure 7A). The Sox1-GFP kinetics from 2i/LIF cultures observed here agree with those reported (Marks et al., 2012), although this study noted a slower induction of Sox1-GFP from FCS/LIF cultures. However, as the timing of Sox1-GFP induction from FCS/LIF cultures in previous studies from the same group (Ying et al., 2003a) was consistent with the timings reported here, further differentiation experiments were initiated from LIF/FCS. Expression of pluripotency markers Nanog and Nr5a2 was decreased in the neural differentiation protocol, although with lower efficiency in Sox2 ESCs than in control Sox2 cells, while Fgf5 was induced in both (Figure 7B). Strikingly, Sox1, Mash1 and Pax6 mRNAs were induced in Sox2 but not Sox2 cells (Figure 7B), and an increase in Sox3 was not sustained. These data indicate that a SOXB1 level above that present in Sox2- cells is required to enable ESCs to undergo neural differentiation in vitro. Furthermore, the expression of Fgf5 suggests that Sox2 cells attain some aspects of an early post-implantation identity (Figure 7B). This contrasts with the neural differentiation observed in Sox2 mouse embryos (Avilion et al., 2003; Rizzoti and Lovell-Badge, 2007; Favaro et al., 2009), suggesting that compensatory mechanisms other than SOXB1 redundancy exist in the embryo.
Figure 7.

Decreased SOX2 levels prevent ESC differentiation into neurons.

(A) (TOP) Schematic diagram showing experimental plan for neural differentiation. (MIDDLE) Sox1-GFP (Aubert et al., 2003) expression in 46C cells cultured in LIF/FCS (green) or LIF/2i (purple) and for the indicated number of hours in N2B27 neural differentiation medium were assessed by flow cytometry. The positive (+) gate was set above the GFP expression level observed in 46C ESCs. The error bars indicate the standard error of the mean (n = 4). (BOTTOM) RT-qPCR analysis of Sox1 mRNA level in 46C cells during neural differentiation. Error bars indicate the standard error of the mean (n = 2). (B) RT-qPCR analysis of the indicated transcripts in differentiating E14Tg2a (E14, Sox2) and SCKO (Sox2) cells. Transcript levels were normalized to Tbp. Error bars represent standard error of the mean (n = 3). (C) Immunofluorescence staining of the neural marker βIII-tubulin (green) in Sox2 E14Tg2a (E14), H2.14 and H2.17 ESCs, and in Sox2 SCKO, H2.1 and BH1.21 ESCs differentiated in N2B27 medium for 4 days; DAPI represented in blue. Scale bar, 100 μm. (D) Immunofluorescence staining of the neural marker βIII-tubulin (green) in Sox2and H2.1 ESCs differentiated in N2B27 medium for 4 days in the presence or in the absence of the LDN-193189 BMP inhibitor (BMPi), of the SB-431542 Nodal inhibitor (NODi) and of recombinant bFGF; DAPI represented in blue. Scale bar, 100 μm.

(A) PCR amplicons surrounding the Cas9 cutting site were generated starting from gDNA of the individual clones and submitted for Sanger sequencing. Electropherograms containing possible indels were then analysed using the TIDE tool (https://tide-calculator.nki.nl/). Histograms represent frequency and size of the deletions found within the Sox2 alleles of the indicated clones. Black bars indicate the frequency of unmodified (WT) alleles; grey bars indicate in frame indels and red bars indicate out of frame indels. Clone H2.1 carries an out of frame 8 bp (Δ8) on one allele and no deletion on the other allele; clone BH1.21 carries an out of frame 10 bp (Δ10) on one allele and an in frame 3 bp deletion (Δ3) on the other allele; two clones that did not carry any deletion on either Sox2 allele (H2.14 and H2.17) were also isolated as controls. (B) WT SOX2 aminoacid sequence aligned with the sequences produced by the mutated Sox2 alleles in clones H2.1 and BH1.21 (as indicated). Bold blue font indicates residues forming the HMG DNA-binding domain of the protein; small font indicates mutated residues and * indicates premature stop codons generated by the alleles containing out of frame indels; - indicates the deleted serine (S)residue produced by the BH1.21 Δ3 allele.

Decreased SOX2 levels prevent ESC differentiation into neurons.

(A) (TOP) Schematic diagram showing experimental plan for neural differentiation. (MIDDLE) Sox1-GFP (Aubert et al., 2003) expression in 46C cells cultured in LIF/FCS (green) or LIF/2i (purple) and for the indicated number of hours in N2B27 neural differentiation medium were assessed by flow cytometry. The positive (+) gate was set above the GFP expression level observed in 46C ESCs. The error bars indicate the standard error of the mean (n = 4). (BOTTOM) RT-qPCR analysis of Sox1 mRNA level in 46C cells during neural differentiation. Error bars indicate the standard error of the mean (n = 2). (B) RT-qPCR analysis of the indicated transcripts in differentiating E14Tg2a (E14, Sox2) and SCKO (Sox2) cells. Transcript levels were normalized to Tbp. Error bars represent standard error of the mean (n = 3). (C) Immunofluorescence staining of the neural marker βIII-tubulin (green) in Sox2 E14Tg2a (E14), H2.14 and H2.17 ESCs, and in Sox2 SCKO, H2.1 and BH1.21 ESCs differentiated in N2B27 medium for 4 days; DAPI represented in blue. Scale bar, 100 μm. (D) Immunofluorescence staining of the neural marker βIII-tubulin (green) in Sox2and H2.1 ESCs differentiated in N2B27 medium for 4 days in the presence or in the absence of the LDN-193189 BMP inhibitor (BMPi), of the SB-431542 Nodal inhibitor (NODi) and of recombinant bFGF; DAPI represented in blue. Scale bar, 100 μm.

Genotyping analysis of four ESC clones generated after transfection of CRISPR/Cas9 reagents to induce indels within the Sox2 ORF in E14Tg2a ESCs.

(A) PCR amplicons surrounding the Cas9 cutting site were generated starting from gDNA of the individual clones and submitted for Sanger sequencing. Electropherograms containing possible indels were then analysed using the TIDE tool (https://tide-calculator.nki.nl/). Histograms represent frequency and size of the deletions found within the Sox2 alleles of the indicated clones. Black bars indicate the frequency of unmodified (WT) alleles; grey bars indicate in frame indels and red bars indicate out of frame indels. Clone H2.1 carries an out of frame 8 bp (Δ8) on one allele and no deletion on the other allele; clone BH1.21 carries an out of frame 10 bp (Δ10) on one allele and an in frame 3 bp deletion (Δ3) on the other allele; two clones that did not carry any deletion on either Sox2 allele (H2.14 and H2.17) were also isolated as controls. (B) WT SOX2 aminoacid sequence aligned with the sequences produced by the mutated Sox2 alleles in clones H2.1 and BH1.21 (as indicated). Bold blue font indicates residues forming the HMG DNA-binding domain of the protein; small font indicates mutated residues and * indicates premature stop codons generated by the alleles containing out of frame indels; - indicates the deleted serine (S)residue produced by the BH1.21 Δ3 allele. To eliminate the possibility that the neural differentiation defect in SCKO cells resulted from a defect unrelated to Sox2, CRISPR/Cas9 was used to introduce indels in the Sox2 ORF in E14Tg2a ESCs. Using independent sgRNAs, two Sox2 clones were isolated. Clone H2.1 carried an 8 bp deletion on one Sox2 allele; clone BH1.21 carried a 10 bp deletion on one allele and a 3 bp deletion on the other allele (Figure 7—figure supplement 1A). Two additional clones in which the Sox2 alleles were not modified (H2.14, H2.17) were used as controls. The −8 and −10 deletions cause frame-shifts introducing stop codons, while the −3 bp deletion is likely to be functionally neutral as it occurs N-terminal to the HMG domain (Figure 7—figure supplement 1B). Placing Sox2 ESCs (H2.14, H2.17 and E14Tg2a) in a neural differentiation protocol produced βIII-tubulin positive neurons (Figure 7C). In contrast, no βIII-tubulin positive cells were detected from parallel treatments of H2.1, BH1.21 and SCKO Sox2 (Figure 7C). This establishes that the lack of a functional Sox2 allele impairs effective neural differentiation of ESCs.
Figure 7—figure supplement 1.

Genotyping analysis of four ESC clones generated after transfection of CRISPR/Cas9 reagents to induce indels within the Sox2 ORF in E14Tg2a ESCs.

(A) PCR amplicons surrounding the Cas9 cutting site were generated starting from gDNA of the individual clones and submitted for Sanger sequencing. Electropherograms containing possible indels were then analysed using the TIDE tool (https://tide-calculator.nki.nl/). Histograms represent frequency and size of the deletions found within the Sox2 alleles of the indicated clones. Black bars indicate the frequency of unmodified (WT) alleles; grey bars indicate in frame indels and red bars indicate out of frame indels. Clone H2.1 carries an out of frame 8 bp (Δ8) on one allele and no deletion on the other allele; clone BH1.21 carries an out of frame 10 bp (Δ10) on one allele and an in frame 3 bp deletion (Δ3) on the other allele; two clones that did not carry any deletion on either Sox2 allele (H2.14 and H2.17) were also isolated as controls. (B) WT SOX2 aminoacid sequence aligned with the sequences produced by the mutated Sox2 alleles in clones H2.1 and BH1.21 (as indicated). Bold blue font indicates residues forming the HMG DNA-binding domain of the protein; small font indicates mutated residues and * indicates premature stop codons generated by the alleles containing out of frame indels; - indicates the deleted serine (S)residue produced by the BH1.21 Δ3 allele.

Neural differentiation of pluripotent cells is stimulated by FGF (Ying et al., 2003a; Ying and Smith, 2003) and inhibited by both BMP and Nodal/Activin (Ying et al., 2003b; Vallier et al., 2004; 2009; Guo et al., 2009). To determine whether perturbations in these pathways could overcome the neural differentiation defect of Sox2 ESCs, H2.1 and SCKO cells were placed in the neural differentiation protocol supplemented with either recombinant bFGF or inhibitors of BMP or Nodal. Additional FGF, or inhibition of Nodal alone, was without effect, while BMP inhibition resulted in only a few βIII-tubulin-positive cells (Figure 7D). However, simultaneous BMP and Nodal inhibition enabled Sox2 ESCs to form βIII-tubulin-positive cells (Figure 7D). These results indicate that a reduction in SOX2 levels in ESCs enhances the response of cells to endogenous BMP and Nodal signalling, preventing effective neural differentiation. To further investigate the effects of modulating SoxB1 gene dosage upon ESC differentiation, Sox3 ESCs were generated by CRISPR/Cas9 mediated gene deletion from heterozygous Sox2 ESCs (SCKO). PCR genotyping identified two Sox2 ESC clones (#36 and #37) (Figure 8A). Quantitative transcript analysis showed that while Sox2 ESCs had an expected reduction in Sox2 mRNA and unchanged levels of Sox1 and Sox3 mRNAs compared to E14Tg2a ESCs, deletion of Sox3 from Sox2 ESCs increased Sox1 and surprisingly, also Sox2 mRNA to a level similar to that present in E14Tg2a ESCs (Figure 8B). These data suggest cross-regulatory interactions between SoxB1 members in which SOX3 protein represses Sox1 and Sox2, either directly or indirectly, in ESCs (Figure 8B). However, as Sox3 deletion in Sox2 ESCs did not increase Sox1 and Sox2 mRNA levels (Figure 3D) this suggests that the repressive effect of SOX3 on Sox2 is sensitive to the SOX2 protein concentration.
Figure 8.

Sox2/Sox3 requirements during EpiSCs differentiation.

(A) Genotyping analysis of the Sox3 locus in E14Tg2a (E14, Sox2), SCKO (Sox2) ESCs (∼2 kb band) and in two Sox2 ESC clones (#36 and #37) derived after deletion of the Sox3 locus (∼600 bp band). Gene targeting was performed following the strategy depicted in Figure 3A. (B) RT-qPCR analysis of the indicated transcripts in E14Tg2a ESCs (E14, Sox2), SCKO ESCs (Sox2) and in two Sox2 ESC clones (#36 and #37). mRNA levels were normalised over Tbp and plotted relative to E14Tg2a. Error bars indicate the standard error of the mean (n = 3). (C) RT-qPCR analysis of the indicated transcripts in SCKO cells (Sox2) and in two Sox2 clones (#36 and #37) grown in LIF/FCS condition and in Activin/FGF conditions for 2 passages (P2). mRNA levels were normalised to Tbp and plotted relative to ESCs (LIF/FCS). Error bars indicate the standard error of the mean (n = 3). (D) RT-qPCR analysis of the indicated transcripts in SCKO cells (Sox2) and in two Sox2 clones (#36 and #37) grown in LIF/FCS condition and in neural differentiation medium (N2B27) for the indicated number of hours. mRNA levels were normalised to Tbp and plotted relative to ESC (LIF/FCS). Error bars indicate the standard error of the mean (n = 3).

mRNA levels were normalised to Tbp and plotted relative to ESC (LIF/FCS). Error bars indicate the standard error of the mean (n = 3).

Sox2/Sox3 requirements during EpiSCs differentiation.

(A) Genotyping analysis of the Sox3 locus in E14Tg2a (E14, Sox2), SCKO (Sox2) ESCs (∼2 kb band) and in two Sox2 ESC clones (#36 and #37) derived after deletion of the Sox3 locus (∼600 bp band). Gene targeting was performed following the strategy depicted in Figure 3A. (B) RT-qPCR analysis of the indicated transcripts in E14Tg2a ESCs (E14, Sox2), SCKO ESCs (Sox2) and in two Sox2 ESC clones (#36 and #37). mRNA levels were normalised over Tbp and plotted relative to E14Tg2a. Error bars indicate the standard error of the mean (n = 3). (C) RT-qPCR analysis of the indicated transcripts in SCKO cells (Sox2) and in two Sox2 clones (#36 and #37) grown in LIF/FCS condition and in Activin/FGF conditions for 2 passages (P2). mRNA levels were normalised to Tbp and plotted relative to ESCs (LIF/FCS). Error bars indicate the standard error of the mean (n = 3). (D) RT-qPCR analysis of the indicated transcripts in SCKO cells (Sox2) and in two Sox2 clones (#36 and #37) grown in LIF/FCS condition and in neural differentiation medium (N2B27) for the indicated number of hours. mRNA levels were normalised to Tbp and plotted relative to ESC (LIF/FCS). Error bars indicate the standard error of the mean (n = 3).

RT-qPCR analysis of the indicated transcripts in wild type E14Tg2a cells (Sox2) and in two Sox2 clones (S3KO8 and S3KO35) (see Figure 3) grown in LIF/FCS conditions and neural differentiation medium (N2B27) for the indicated number of hours.

mRNA levels were normalised to Tbp and plotted relative to ESC (LIF/FCS). Error bars indicate the standard error of the mean (n = 3). Next, the ability of Sox2 ESCs to transition to primed pluripotency was assessed by passaging in Activin/FGF. Whereas Sox2 EpiSCs could be successfully established and maintained (Figure 4), Sox2 cells displayed a differentiated morphology within two passages. Quantitative transcript analysis showed that in comparison to Sox2 cells, Sox2 cells induced less Fgf5 but more Mash1 and Pax6 (Figure 8C). These data suggest that while primed pluripotency can be maintained in the absence of either Sox2 or Sox3, the transition from a naïve ESC state to a primed EpiSC state does not occur effectively when Sox3 is absent and the Sox2 gene dosage is halved. Notably, compared to Sox2 ESCs, Sox2 ESCs have the same Sox2 mRNA level as Sox2+/+ ESCs and Sox1 mRNA is increased >10 fold (Figure 8B). Such an increase in Sox1 mRNA expression is sufficient to enforce neural differentiation following LIF withdrawal (Zhao et al., 2004). The increased levels of Sox1 and Sox2 mRNAs in LIF/FCS (Figure 8B), together with the increased levels of neural differentiation markers during EpiSC induction of Sox2 ESCs (Figure 8C), prompted us to examine the behaviour of Sox2 ESCs during neural differentiation. While Sox2 ESCs did not effectively undergo neural differentiation (Figure 7), deletion of Sox3 from Sox2 ESCs was sufficient to rescue neural differentiation as judged by induction of Sox1, Mash1 and Pax6 mRNAs and of the βIII-tubulin protein (Figure 8D, Figure 8—figure supplement 1). This is likely a secondary consequence of the increase in Sox2/Sox1 mRNA expression in Sox2 ESCs resulting from Sox3 deletion (Figure 8B). The two Sox2+/+; Sox3 ESC clones (Figure 3A) were able to differentiate into neural cells with similar efficiency to parental cells as shown by induction of Sox1, Mash1 and Pax6 mRNAs (Figure 8—figure supplement 2) and appearance of βIII-tubulin-positive cells (Figure 8—figure supplement 1).
Figure 8—figure supplement 1.

Immunofluorescence staining of the neural marker βIII-tubulin (TUJ1, green) in the indicated cells grown for 96 hr in neural differentiation medium (N2B27); DAPI staining represented in blue. Scale bar, 100 μm.

Figure 8—figure supplement 2.

RT-qPCR analysis of the indicated transcripts in wild type E14Tg2a cells (Sox2) and in two Sox2 clones (S3KO8 and S3KO35) (see Figure 3) grown in LIF/FCS conditions and neural differentiation medium (N2B27) for the indicated number of hours.

mRNA levels were normalised to Tbp and plotted relative to ESC (LIF/FCS). Error bars indicate the standard error of the mean (n = 3).

These data demonstrate that altering the SoxB1 genetic composition by deletion of Sox3 and elimination of one functional Sox2 allele induces a transcriptional de-regulation of the remaining SoxB1 alleles. The increased mRNA levels of Sox1 and Sox2 are then sufficient to rescue neural differentiation of Sox2 ESCs but also impair the ability of Sox2 ESCs to be captured as primed EpiSCs.

Discussion

Our examination of SoxB1 function in pluripotent cells extends previous findings that SOXB1 proteins can act redundantly in ESCs (Niwa et al., 2016) and during somatic cell reprogramming (Nakagawa et al., 2008) by showing that in EpiSCs, SOX2 and SOX3 proteins are functionally redundant within an altered PGRN. Functional redundancy implies that we can consider the total SOXB1 complement as a key factor in the outcomes selected by cells genetically engineered to express varying combinations of functional SoxB1 alleles. In particular, a broad range of SOXB1 levels are tolerated by ESCs. However, upon exit from naïve pluripotency, low SOXB1 levels permit entry to the EpiSC state, while high levels enforce neural differentiation (Figure 9). We have also uncovered cross-regulatory relationships between Sox3 and the other SoxB1 members, that we hypothesise act to maintain an adequate SOXB1 level.
Figure 9.

Dependence of cell fate potential of ESCs on the total SOXB1 concentration.

The overall SOXB1 concentration inferred from SoxB1 transcript levels in different SoxB1 mutant cell lines. Naïve ESCs self-renew in a wide range of SOXB1 concentrations. However, only ESCs with approximately wild-type SOXB1 levels can differentiate towards both primed EpiSCs and neural cells. ESCs with increased SOXB1 concentrations are poised towards neural differentiation, preventing their capture as primed EpiSCs in FGF/ActivinA. Decreased SOXB1 concentrations are insufficient to enable neural differentiation due to increased activity of neural antagonists (BMP and Nodal). A further reduction in SOXB1 is tolerated in the primed state due to SOX2/SOX3 functional redundancy but complete loss of the predominant SoxB1 forms is incompatible with self-renewal of both naïve and primed pluripotent cells. Depicted below are diagrams of pre- (E3.5) and postimplantation (E5.5 and E7.5) mouse embryos indicating the published expression patterns of SoxB1 mRNAs (Wood and Episkopou, 1999; Uchikawa et al., 2011; Avilion et al., 2003; Cajal et al., 2012), and the areas of BMP/Nodal signalling and inhibition during gastrulation (Constam and Robertson, 2000; Bachiller et al., 2000; Kinder et al., 2001; Levine et al., 2006; Pereira et al., 2012; Norris et al., 2002; Lawson et al., 1999; Perea-Gomez et al., 2002).

Dependence of cell fate potential of ESCs on the total SOXB1 concentration.

The overall SOXB1 concentration inferred from SoxB1 transcript levels in different SoxB1 mutant cell lines. Naïve ESCs self-renew in a wide range of SOXB1 concentrations. However, only ESCs with approximately wild-type SOXB1 levels can differentiate towards both primed EpiSCs and neural cells. ESCs with increased SOXB1 concentrations are poised towards neural differentiation, preventing their capture as primed EpiSCs in FGF/ActivinA. Decreased SOXB1 concentrations are insufficient to enable neural differentiation due to increased activity of neural antagonists (BMP and Nodal). A further reduction in SOXB1 is tolerated in the primed state due to SOX2/SOX3 functional redundancy but complete loss of the predominant SoxB1 forms is incompatible with self-renewal of both naïve and primed pluripotent cells. Depicted below are diagrams of pre- (E3.5) and postimplantation (E5.5 and E7.5) mouse embryos indicating the published expression patterns of SoxB1 mRNAs (Wood and Episkopou, 1999; Uchikawa et al., 2011; Avilion et al., 2003; Cajal et al., 2012), and the areas of BMP/Nodal signalling and inhibition during gastrulation (Constam and Robertson, 2000; Bachiller et al., 2000; Kinder et al., 2001; Levine et al., 2006; Pereira et al., 2012; Norris et al., 2002; Lawson et al., 1999; Perea-Gomez et al., 2002).

SOXB1 function in primed pluripotent cells is provided by SOX2 and SOX3

In ESCs Sox2 mRNA is expressed at much higher levels than either Sox1 or Sox3, and thus, in spite of redundancy, Sox2 can be considered to provide the dominant SOXB1 function in ESC pluripotency. However, even though Sox2 is also the most abundant SoxB1 transcript in EpiSCs, functional properties of the PGRN have changed. While Sox2 mRNA levels in EpiSCs are lower than in ESCs, Sox3 levels are increased, and SoxB1 function is provided redundantly by Sox2 and Sox3. Sox1 mRNA levels are also increased in these cells. The ability of Sox1 or Sox3 to substitute functionally for Sox2 in ESCs might suggest that Sox1 could also function redundantly with Sox2 to maintain EpiSCs. However, Sox1 may be less relevant to pluripotency as, unlike Sox2 and Sox3, which are widely expressed in the pluripotent postimplantation epiblast, Sox1 expression is uniquely associated with neural fate in the epiblast (Wood and Episkopou, 1999; Uchikawa et al., 2011; Cajal et al., 2012; Figure 9). Indeed, Sox1 expression in EpiSC populations is associated with neural committed cells (Tsakiridis et al., 2014).

SOXB1 redundancy in vivo

In the seminal Sox2 deletion study (Avilion et al., 2003), Sox2 embryos fail to develop a postimplantation epiblast. This was hypothesised to be due to the fact that neither Sox1 nor Sox3 were expressed sufficiently at the time of embryonic failure and therefore no redundantly acting SOXB1 protein could compensate for the SOX2 absence. Additional instances of potential SoxB1 redundancy have been reported in vivo. Replacement of an endogenous Sox2 allele with a Sox1 ORF produced no phenotype, suggestive of functional interchangeability (Ekonomou et al., 2005). SOXB1 redundancy is likely to be evolutionarily conserved since in the chick, Sox2 and Sox3 both promote development of ectoderm and neurectoderm at gastrulation, although interestingly, in this case Sox3 expression occurs before Sox2 (Acloque et al., 2011). Moreover, while genetic knock-ins have shown that placement of Sox2 ORF at the Sox3 locus can rescue pituitary and testes phenotypes caused by Sox3 deletion (Adikusuma et al., 2017), the effects on pluripotent cells were not assessed. It is therefore interesting that while Sox3 mice can be viable, on a 129 genetic background they exhibit gastrulation-stage lethality (Rizzoti and Lovell-Badge, 2007; Adikusuma et al., 2017). This suggests that aspects of the regulation of SoxB1 expression that we show here to be important in vitro could also contribute to strain-specific differences in the timing or regulation of SOXB1 activity in vivo. Further studies will be required to establish the extent to which SOXB1 proteins can substitute genetically for one another in pluripotent cells in vivo.

Low SOXB1 levels permit entry to the EpiSC state

Our results indicate that the total SoxB1 transcript level in ESCs needs to be reduced to enable entry into the EpiSC state rather than neural differentiation (Figure 9). Sox2+/- ESCs placed in a neural differentiation protocol showed a reduced down-regulation of pluripotency markers (Nanog and Nr5a2) and failed to induce markers of neural differentiation. Surprisingly however, deletion of Sox3 from SCKO cells to produce Sox2 ESCs restored neural differentiation capacity (Figure 8D). Moreover, placement of Sox2 ESCs in an EpiSC differentiation protocol resulted in a skewing of differentiation towards a neural identity as indicated by loss of Nanog, Nr5a2 and Fgf5 transcripts, and increase in mRNAs for neural differentiation markers (Figure 8C). This paradoxical behaviour may be explained by the fact that both Sox1 and Sox2 mRNAs increase upon elimination of Sox3 from Sox2 ESCs (Figure 8B). Interestingly, reciprocal repression of Sox3 by SOX2 also occurs in EpiSCs (Figure 4E). Unravelling the regulatory relationships between SoxB1 genes is a relevant point for future studies.

High SOXB1 levels enforce neural differentiation

Previous results have shown that elevating SOX1 or SOX2 expression in differentiating ESCs promotes neural differentiation (Zhao et al., 2004). In the present study, we showed that ESCs with either elevated SOX2 or SOX3 self-renew efficiently. However, when these cells were placed in an EpiSC differentiation protocol, differentiation was skewed towards a neural identity despite the presence of FGF and neural-antagonising Activin signals (Vallier et al., 2004, 2009). This indicates that enforced expression of SOXB1 proteins overrides the signalling system that captures primed pluripotent cells in vitro.

Parallels between SOXB1 function during in vitro and in vivo neurogenesis

The dynamics of ESC differentiation in vitro towards neural and EpiSC states show interesting parallels with early development in vivo (Figure 9). While ESCs and pre-implantation embryos express only Sox2, early post-implantation embryos, and differentiating ESCs, express Sox2 and Sox3 but not Sox1 (Wood and Episkopou, 1999; Uchikawa et al., 2011; Cajal et al., 2012). At gastrulation stages, which are transcriptomically similar to EpiSCs (Kojima et al., 2014), Sox2 and Sox3 are expressed widely in the epiblast. As noted above, Sox1 expression is restricted to a subdomain within the Sox2/Sox3-positive epiblast that overlaps extensively with the prospective brain (Wood and Episkopou, 1999; Cajal et al., 2012), where early neural differentiation occurs in vivo. Thus, the region expressing all three SOXB1 members might undergo neural induction as a consequence of expressing high levels of SOXB1 proteins, while the rest of the epiblast experiences lower SOXB1 levels, enabling pluripotency to extend through gastrulation (Osorno et al., 2012).

An interplay between SOXB1 function and anti-neural signals

Inhibition of both BMP and Nodal signalling rescues the neural differentiation ability of Sox2+/- ESCs. These results suggest that Sox2+/- ESCs can initiate exit from naïve pluripotency but cannot complete neural differentiation due to enhanced responses of cells to endogenous anti-neuralising signalling by BMP and Nodal. The viability of Sox2+/- mice (Avilion et al., 2003; Rizzoti and Lovell-Badge, 2007; Favaro et al., 2009) indicates that the in vivo environment is able to overcome these anti-neural signals. In wild-type embryos, the prospective brain is shielded from Nodal and BMP signalling by secreted inhibitors of these pathways, including Cer1, Lefty1/2 (Perea-Gomez et al., 2002), Chrd and Nog (Bachiller et al., 2000) (Figure 9). Removal of either Nodal or BMP inhibition leads to absence of anterior neural tissue. Interestingly, the cells that express these inhibitors (including the anterior visceral endoderm and node) do not express SOXB1 proteins and are therefore likely to be functionally unaltered in Sox2+/- embryos. The observation that the reduced SOXB1 concentration in Sox2+/- pluripotent cells is compatible with neural differentiation, provided that endogenous anti-neuralising signals are blocked, indicates that to fully understand how the choice between neural and primed pluripotency is made, it will be necessary to elucidate how the signalling environment connects to the SOXB1-driven transcriptional programme.

Materials and methods

Cell culture

For a complete list of cell lines, their name, their genotypes and their original characterisation, see Supplementary file 2. All the cell lines used in this study were regularly tested for contaminations and were mycoplasma negative. ESCs grown in LIF/FCS conditions were cultured on dishes coated with 1% gelatin (Sigma-Aldrich, St. Louis, USA) and in GMEM medium (Sigma-Aldrich, St. Louis, USA) supplemented with 1x non-essential aminoacids (Life Technologies, Waltham, USA), 1 mM sodium pyruvate (Life Technologies, Waltham, USA), 2 mM glutamine (Life Technologies, Waltham, USA), 100 U/ml human LIF (Nichols et al., 1990), 10% ESC-grade FCS (APS, UK) and 100 μM β-mercaptoethanol (Life Technologies, Waltham, USA). G418 (200 μg/mL, Sigma-Aldrich, St. Louis, USA) was supplemented to maintain SCKO ESCs. To adapt ESCs into LIF/2i/N2B27 (Ying et al., 2008) (LIF/2i) or LIF/BMP4/N2B27 (Ying et al., 2003b) (LIF/BMP) conditions, ESCs were replated in LIF/FCS on gelatin-coated plates for 24 hr before changing the culture media to N2B27 medium (Ying and Smith, 2003) supplemented with 100 U/ml LIF, 1 μM PD0325901 (Stemgent, Cambridge, USA) and 3 μM CHIR99021 (Stemgent, Cambridge, USA) (LIF/2i) or 10 ng/ml BMP4 (Life Technologies, Waltham, USA) (LIF/BMP). Cells were passaged for at least four passages before using for analysis. EpiSCs were derived from LIF/FCS-cultured ESCs as described previously (Guo et al., 2009; Osorno et al., 2012) and cultured on dishes pre-coated with 7.5 μg/ml fibronectin (Sigma-Aldrich, St. Louis, USA) without feeders in N2B27 medium (Ying and Smith, 2003) ActivinA (20 ng/ml, Peprotech, UK), bFGF (10 ng/ml, Peprotech, UK). In brief, ESCs were plated at a density of 3 × 103 cells/cm2; the equivalent of 30 × 103 cells per well of a six well plate. Medium was changed to Activin/FGF conditions 24 hr after replating. Cells were passaged after 4–5 days in a 1:20 dilution for the first 8–10 passages. Stable EpiSC lines were propagated by passaging in a 1:10-1:20 dilution. For neural differentiation, ESCs were cultured with minor modifications as previously described (Ying et al., 2003a; Ying and Smith, 2003). Briefly, ESCs were replated in LIF/FCS on gelatin-coated plates for 24 hr before changing the culture media to N2B27 medium (Ying and Smith, 2003) only and allowed to grow for the indicated amount of time. When indicated, cells were differentiated in the presence of bFGF (10 ng/ml, Peprotech, UK), LDN-193189 (100 nM, Stemgent, Cambridge, USA) and/or SB-431542 (10 μM, Merck, Germany).

Sox2 deletion in ESCs and EpiSCs

Sox2 deletion in SCKO ESCs was performed similarly to previously described (Gagliardi et al., 2013; Favaro et al., 2009). In brief, 107 SCKO ESCs grown in LIF/FCS conditions were transfected using Lipofectamine 3000 (Life Technologies, Waltham, USA) with 6–15 μg of transgene-expressing plasmid the indicated test cDNA before replated in LIF/FCS at a density of 1.5 × 106 per 10 cm dish cultured overnight in the presence or in the absence of 4-hydroxytamoxifen (1 μM, Sigma-Aldrich, St. Louis, USA). Medium was changed 12 to 24 hr later to LIF/FCS medium supplemented with Hygromycin B (150 μg/mL, Roche, Switzerland). Transfected cells were cultured for 8 to 10 days before they were stained for alkaline phosphatase (AP) activity (Sigma-Aldrich, St. Louis, USA). Stained colonies were scored based on the presence of AP-positive cells within the colony. In parallel, unstained populations were expanded to generate cell lines before genotyping by PCR. SCKO EpiSCs were transfected with ptdTomato-T2A-Cre by lipofection (Lipofectamine 2000, Life Technologies, Waltham, USA). After 12–24 hours cells were sorted for tdTomato expression and replated in the presence of ROCK inhibitor (Y-27632, Merck, Germany) for 24 hr before medium was changed to remove ROCK inhibitor. Clones were expanded before genotyping by PCR.

CRISPR/Cas9 deletion of the Sox3 gene

Two sgRNAs were designed upstream of the ATG (sgRNA1) and downstream of the stop codon (sgRNA2) using an online CRISPR Design Tool (http://crispr.mit.edu/) and subsequently cloned in the BbsI-linearised pSpCas9(BB)−2A-GFP plasmid (Addgene 48138) as previously described (Ran et al., 2013). sgRNA sequences used in this study are listed in Supplementary file 3. 106 E14Tg2a ESCs were co-transfected with 1 μg of sgRNA1-encoding plasmid and 1 μg of sgRNA2-encoding plasmid using Lipofectamine 3000 (Life Technologies, Waltham, USA) following the manufacturer’s instructions. 24 hr after transfection, GFP-positive cells were sorted by FACS and replated at clonal density to allow the isolation of single colonies. After 8–10 days, single ESC colonies were expanded and the Sox3 locus was genotyped by PCR.

Indel induction and TIDE analysis

SgRNAs targeting the Sox2 or Sox3 ORF immediately upstream of the sequence encoding for the HMG box were designed using an online CRISPR Design Tool (http://crispr.mit.edu/). The Sox2 sgRNA was subsequently cloned in the BbsI-linearised pSpCas9(BB)−2A-Puro (PX459) V2.0 plasmid (Addgene 62988) as previously described (Ran et al., 2013). The resulting plasmid, or the empty vector control, were then transfected using Lipofectamine 3000 (Life Technologies, Waltham, USA) into SCKO ESCs constitutively expressing either SOX1, SOX3 or GFP. After 24 hr, ESCs were selected with 1.5 μg/ml of puromycin (Life Technologies, Waltham, USA) for 24 hr to enrich for transfected cells, and then expanded for 72 hr. For Sox3 indel analysis, two individual sgRNAs were cloned in BbsI-linearised pSpCas9(BB)−2A-mCherry that was obtained by fusing a 2A-mCherry cassette to the Cas9 CDS of the eSpCas9(1.1) plasmid (Addgene 71814). 106 E14Tg2a (Sox2), SCKO (Sox2), SKO1 (Sox2) and SKO6 (Sox2) EpiSCs were then transfected with 1 μg of sgRNA-containing plasmids or empty vector using Lipofectamine 3000 (Life Technologies, Waltham, USA). 48 hr after transfection, mCherry-positive cells were FACS sorted, replated and expanded for 72 hr. Genomic DNA (gDNA) was extracted using the DNeasy Blood and Tissue kit (Qiagen, Germany) following the manufacturer’s instructions. gDNA was PCR amplified using the Q5 HotStart Polymerase (NEB, Ipswich, USA) and primers flanking either the Sox2 sgRNA or Sox3 sgRNAs recognition sites. Primers and sgRNAs used in this study are listed in Supplementary file 3. PCR amplicons were purified and submitted for Sanger sequencing using the same forward primer that they had been generated with. Sanger sequencing electropherograms were then submitted for indel analysis with the TIDE tool (https://tide-calculator.nki.nl/, [Brinkman et al., 2014]) using amplicons obtained from cells transfected with empty vector as reference sequences. Indel analysis was performed using the default TIDE settings and a window of 27 bp for SCKO ESCs and Sox2 indel induction, and a window of 30 bp for EpiSCs and Sox3 indel induction. Indels with p value >0.001 were scored as statistically significant.

PCR genotyping

Genomic DNA (gDNA) was extracted from cells using DNeasy kits (Qiagen, Germany) according to the manufacturer’s recommended protocol. 100 ng of gDNA was used per PCR reaction. Primers used in this study are listed in Supplementary file 3.

Plasmid constructs

A mouse genomic BAC containing 5 kb on either side of the Sox2 stop codon (Source bioscience bMQ314D22) was shredded by pSC101-BAD-gbaA mediated recombineering using the pACYC177 backbone comprising the p15-origin and β-lactamase gene to produce pSox2-10kb. To construct the Sox2-T2A-H2B-tdTomato-IRES-Neo cassette, 89 bp and 168 bp immediately upstream and downstream of, and excluding the Sox2 stop codon were PCR amplified to serve as homology arms for recombineering. The 89 bp upstream fragment has a 5’ Xho I site and a GSG-T2A sequence at the 3’ end containing an in-frame Fse I site that preserves the T2A Gly-Pro residues and is followed by Not I, Pac I, Asc I, San DI, Bam HI, Afl II, Nhe I, Cla I and Xho I sites. The sequence of this fusion is shown below: GGCTCCGGAGAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGGCCGGCCGCGGCCGCTTAATTAAGGCGCGCCGGGACCCGGATCCGCTTAAGGCTAGCATCGATTCTCGAG The 89 bp fragment was cloned into a PCR amplified, pUC19-derived 2 kb minimal vector comprising β-lactamase gene and Col E1 origin with 150nt flanking sequences and a single Xho I site (pL). Individual features were PCR-amplified, flanked with unique sites and cloned as follows: H2B-tdTomato was cloned in-frame between Fse I and Not I, using TAA stop codon from Pac I; Gtx-IRES was cloned between Pac I and Asc I; neomycin phosphotransferase (Npt) was cloned between San DI and Bam HI, using the TAA stop codon from Afl II. The 168 bp downstream fragment is flanked with Nhe I at the 5’ side and Cla I at the 3’ end and was cloned between Nhe I and Cla I (pL-Sx-5HTiN3). To insert a selection cassette for use in recombineering and targeting, a linker was made by annealing the following two oligonucleotides: TCGAGCTTAAGGTCGACAGATCTCGATCGGCTAGCC TCGAGGCTAGCCGATCGAGATCTGTCGACCTTAAGC The linker was cloned into the Xho I site of a pTOPO-BluntII-derived, Zeocin-resistant version of pL (pZ-Linker). A 3.6 kb Bam HI fragment containing PGK-EM7-Npt-pA and MC1-HSVtk-pA flanked by FRT sites (FNF) was subcloned from pBS-M179 (a kind gift from Dr. Andrew Smith) into the Bgl II site of pZ-Linker (pZ-FNF), destroying the Bam HI and Bgl II sites. This places an Afl II site on one side and Nhe I site on the other side of the FNF cassette and these are used to subclone into pL-Sx-5HTiN3 to make pL-Sx-5HTiNFNF3. To make the targeting vector, a 7.1 kb Xho I-Cla I fragment from pL-Sx-5HTiNFNF3 was transfected into E. coli containing pSox2-10kb and pSC101-BAD-gbaA to replace the Sox2 stop codon by recombineering. Successful kanamycin-resistant recombinants carrying a 20 kb targeting vector (pSox2AHTiN-FNF-10kb) were amplified at 37°C to restrict pSC101-BAD-gbaA replication and identified by diagnostic Bam HI digest. The targeting construct was linearised, electroporated into E14Tg2a ESCs and G418 resistant colonies expanded and genotyped by southern blot analysis as described below. The FRT-flanked cassette was removed by transiently transfecting pPGK-FlpO into verified E14TG2a-derived Sox2-tdTomato ESC clone 18 (TST18). Overexpression constructs were generated by cloning open reading frames (ORFs) of indicated Sox genes, preceeded upstream by the Kozak consensus sequence (GCCGCCACC), into pPyCAG-IRES-Hyg vector between the XhoI and NotI sites (Chambers et al., 2003).

Southern blot analysis

40 µg of genomic DNA were digested with Eco RI (5’ probe analysis) or with Hind III (3’ and internal probe analysis) and assessed by Southern blot analysis using probes synthesised by PCR from the oligonucleotides indicated in Supplementary file 3.

RNA level quantification

Total RNA was purified from cells using RNeasy mini kits (Qiagen, Germany) following the manufacturer’s protocol. cDNA was prepared from 1 μg of total RNA using SuperScript III reverse transcription kits (Life Technologies, Waltham, USA) according to the recommended protocol and the final cDNA solution was diluted 1:10 prior to use. 2 μl of cDNA solution was used per reaction with the Takyon Sybr Assay (Eurogentec, Belgium). Primers used in this study are listed in Supplementary file 3.

Microarray gene expression analysis

Total RNA (127 ng/sample) from three independently replicated experiments was converted into biotin-labelled cRNA using the Illumina TotalPrep RNA amplification kit (Ambion, Cambridge, USA). Microarray hybridization reactions were performed on a Mouse WG-6v2 BeadChip (Illumina). Raw data were normalised in R using the beadarray (Dunning et al., 2007), limma (Smyth, 2005) and sva (Leek and Storey, 2007) packages from the Bioconductor suite (Gentleman et al., 2004). Briefly, low-quality probes were removed from the input and data were then quantile-normalized. ComBat was used to account for batch effects (Leek and Storey, 2007) between microarrays run at different dates. Differential expression in the log2-transformed data was assessed with the limma algorithms (Smyth, 2005). Probes were considered differentially expressed if they showed a FDR-adjusted p-value of ≤ 0.1 and an absolute log2 fold change ≥ log2(1.5). Primary analysis results were uploaded to GeneProf (Halbritter et al., 2011) and mapped to Ensembl-based reference genes, collapsing multiple probes for the same gene by picking the most responsive probe (i.e., the probe with the highest absolute fold change across all pair-wise comparisons). Data are available in Supplementary file 1. Microarray data have been submitted to the Gene Expression Omnibus (GEO) under accession code GSE99185.

Immunofluorescence staining

Cells were fixed with 4% PFA (10 mins, RT) and permeabilised using PBS/0.1% (v/v) Triton-X100 (PBSTr) for 10 mins, before quenching with 0.5M Glycine/PBSTr (15 mins). Non-specific antigens were blocked using 3% (v/v) donkey serum/1% (v/v) BSA/PBSTr (1 hr, RT) before incubating with primary antibody in blocking solution (4°C, overnight). Cells were washed with PBSTr before incubating with donkey-raised secondary antibodies conjugated with Alexa-488,–568 or −647 in blocking solution (1–2 hr, RT). DAPI (1–2 μg/mL, Molecular Probes) in PBS was added to cells for at least 30 mins before imaged using the Olympus IX51 inverted fluorescent microscope. Primary antibodies used were: α-SOX2 (1:400; Abcam ab92494, UK ), α-NANOG (1:500; eBioscience 14–5761, Cambridge, USA) and α-OCT4 (1:400; Santa Cruz Biotechnology sc8628, Santa Cruz, USA), α-SOX3 antibody (1:400; Abcam ab42471, UK ), α-βIII-tubulin (1:1500; Covance MMS-435P, Princeton, USA ).

Immunoblotting analysis

Cells were lysed with lysis buffer comprising 50 mM Tris pH 8.0, 150 mM NaCl supplemented with fresh 0.5% NP-40, 0.5 mM DTT, 1 × protease inhibitors cocktail (Roche, Switzerland) and 1.3 μl of Benzonase (Novagen, Germany) (1 hr, 4°C). Samples were prepared by boiling 40 μg of total protein extract with Laemmli buffer (Life Technologies, Cambridge, USA) . Samples were analysed using Bolt 10% Bis-Tris +SDS PAGE (Life Technologies, Cambridge, USA) and electroblotted onto 0.2 µm pore Whatman-Protran nitrocellulose membranes (Capitol Scientific, Austin, USA) in transfer buffer comprising 25 mM Tris/0.21M glycine/20% methanol. Membranes were blocked using 5% (w/v) low-fat milk in 0.01% (v/v) Tween-20/PBS (PBSTw) before incubating with primary antibody in blocking solution . Membranes were washed with PBSTw before incubating with donkey-raised secondary antibodies conjugated with IRDye 800CW (1:10000; LI-COR 926–32213, Lincoln, USA) and HRP-conjugated α-βActin (1:10000; Abcam ab20272, UK) antibody. HRP-staining was developed using a Super-signal West Pico kit (Pierce, Cambridge, USA) before imaging the membranes using LI-COR Odyssey Fc imager. The primary antibodies used were: α-Sox2 (1:1000; Abcam ab92494, UK) and α-Nanog (1:2000; Bethyl Laboratories A300-397A, Montgomery, USA).

Embryo manipulation

Mice were maintained on a 12 hr light/dark cycle. All animals were maintained and treated in accordance with guidance from the UK Home Office. Embryonic day (E)0.5 was designated as noon on the day of finding a vaginal plug. Morula aggregations, blastocyst injections and embryo transfer were performed using standard procedures. Chimeric, gastrulation-stage embryos were collected at E7.5 and imaged using an inverted fluorescence microscopy. Chimeric E9.5 embryos were fixed with 4% PFA at 4°C for 3 hr and cryosectioned as described before (Wymeersch et al., 2016). Sections were stained for GFP as described above. In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included. Thank you for submitting your article "Distinct SoxB1 networks are required for naive and primed pluripotency" for consideration by eLife. Your article has been reviewed by two peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Sean Morrison as the Senior Editor. The reviewers have opted to remain anonymous. The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission. Essential revisions: All reviewers agree that the study has been carefully performed and contains some important findings about the role of Sox genes in pluripotency. However, there is much previous work pertinent to the study which is not cited in the manuscript. This omission should be addressed, and the relevant findings discussed in light of the authors' work. You should also discuss the ways in which in vivo findings are at odds with the in vitro findings and why you have confidence that the differences do not simply reflect in vitro artifacts. Specific comments: This aim of this work is to address the role of SOXB1 factors in epiblast stem cell (EpiSC) pluripotency. The authors show that Sox2 can be deleted from EpiSCs without affecting their potential, which is due to functional redundancy with Sox3. This is claimed to be a surprising result, but it is really quite predictable, given the co-expression of the two genes, and that they are known to be functionally equivalent (see for example: https://www.ncbi.nlm.nih.gov/pubmed/28515211;https://www.ncbi.nlm.nih.gov/pubmed/10446282), with Sox3 at slightly higher levels and slightly more extensively expressed than Sox2. Indeed, compared to the mouse, the two genes have swapped prominence in the chick embryo, with Sox3 preceding Sox2, and with both acting in the same way antagonistically to Snail, in helping to promote ectoderm/neurectoderm development during gastrulation (https://www.ncbi.nlm.nih.gov/pubmed/21920318). The authors show that Sox3 can also be deleted from EpiSCs without eliminating self-renewal. Again, this is not surprising, given that Sox3 null mutant mice are viable (https://www.ncbi.nlm.nih.gov/pubmed/14981518; https://www.ncbi.nlm.nih.gov/pubmed/17728342; https://www.ncbi.nlm.nih.gov/pubmed/28515211). Deletion of both Sox2 and Sox3 was found to prevent self-renewal of EpiSCs. This is again not surprising, but it is probably worth showing. The authors also found that differentiation of Sox2 heterozygous ESCs is compromised, although this would seem not to be very important in vivo, given that such cells can make germ line chimeras after blastocyst injection and that both Sox2 heterozygous mice and humans are viable (although with a range of more or less severe defects) [many papers]. The authors also show that increased SOXB1 levels divert the ESC to EpiSC transition towards neural differentiation. Putting all their findings together, they claim that optimal SOXB1 levels are critical for each pluripotent state and for cell fate decisions during exit from naïve pluripotency. While I have few if any problems with the way the experiments have been conducted, indeed some approaches are clever, such as the indel analysis after CRISPR/Cas9 NHEJ mutagenesis, the authors seem to disregard much published data including all that on the effects of mutations in Sox2, Sox3 (and Sox1) in vivo, where there is extensive data both in mice and humans. Several of the in vivo findings are at odds with the claims being made here for the role of Soxb1 genes in ESCs and EpiSCs in vitro. This begs the question as to the relevance of this current work. If the authors had gone on to define the downstream genes required for neurectoderm, etc., fate, or the mechanisms involved in crosstalk or feedback regulation between Sox2 and Sox3, then this would be important. But as it is, I worry that they are mostly chasing some in vitro artifacts. Other comments: It is usual convention to write protein symbols as all uppercase letters (both mouse and human proteins). Introduction, third paragraph: Where is the evidence for 23 SOX proteins in mammals? It is usually accepted that there are 20. Subsection “A subset of SOX family proteins can functionally replace Sox2 in ESC self-renewal”, first paragraph and Figure 2: Sox15 was already known to be able to substitute for Sox2 in pluripotency. https://www.ncbi.nlm.nih.gov/pubmed/27582319 Subsection “Sox3 is dispensable for pluripotent cell self-renewal”, first paragraph and Figure 3—figure supplement 1: The level of Sox3 in undifferentiated ES cells is extremely low – but it is readily activated by retinoic acid and other ligands. "These findings indicate that Sox3 is dispensable for ESC self-renewal." This was also known from previous work from others where Sox3 null mutant ESCs have been generated (gene targeting via homologous recombination) and the generation of mice from these (https://www.ncbi.nlm.nih.gov/pubmed/14981518;https://www.ncbi.nlm.nih.gov/pubmed/14585968). "These data demonstrate that both naïve and primed pluripotent cells can self-renew in the absence of Sox3." Again, this is not surprising given the viability of Sox3 null mice. Subsection “Sox2 is dispensable for the maintenance of primed pluripotency”, last paragraph: Sox3 mRNA levels were found to be elevated in in Sox2-/- EpiSCs compared to controls. Again, this has been seen before in the developing brain in vivo (https://www.ncbi.nlm.nih.gov/pubmed/18638478). "These data indicate that a Sox2 level above that present in Sox2ESCs is required to enable neural differentiation and suggest that below this SOX2 concentration cells are directed towards non-neural differentiation via an early post-implantation identity (Figure 6A)." This does not make sense since Sox2+/- mice (and humans) do have a CNS, although with some abnormalities. Is the Sox2 allele hypomorphic? "While Sox2ESCs do not effectively undergo neural differentiation (Figure 6), quantitative transcript analysis shows that deletion of Sox3 from Sox2ESCs is sufficient to rescue the neural differentiation of the cells.." I don't understand this. And again, it doesn't relate very well to the in vivo situation. – "In the future, it will also be interesting to determine the extent to which SoxB1 proteins can substitute for Sox2 function in vivo." Some such combinations have already been carried out:https://www.ncbi.nlm.nih.gov/pubmed/15882093https://www.ncbi.nlm.nih.gov/pubmed/28515211 Discussion, fourth paragraph: This paper, which also shows co-expression and some functional redundancy of Sox2 and Sox3, should perhaps also be cited in relevant places: https://www.ncbi.nlm.nih.gov/pubmed/12514105 Essential revisions: All reviewers agree that the study has been carefully performed and contains some important findings about the role of Sox genes in pluripotency. However, there is much previous work pertinent to the study which is not cited in the manuscript. This omission should be addressed, and the relevant findings discussed in light of the authors' work. You should also discuss the ways in which in vivo findings are at odds with the in vitro findings and why you have confidence that the differences do not simply reflect in vitro artifacts. We are pleased that our reviewers agree that our work has been carefully conducted and has produced important results about the function of Sox genes in pluripotency. We acknowledge that we omitted discussion of several important and relevant previous publications and are grateful to the reviewers for drawing our attention to these omissions. As a consequence, we have considerably redrafted our Discussion to include this published work in the context of our findings. Moreover, in response to our reviewers prompting, we have now performed additional experiments that we think resolve the apparent discrepancy between published in vivo studies and our in vitro work. We believe our current manuscript has been significantly improved in response to our reviewers’ request and we hope that it is now considered suitable for publication. Specific comments: This aim of this work is to address the role of SOXB1 factors in epiblast stem cell (EpiSC) pluripotency. The authors show that Sox2 can be deleted from EpiSCs without affecting their potential, which is due to functional redundancy with Sox3. This is claimed to be a surprising result, but it is really quite predictable, given the co-expression of the two genes, and that they are known to be functionally equivalent (see for example: https://www.ncbi.nlm.nih.gov/pubmed/28515211;https://www.ncbi.nlm.nih.gov/pubmed/10446282), with Sox3 at slightly higher levels and slightly more extensively expressed than Sox2. We are grateful to the reviewer for pointing us to the Adikusuma et al. paper, an elegant study published while our manuscript was under review, which shows that knock-in of Sox2 to the Sox3 locus can rescue pituitary and testis defects of the Sox3 knockout. We refer to this work as indicated below (Introduction, last paragraph and subsection “SOXB1 redundancy in vivo”). The second paper referred to above is Wood and Episkopou, a classic RNA in situ hybridisation study that we have cited in our manuscript and that shows overlapping Sox2 and Sox3 expression domains in the post-implantation epiblast. We accept the reviewer’s point that these overlapping expression domains, together with other studies referred to later by the reviewer are sufficient to suggest our findings are unsurprising. Therefore, we have deleted the relevant instances of ‘surprising’ from our manuscript and reframed our discussion in light of the papers that the reviewer has kindly brought to our attention. However, neither of the studies above, nor any of the studies that the reviewer refers to below have tested the functional redundancy of Sox2 and Sox3 in postimplantation pluripotency and therefore our results are novel. We have reserved the use of the word ‘surprising’ in the revised manuscript for the unexpected up-regulation of Sox2 mRNA upon deletion of Sox3, rescuing neural differentiation of Sox2+/- cells and indicating a novel cross-regulatory relationship between the SoxB genes (subsection “Modulating SOXB1 levels affects differentiation and can prevent capture of primed pluripotency, fifth paragraph and subsection “Low SoxB1 levels permit entry to the EpiSC state”). Indeed, compared to the mouse, the two genes have swapped prominence in the chick embryo, with Sox3 preceding Sox2, and with both acting in the same way antagonistically to Snail, in helping to promote ectoderm/neurectoderm development during gastrulation (https://www.ncbi.nlm.nih.gov/pubmed/21920318). We agree this is relevant background and have included a reference to the Acloque paper in the Discussion, ‘in the chick, Sox2 and Sox3 both promote development of ectoderm and neurectoderm at gastrulation, although interestingly, in this case Sox3 expression occurs before Sox2 (Acloque et al.).’ The authors show that Sox3 can also be deleted from EpiSCs without eliminating self-renewal. Again, this is not surprising, given that Sox3 null mutant mice are viable (https://www.ncbi.nlm.nih.gov/pubmed/14981518; https://www.ncbi.nlm.nih.gov/pubmed/17728342; https://www.ncbi.nlm.nih.gov/pubmed/28515211). The papers referred to are Rizzoti et al. (shows Sox3 is required for pituitary function), Rizzoti & Lovell-Badge (shows that Sox3 is required for correct craniofacial morphogenesis) and Adikusuma et al. (knock-in of Sox2 to the Sox3 locus referred to above). While each of these papers indicates that Sox3-null mice can be viable and that therefore there may not be an essential requirement for Sox3 in the epiblast, there are suggestions that things may not be so simple. Rizzotti et al. (2004) state as an unpublished observation that there is early gastrulation lethality of Sox3 on 129 genetic background and that a viable phenotype was only observed in conditional nulls on an outbred background. Adikusuma et al. also report failure to generate Sox3Sox2KI mice from targeted clones via conventional gene targeting in ES cells, followed by blastocyst injection of these cells. Subsequently, Adikusuma et al. obtained the Sox3 allele using a CRISPR/Cas9 strategy via pronuclear injection of C57Bl/6 zygotes. The failure of two independent groups to establish mice from knock-out Sox3 on a 129 background points to a requirement for Sox3 that goes beyond the reported viability on an outbred background. We have shown that Sox3 contributes to the total SoxB1 levels required for postimplantation pluripotency (Figure 5). This suggests that subtle strain-specific variations in Sox2 levels/timing in postimplantation embryos may exist, which permit maintenance of Sox3 KO ES cells but not embryos. Deletion of both Sox2 and Sox3 was found to prevent self-renewal of EpiSCs. This is again not surprising, but it is probably worth showing. We agree that despite other reports of tissues where Sox2 and Sox3 are redundant, our finding that Sox2 and Sox3 act redundantly in EpiSC self-renewal is worthwhile, especially as it highlights a distinct post-implantation-specific functional PGRN. Moreover, our results point to a model wherein both genes contribute to maintain threshold SoxB1 levels required for postimplantation pluripotency – as alluded to by Avilion et al. This information is contained in the updated model (Figure 9). The authors also found that differentiation of Sox2 heterozygous ESCs is compromised, although this would seem not to be very important in vivo, given that such cells can make germ line chimeras after blastocyst injection and that both Sox2 heterozygous mice and humans are viable (although with a range of more or less severe defects) [many papers]. The authors also show that increased SOXB1 levels divert the ESC to EpiSC transition towards neural differentiation. Putting all their findings together, they claim that optimal SOXB1 levels are critical for each pluripotent state and for cell fate decisions during exit from naïve pluripotency. While I have few if any problems with the way the experiments have been conducted, indeed some approaches are clever, such as the indel analysis after CRISPR/Cas9 NHEJ mutagenesis, the authors seem to disregard much published data including all that on the effects of mutations in Sox2, Sox3 (and Sox1) in vivo, where there is extensive data both in mice and humans. Several of the in vivo findings are at odds with the claims being made here for the role of Soxb1 genes in ESCs and EpiSCs in vitro. This begs the question as to the relevance of this current work. If the authors had gone on to define the downstream genes required for neurectoderm, etc., fate, or the mechanisms involved in crosstalk or feedback regulation between Sox2 and Sox3, then this would be important. But as it is, I worry that they are mostly chasing some in vitro artifacts. We apologise for omitting important in vivo studies in our previous manuscript. We have taken on board the reviewers’ suggestions and have now discussed previous in vivo findings in relation to our results (we have indicated these in response to detailed points elsewhere in this document). To address whether we were indeed chasing an artefactual inability of SCKO to undergo neural differentiation, we independently generated Sox2+/- ESCs using CRISPR. Two new Sox2+/- ESC clones derived independently using two different sgRNAs confirmed our findings that mutation of a Sox2 allele in ESCs causes a defect in neural differentiation (Figure 7, Figure 7—figure supplement 1). Whether this was due to Sox2 protein level being insufficient to drive neural differentiation remained an open question that we have addressed as outlined below. in vitro findings can highlight cellular requirements that are difficult to unpick in vivo. A key difference between in vitro and in vivo experiments is the ability to control the extracellular environment. Through in vitro studies using inhibitors of BMP and Nodal signalling, we have uncovered endogenous BMP and Nodal signalling in Sox2 heterozygous cells that block neural differentiation (Figure 7). This establishes that the inability of Sox2+/- ESCs to undergo neural differentiation is not an intrinsic cellular defect, but is due to an anti-neural environment. In the embryo, such an environment exists in the anterior epiblast and does not depend on Sox2. We believe these experiments resolve the apparent discrepancy between our findings and the ability of Sox2+/- mice to develop brains. Other comments: It is usual convention to write protein symbols as all uppercase letters (both mouse and human proteins). We have corrected the text so that all reference to proteins is uppercase. Introduction, third paragraph: Where is the evidence for 23 SOX proteins in mammals? It is usually accepted that there are 20. We apologise for this error, which has been corrected (Introduction, third paragraph). Subsection “A subset of SOX family proteins can functionally replace Sox2 in ESC self-renewal”, first paragraph and Figure 2: Sox15 was already known to be able to substitute for Sox2 in pluripotency. https://www.ncbi.nlm.nih.gov/pubmed/27582319 We have cited the Niwa et al. study but have added a further citation to this work relevant to SOX15 (subsection “A subset of SOX family proteins can functionally replace Sox2 in ESC self-renewal”, first paragraph). Subsection “Sox3 is dispensable for pluripotent cell self-renewal”, first paragraph and Figure 3—figure supplement 1: The level of Sox3 in undifferentiated ES cells is extremely low – but it is readily activated by retinoic acid and other ligands. We have amended the text (subsection “Sox3 is dispensable for both naïve and primed pluripotency”, first paragraph) to draw attention to the low Sox3 expression level observed in ESCs and to our intention to document whether this was required for ESC self-renewal. "These findings indicate that Sox3 is dispensable for ESC self-renewal." This was also known from previous work from others where Sox3 null mutant ESCs have been generated (gene targeting via homologous recombination) and the generation of mice from these (https://www.ncbi.nlm.nih.gov/pubmed/14981518;https://www.ncbi.nlm.nih.gov/pubmed/14585968). The papers referred to above are Rizzoti et al. and Weiss et al. Both papers document the existence of ESCs carrying loxP-flanked Sox3 alleles but do not document deletion of either of these loxP-flanked Sox3 alleles in ESCs. Rizzoti et al. do refer to unpublished data in which a null mutation in Sox3 was targeted to the Sox3 allele in XY male ESCs. We have therefore amended our text to reflect this (“These findings indicate that Sox3 is dispensable for ESC self-renewal, confirming previously reported unpublished data (Rizzoti et al)”). "These data demonstrate that both naïve and primed pluripotent cells can self-renew in the absence of Sox3." Again, this is not surprising given the viability of Sox3 null mice. The reviewer raises an interesting point. Rizzoti et al. state that “To study the role of Sox3, we targeted null mutations in the gene into XY embryonic stem (ES) cells, but injection of these cells into blastocysts resulted in early lethality of the chimeras due to a gastrulation defect (unpublished data).” The authors circumvented this problem by generating a loxP-flanked Sox3 allele and testing the effects of Sox3 deletion in an outbred background. Rizzoti et al.’s unpublished data suggests in fact that Sox3 may in fact be required in postimplantation pluripotent cells in specific genetic backgrounds (in this case, 129sv/ev). Interestingly, genetic background effects do modulate the severity of Sox3 phenotypes since Sox3-null mice have a more severe pituitary phenotype on a C57Bl/6 background (Adikusuma et al.) than on an MF1 background (Rizzoti et al.) We discussed the points raised by these papers in the Discussion (subsection “SOXB1 redundancy in vivo”). Subsection “Sox2 is dispensable for the maintenance of primed pluripotency”, last paragraph: Sox3 mRNA levels were found to be elevated in in Sox2-/- EpiSCs compared to controls. Again, this has been seen before in the developing brain in vivo (https://www.ncbi.nlm.nih.gov/pubmed/18638478). This paper by Miyagi et al. shows that Sox3 mRNA is increased in Sox2-null E14.5 brain, suggesting that functional compensation between Sox2 and Sox3 occurs in neural stem cells. We have included citation of the work of Miyagi et al. and have amended the text accordingly (subsection “Sox2 is dispensable for the maintenance of primed pluripotency”, last paragraph). "These data indicate that a Sox2 level above that present in Sox2fl/- ESCs is required to enable neural differentiation and suggest that below this SOX2 concentration cells are directed towards non-neural differentiation via an early post-implantation identity (Figure 6A)." This does not make sense since Sox2+/- mice (and humans) do have a CNS, although with some abnormalities. We agree with the reviewers’ comment and have amended the text (subsection “Modulating SOXB1 levels affects differentiation and can prevent capture of primed pluripotency”, second paragraph) to underline that our findings are referring to the differentiation potential of ESCs in vitro, and that this does not exclude compensation mechanisms in vivo. As mentioned above, we have now investigated the neural differentiation phenotype further and believe we can suggest an explanation for this discrepancy based on their increased BMP/Nodal signalling activity. Is the Sox2fl allele hypomorphic? mRNA and protein expression analysis in this (Figure 3—figure supplement 1, Figure 4, Figure 8) and previous studies (Gagliardi et al. 2013) suggests that Sox2+/- cells express about 50-60% of the Sox2 mRNA/protein levels found in WT cells. The validation of the neural differentiation defect of Sox2+/- ESCs using ESC clones derived by introducing small deletions in the Sox2 CDS by CRISPR indicates that this defect is not peculiar to the SCKO ESC line. "While Sox2fl/- ESCs do not effectively undergo neural differentiation (Figure 6), quantitative transcript analysis shows that deletion of Sox3 from Sox2fl/- ESCs is sufficient to rescue the neural differentiation of the cells.." I don't understand this. And again, it doesn't relate very well to the in vivo situation. We have dealt with the apparent differences between the Sox2 heterozygote phenotype in vitro and in vivo above. To clarify the statement, we have added text (subsection “Modulating SOXB1 levels affects differentiation and can prevent capture of primed pluripotency”). This indicates that removal of Sox3 from Sox2ESCs increases Sox2 expression to wild-type levels, and Sox1 expression to 10x the wild-type level. This could explain why Sox2Sox3null ESCs can differentiate into neurons. This effect is rather surprising given the low expression level of Sox3 relative to Sox2 in ESCs. This suggests that small alterations in feedback between SoxB1 genes may be sufficient to rescue neural differentiation. "In the future, it will also be interesting to determine the extent to which SoxB1 proteins can substitute for Sox2 function in vivo." Some such combinations have already been carried out: https://www.ncbi.nlm.nih.gov/pubmed/15882093https://www.ncbi.nlm.nih.gov/pubmed/28515211 These papers refer to a Sox1knock-in at Sox2 (Ekonomou et al.) and the Sox2 knock-in at Sox3 mentioned earlier (Adikusuma et al.). We have discussed these findings in the “Discussion” section “SOXB1 redundancy in vivo”, ending with a modified version of the sentence above; “Further studies will be required to establish the extent to which SOXB1 proteins can substitute genetically for one another in pluripotent cells in vivo.” Discussion, fourth paragraph: This paper, which also shows co-expression and some functional redundancy of Sox2 and Sox3, should perhaps also be cited in relevant places: https://www.ncbi.nlm.nih.gov/pubmed/12514105 This paper by Avilion et al. is the seminal Sox2 deletion study. In this paper the authors discuss the Sox2 phenotype in relationship to expression of Sox2 and Sox3 and hypothesise that the failure of Sox2-null embryos early in development is due to the fact that no other SoxB1 gene is active as early. This is hypothesized to be a general point that SoxB1 phenotypes occur in cells where the particular SoxB1 gene mutated is the sole expressed member of the SoxB1 group. These are important ideas and we have now properly referred to them in our manuscript.
  78 in total

1.  Crystal structure of a POU/HMG/DNA ternary complex suggests differential assembly of Oct4 and Sox2 on two enhancers.

Authors:  Attila Reményi; Katharina Lins; L Johan Nissen; Rolland Reinbold; Hans R Schöler; Matthias Wilmanns
Journal:  Genes Dev       Date:  2003-08-15       Impact factor: 11.361

2.  GeneProf: analysis of high-throughput sequencing experiments.

Authors:  Florian Halbritter; Harsh J Vaidya; Simon R Tomlinson
Journal:  Nat Methods       Date:  2011-12-28       Impact factor: 28.547

Review 3.  B1 and B2 Sox gene expression during neural plate development in chicken and mouse embryos: universal versus species-dependent features.

Authors:  Masanori Uchikawa; Megumi Yoshida; Makiko Iwafuchi-Doi; Kazunari Matsuda; Yoshiko Ishida; Tatsuya Takemoto; Hisato Kondoh
Journal:  Dev Growth Differ       Date:  2011-07-18       Impact factor: 2.053

4.  The organizer factors Chordin and Noggin are required for mouse forebrain development.

Authors:  D Bachiller; J Klingensmith; C Kemp; J A Belo; R M Anderson; S R May; J A McMahon; A P McMahon; R M Harland; J Rossant; E M De Robertis
Journal:  Nature       Date:  2000-02-10       Impact factor: 49.962

5.  Inhibition of pluripotential embryonic stem cell differentiation by purified polypeptides.

Authors:  A G Smith; J K Heath; D D Donaldson; G G Wong; J Moreau; M Stahl; D Rogers
Journal:  Nature       Date:  1988-12-15       Impact factor: 49.962

6.  Octamer and Sox elements are required for transcriptional cis regulation of Nanog gene expression.

Authors:  Takao Kuroda; Masako Tada; Hiroshi Kubota; Hironobu Kimura; Shin-ya Hatano; Hirofumi Suemori; Norio Nakatsuji; Takashi Tada
Journal:  Mol Cell Biol       Date:  2005-03       Impact factor: 4.272

7.  Generation of induced pluripotent stem cells without Myc from mouse and human fibroblasts.

Authors:  Masato Nakagawa; Michiyo Koyanagi; Koji Tanabe; Kazutoshi Takahashi; Tomoko Ichisaka; Takashi Aoi; Keisuke Okita; Yuji Mochiduki; Nanako Takizawa; Shinya Yamanaka
Journal:  Nat Biotechnol       Date:  2007-11-30       Impact factor: 54.908

8.  Comparative expression of the mouse Sox1, Sox2 and Sox3 genes from pre-gastrulation to early somite stages.

Authors:  H B Wood; V Episkopou
Journal:  Mech Dev       Date:  1999-08       Impact factor: 1.882

9.  A direct physical interaction between Nanog and Sox2 regulates embryonic stem cell self-renewal.

Authors:  Alessia Gagliardi; Nicholas P Mullin; Zi Ying Tan; Douglas Colby; Anastasia I Kousa; Florian Halbritter; Jason T Weiss; Anastasia Felker; Karel Bezstarosti; Rebecca Favaro; Jeroen Demmers; Silvia K Nicolis; Simon R Tomlinson; Raymond A Poot; Ian Chambers
Journal:  EMBO J       Date:  2013-07-26       Impact factor: 11.598

10.  Multipotent cell lineages in early mouse development depend on SOX2 function.

Authors:  Ariel A Avilion; Silvia K Nicolis; Larysa H Pevny; Lidia Perez; Nigel Vivian; Robin Lovell-Badge
Journal:  Genes Dev       Date:  2003-01-01       Impact factor: 11.361

View more
  6 in total

1.  An epiblast stem cell-derived multipotent progenitor population for axial extension.

Authors:  Shlomit Edri; Penny Hayward; Peter Baillie-Johnson; Benjamin J Steventon; Alfonso Martinez Arias
Journal:  Development       Date:  2019-05-20       Impact factor: 6.868

2.  Sox2 modulation increases naïve pluripotency plasticity.

Authors:  Kathryn C Tremble; Giuliano G Stirparo; Lawrence E Bates; Katsiaryna Maskalenka; Hannah T Stuart; Kenneth Jones; Amanda Andersson-Rolf; Aliaksandra Radzisheuskaya; Bon-Kyoung Koo; Paul Bertone; José C R Silva
Journal:  iScience       Date:  2021-02-06

3.  Mosaic cis-regulatory evolution drives transcriptional partitioning of HERVH endogenous retrovirus in the human embryo.

Authors:  Thomas A Carter; Manvendra Singh; Gabrijela Dumbović; Jason D Chobirko; John L Rinn; Cédric Feschotte
Journal:  Elife       Date:  2022-02-18       Impact factor: 8.140

4.  Sox2 levels regulate the chromatin occupancy of WNT mediators in epiblast progenitors responsible for vertebrate body formation.

Authors:  Robert Blassberg; Harshil Patel; Thomas Watson; Mina Gouti; Vicki Metzis; M Joaquina Delás; James Briscoe
Journal:  Nat Cell Biol       Date:  2022-05-12       Impact factor: 28.213

5.  Functional Dissection of the Enhancer Repertoire in Human Embryonic Stem Cells.

Authors:  Tahsin Stefan Barakat; Florian Halbritter; Man Zhang; André F Rendeiro; Elena Perenthaler; Christoph Bock; Ian Chambers
Journal:  Cell Stem Cell       Date:  2018-07-19       Impact factor: 24.633

6.  Dynamic regulation of chromatin accessibility by pluripotency transcription factors across the cell cycle.

Authors:  Elias T Friman; Cédric Deluz; Antonio Ca Meireles-Filho; Subashika Govindan; Vincent Gardeux; Bart Deplancke; David M Suter
Journal:  Elife       Date:  2019-12-03       Impact factor: 8.140

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.