Literature DB >> 29251324

MicroRNA-505 is downregulated in human osteosarcoma and regulates cell proliferation, migration and invasion.

Yu-Jiang Liu1, Wei Li1, Feng Chang1, Jian-Na Liu1, Jun-Xin Lin2, De-Xi Chen1.   

Abstract

Recent studies have demonstrated that microRNAs (miRNAs/miRs) are involved in osteosarcoma tumorigenesis, progression, invasion and metastasis. For example, miR-505 plays important roles in human carcinogenesis; however, its exact function in osteosarcoma remains unclear. MicroRNA profiles of osteosarcoma and normal tissues were obtained by miRNA microarray assays, which were validated by quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR). Then, high-mobility group box 1 (HMGB1) expression was evaluated by qRT-PCR and western blot analysis. The correlation between miR-505 and HMGB1 was analyzed by Pearson correlation. In vitro, the biological functions of miR-505 were examined by wound healing, MTT and Transwell assays and western blot analysis in MG63 cells transfected with miRNA mimics or empty vector. Luciferase assay was utilized to assess whether HMGB1 is a target of miR-505. miRNA microarrays revealed 26 aberrant miRNAs in osteosarcoma tissues; miR-505 showed the most pronounced decrease (P<0.01), which was significantly associated with TNM stage and metastasis status (P<0.05). In addition, HMGB1 was highly expressed in osteosarcoma tissues (P<0.01), with a significantly negative correlation with miR-505 (r=-0.6679, P<0.001). Furthermore, miR-505 inhibited proliferation, migration and invasion abilities of MG63 cells (P<0.01). Moreover, luciferase activity of the HMGB1-3'-UTR plasmid was suppressed following miR-505 binding (P<0.01). Finally, HMGB1 overexpression partly reversed the effects of miR-505 on MG63 cells. In conclusion, miR-505 levels are decreased in osteosarcoma tissues, and reduced miR-505 expression is significantly associated with poorer clinical prognosis in patients with osteosarcomas. miR-505 inhibits osteosarcoma cell proliferation, migration and invasion by regulating HMGB1.

Entities:  

Mesh:

Substances:

Year:  2017        PMID: 29251324      PMCID: PMC5783616          DOI: 10.3892/or.2017.6142

Source DB:  PubMed          Journal:  Oncol Rep        ISSN: 1021-335X            Impact factor:   3.906


Introduction

Primary bone cancers are extremely rare neoplasms, accounting for less than 0.2% of all cancers. In 2015, 2,970 patients were newly diagnosed with bone and joint cancer in the United States, with 1,490 deaths from the disease (1). Osteosarcoma is the most common primary malignant bone tumor in children and young adults. The median age of patients with osteosarcoma is 20 years (2). Patients always seek medical attention following symptoms of pain and swelling. Unfortunately, approximately 10–20% of cases present with metastatic disease at diagnosis (3). What is more, ~30% of patients with localized disease and 80% of those presenting with metastatic disease will experience relapse (4). Thus, it is critical to develop new strategies to treat recurrent and/or metastatic osteosarcomas. Recently, several studies have focused on the impact of microRNAs (miRNAs/miRs) on tumor initiation and progression. miRNAs are short non-coding RNAs that regulate the expression of target mRNAs by binding to their 3′ untranslated regions (UTRs), causing degradation or translation inhibition (5,6). Indeed, specific miRNAs contribute to tumor growth, progression, metastasis and drug resistance in osteosarcoma (7–10). For example, miR-505 was reported to be involved in many cancer types (11–13); however, its exact role in osteosarcoma remains unknown. The present study, therefore, aimed to assess the role of miR-505 in osteosarcoma, exploring its biological functions in osteosarcoma cells. Direct targets of miR-505 were searched for at microRNA.org and using Diana Tools, and high miTG (0.982) and mirSVR (−2.98) scores were found for high mobility group box 1 (HMGB1). HMGB1 is a transcription factor that outside the cell acts as a potent pro-inflammatory cytokine in the immune response (14). It was also found in culture supernatants of numerous osteoblast preparations as well as isolated osteoclast precursors and osteoclasts (15). HMGB1 expression is associated with cancer development by interfering with several signaling pathways (16). Thus, we hypothesized HMGB1 to be a candidate target of miR-505, and assessed whether this miR could modulate HMGB1 expression in osteosarcoma cells. In the present study, miRNA expression profiles in osteosarcoma and adjacent normal tissue specimens were compared, and a subset of deregulated miRNAs were identified. Specifically, miR-505 was revealed as a candidate oncogenic miRNA in osteosarcoma, showing a significant decrease. Further experiments demonstrated that the reduced miR-505 level is associated with poorer clinical prognosis in patients with osteosarcomas. In addition, miR-505 overexpression resulted in reduced cell growth, migration and invasion. More importantly, HMGB1 was confirmed as a direct target gene for miR-505 in osteosarcoma.

Materials and methods

Patients and tissue specimens

A total of 37 freshly frozen osteosarcoma tumor and adjacent normal tissue specimens were obtained by resection or biopsy from 2013 to 2014 at the Department of Orthopedics, Qilu Hospital of Shandong University. None of the patients had received any treatment prior to surgery. All specimens were snap-frozen in liquid nitrogen within 2 h and stored at −80°C for further analysis. Inclusion criteria were: diagnosis as osteosarcoma confirmed by light microscopy and immunohistochemistry; complete clinical and pathological data available. Exclusion criteria were: family history of cancer; other chronic system disease; unwillingness to participate in the present study. Written informed consent was provided by all patients. The study was approved by the Ethics Committee of Qilu Hospital of Shandong University.

MicroRNA microarray and RT-PCR

A total of 5 paired tumor and adjacent normal tissue specimens were randomly selected. Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and miRNeasy Mini kit (Qiagen, Valencia, CA, USA) according to the manufacturers instructions. Samples with RNA integrity number (RIN) >8 were processed for hybridization. Total RNA was labeled using the miRCURY™ Array Power labeling kit (Exiqon, Copenhagen, Denmark) and hybridized to the miRNA microarray using miRCURY™ LNA Array (Exiqon). Scanned images were then imported into the GeenPix 4000B software (Axon Instruments, Sunnyvale, CA, USA). The SpotData Pro software was used for data analysis. Hierarchical clustering was performed using Data Matching Software. Quantitative real-time polymerase chain reaction (qRT-PCR) was used to validate microarray data. First strand cDNA was synthesized using TaqMan MicroRNA Reverse Transcription kit with the stem-loop RT primer. Amplification was performed using Power SYBR-Green PCR Master Mix in triplicate, on Roche LightCycler 480 Real-Time PCR System with the following conditions: 2 min of initial denaturation at 95°C, and 40 cycles at 94°C (15 sec), 60°C (60 sec) and 72°C (30 sec). Relative miRNA and mRNA expression levels were determined using the 2−ΔΔCt method and normalized to U6. To assess HMGB1 mRNA levels, qRT-PCR was performed with SYBR-Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA) according to the manufacturers instructions; GAPDH was used as an endogenous control. The primers used for qRT-PCR are shown in Table I.
Table I.

The TaqMan stem-loop primers for reverse transcription PCR and the forward and reverse primers for real-time PCR.

AccessionIDSequence
MIMAT0000267hsa-miR-210SequenceCUGUGCGUGUGACAGCGGCUGA
TaqMan primerGTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACTCAGCC
PCR-FCTGTGCGTGTGACAGC
MIMAT0000758hsa-miR-135bSequenceUAUGGCUUUUCAUUCCUAUGUGA
TaqMan primerGTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACTCACAT
PCR-FTATGGCTTGTCATTCCT
MIMAT0002876hsa-miR-505SequenceCGUCAACACUUGCUGGUUUCCU
TaqMan primerGTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACAGGAAA
PCR-FCGTCAACACTTGCTGG
MIMAT0000069hsa-miR-16SequenceUAGCAGCACGUAAAUAUUGGCG
TaqMan primerGTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACCGCCAA
PCR-FGGGTAGCAGCACGTAAATAT
U6PCR-FGCTCGCTTCGGCAGCACA
PCR-RAACGCTTCACGAATTTGCGT
GAPDHPCR-FACCCAGAAGACTGTGGATGG
PCR-RCAGTGAGCTTCCCGTTCAG
HMGB1PCR-FCTTCTTGAGGGGAAGCTAGT
PCR-RTTTTGGATGTTCAGTTATGG

Cell culture and treatment

The human osteosarcoma cell lines U2-OS, MG63, HOS and SAOS-2, as well as the normal osteoblastic cell line hFOB 1.19 were purchased from the American Type Culture Collection (ATCC; Manassas, VA, USA). hFOB 1.19 cells were cultured in Dulbeccos modified Eagles medium (DMEM)/F-12 (1:1; Invitrogen) and osteosarcoma cells in osteoblast growth medium (Invitrogen). All cells were maintained at 37°C in a humidified incubator with 5% CO2 in media supplemented with 10% fetal bovine serum (FBS; Invitrogen), 1% of 100 U/ml penicillin and streptomycin (Invitrogen) and 2 mM glutamine. The miR-505 mimic and mimics negative control (miR-NC) were obtained from Guangzhou RiboBio, Co., Ltd. (Guangzhou, China). Cells were transfected with 30 nM miR-505 mimics or miR-NC using Lipofectamine 2000 reagent (Invitrogen) according to the manufacturers instructions. Overexpression of HMGB1 was achieved using the pcDNA3.1/HMGB1 transfection and the pcDNA3.1/CAT (vector) was used as its negative control.

MTT assay

Cells (1×104/well) were seeded into 96-well plates and incubated for 24, 48, 72 and 96 h, respectively. Then, 20 µl of 5 mg/ml MTT reagent (Sigma-Aldrich, St. Louis, MO, USA) in phosphate-buffered saline (PBS) was added to each well and incubated for 4 h. Subsequently, 150 µl of dimethyl sulfoxide (DMSO; Sigma-Aldrich) was added to dissolve the precipitates. Absorbance was measured at 450 nm on a microplate reader (Multiskan; Thermo Fisher Scientific, Waltham, MA, USA). A growth curve was generated with time and absorbance on the horizontal and vertical axes, respectively.

Cell migration assay

MG63 cells were transfected with miR-505 mimics or miR-NC as well as pcDNA3.1/HMGB1 or pcDNA3.1/CAT, following the manufacturers instructions. After transfection, a sterile pipette tip was used to scratch the cell layer at ~90% confluency. After washing with PBS three times, the cells were further incubated at 37°C for 24 h. Micrographs were acquired on an inverted microscope at 0 and 24 h, respectively, after wounding.

Invasion assay

Transfected cells were seeded onto Transwell 24-well plates coated with diluted Matrigel, with serum-free media containing 5% FBS used as a chemoattractant. After 24 h of incubation, the medium was removed, and chambers were washed twice with PBS. The cells on the upper side of the inserts were softly scraped; those migrated to the lower surface were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet. Microphotographs were obtained on an immunofluorescence microscope (Olympus BX53; Olympus, Tokyo, Japan) at ×200 magnification.

Western blot analysis

Total protein was extracted from cells with 1% RIPA lysis buffer (Beyotime Institute of Biotechnology, Haimen, China); protein quantitation was carried out by the BCA method. Equal amounts of protein (30 µg) were separated by SDS-PAGE and transferred onto PVDF membranes. After blocking, the samples were incubated with relevant antibodies, including anti-HMGB1 (cat. no. ab79823, 1:1,000; Abcam, Cambridge, MA, USA), anti-MMP2 (cat. no. 40994, 1:1,000; Cell Signaling Technology, Danvers, MA, USA), anti-MMP9 (cat. no. 13667, 1:1,000; Cell Signaling Technology) anti-cyclin D1 (1 µg/ml; cat. no. AF4196; R&D Systems, Minneapolis, MN, USA) and anti-GAPDH (cat. no. GTX100118, 1:5,000; GeneTex, Inc., Irvine, CA, USA), overnight at 4°C. This was followed by incubation with HRP-labeled goat anti-rabbit or anti-rat IgG (H+L) (1:5,000; Beyotime Institute of Biotechnology) for 60 min at room temperature. Immunodetection was performed by enhanced chemiluminescence (ECL Plus kit; Beyotime Institute of Biotechnology) and visualized on a G:Box Chemi imaging system (Syngene, Cambridge, UK).

Luciferase reporter assay

The 3′-UTR fragment of HMGB1, predicted to be the miRNA binding site, was synthesized and inserted into the XbaI and FseI sites of the pGL3 control vector (Promega, Madison, WI, USA) to generate a HMGB1-Wt luciferase reporter. Mutation of the binding site was introduced by site-directed mutagenesis (Promega), to yield Mut. For luciferase reporter assay, MG63 cells were cultured in 96-well plates and co-transfected with miR-505 mimics (or negative control) using Lipofectamine 2000. After transfection for 48 h, cells were harvested, and luciferase activity was assayed with the luciferase reporter assay system (Promega).

Statistical analysis

All experiments were performed in triplicate, with values expressed as mean ± standard deviation (SD). Group comparison was carried out by unpaired two-tailed Students t-test with the SPSS 19.0 software. P<0.05 was considered statistically significant.

Results

miR-505 is specifically downregulated in osteosarcoma tissues

To obtain microRNA expression patterns, 5 paired osteosarcoma tissue samples were randomly selected, and their miRNA expression profiles were determined by microRNA microarray. Notably, among the unique 2,150 human miRNA probes, 26 were differentially expressed between the osteosarcoma and adjacent normal tissues; among these, 12 were markedly upregulated and 14 downregulated (Fig. 1 and Table II). miR-505 showed the most pronounced decrease. To confirm the microarray findings, 4 significantly altered miRNAs (the most significantly dysregulated miRNAs), including miR-210, miR-135b, miR-505 and miR-16, were assessed by quantitative real-time reverse transcription-PCR (qRT-PCR). Their expression levels were evaluated in 37 paired tissue samples. As shown in Fig. 2, after normalization to U6, the expression trends of the 4 miRNAs were consistent with the microarray findings. However, the fold changes of expression differed somewhat between both assays.
Figure 1.

miRNA profile of osteosarcoma tissues. Five paired osteosarcoma tissue samples were randomly chosen for microRNA microarray assay (osteosarcoma tissues are indicated as O1-5; adjacent normal tissues are indicated as N1-5). The green bar indicates downregulated miRNAs, red part indicates upregulated miRNAs.

Table II.

Differentially expressed miRNAs between osteosarcoma tissues and corresponding normal tissues.

miRNA expression profiles

Upregulated miRNAsDownregulated miRNAs


miRNA nameFold changeP-valuesmiRNA nameFold changeP-values
hsa-miR-2106.210.0035hsa-miR-5057.360.0101
hsa-miR-135b6.060.0306hsa-miR-167.110.0232
hsa-miR-215.910.0121hsa-miR-29a6.340.0180
hsa-let-7c5.420.0263hsa-miR-29b6.210.0316
hsa-miR-935.040.0076hsa-miR-153-5p5.730.0246
hsa-miR-1554.600.0402hsa-miR-315.130.0023
hsa-miR-1504.310.0131hsa-miR-34a4.690.0130
hsa-miR-542-5p4.030.0169hsa-miR-34b4.240.0302
hsa-miR-6523.390.0114hsa-miR-2033.840.0173
hsa-miR-1833.230.0027hsa-miR-1253.370.0218
hsa-miR-2112.650.0126hsa-miR-1322.930.0104
hsa-miR-5192.070.0105hsa-miR-2062.670.0023
hsa-miR-4242.310.0010
hsa-miR-912.010.0156
Figure 2.

Analysis of the expression levels of the 4 miRNAs in specimens using qRT-PCR. Compared with normal tissues, (C) miR-505 and (D) miR-16 showed higher expression in osteosarcoma tissues, whereas (A) miR-210 and (B) miR-135b showed lower expression. **P<0.01 vs. corresponding normal tissues.

Associations of miR-505 expression with clinicopathological features in osteosarcoma

To assess the clinical value of miR-505 in osteosarcoma, clinical characteristics of the enrolled patients were collected by an Orthopedist. Then, patients were divided into groups according to various clinicopathological features (Table III). miR-505 expression was used to divide the patients into two groups according to its median value of 1.85. Notably, significant associations of miR-505 expression with TNM stage and metastasis were obtained (P=0.005 and 0.036, respectively). However, no significant associations of miR-505 expression with age, sex, histologic type, tumor size and nuclear grade were observed. These findings suggested that decreased miR-505 expression was significantly associated with poorer clinical prognosis in patients with osteosarcoma.
Table III.

Expression of miR-505 in relation to clinicopathological characteristics of 37 patients with osteosarcoma.

miR-505

CharacteristicsNo. of casesLow expressionHigh expressionP-value
Age (years)0.501
  <20271116
  ≥2010  6  4
Sex0.611
  Male1910  9
  Female18  711
Histologic type0.610
  Osteoblastic type18  810
  Fibroblastic type10  6  4
  Chondroblastic type  4  1  4
  Telangiectatic type  5  2  3
Nuclear grade0.157
  1–2271017
  3–410  7  3
Tumor size (cm)0.065
  ≤711  2  9
  >7261511
TNM classification0.005
  I+II21  516
  III+IV1612  4
Metastasis0.036
  Yes1611  5
  No21  615

HMGB1 is highly expressed in osteosarcoma tissues

The important role of miR-505 in osteosarcoma prompted us to explore the probable molecular mechanisms. As miRNAs always perform their functions by binding the 3UTRs of target mRNAs, several target prediction software programs, including TargetScan, miRDB and miRBase, were used to identify direct targets of miR-505. HMGB1 was revealed as a candidate, and has been reported to be overexpressed in several cancers and involved in autophagy. Therefore, HMGB1 mRNA levels were assessed in osteosarcoma samples. As expected, HMGB1 mRNA expression was significantly increased in osteosarcoma tissues compared with that in the corresponding normal tissues, as shown in Fig. 3A. What is more, HMGB1 gene expression was negatively correlated with miR-505 levels in the osteosarcoma samples, as analyzed by Pearson correlation (r=−0.6679, P<0.001) (Fig. 3B). In addition, the HMGB1 protein was also highly expressed in osteosarcoma tissues compared with that in the adjacent non-cancerous tissues (Fig. 3C and D).
Figure 3.

An inverse correlation between HMGB1 mRNA and miR-505 expression in osteosarcoma tissues. (A) The expression of HMGB1 was significantly increased in osteosarcoma tissues, compared with that in the adjacent normal tissues (**P<0.01). (B) Pearson correlation was used to analyze the relationship between miR-505 and HMGB1 mRNA in osteosarcoma tissues. (C and D) Western blot analysis shows the expression of HMGB1 protein in osteosarcoma tissues and adjacent normal tissues.

miR-505 suppresses the growth, migration and invasion of osteosarcoma cells

The biological functions of miR-505 in osteosarcoma cells were further assessed in vitro. As shown in Fig. 4A, qRT-PCR indicated significantly lower miR-505 expression in the osteosarcoma cell lines U2-OS, MG63, HOS and SAOS-2, compared with the normal osteoblastic cell line hFOB 1.19 (P<0.01). Then, miR-505 mimics and the miRNA negative control were successfully transfected into MG63 cells, respectively, for subsequent studies. Interestingly, miR-505 expression was significantly higher in the miR-505 mimics group compared with controls at 24 h after transient transfection (Fig. 4B; P<0.01). Subsequently, the effects of miR-505 on MG63 cell growth, migration and invasion were evaluated. Cell proliferation ability was suppressed in the miR-505 mimics group (P<0.01; Fig. 4C) as assessed by MTT assay every 24 h for 4 days. In addition, MG63 cells showed decreased cell migration ability after miR-505 overexpression (Fig. 4D and E). Furthermore, cell invasion assay showed that the mean number of cells penetrating the Transwell membrane in the miR-505 mimics group was significantly reduced compared with those of the miR-NC and mock groups (Fig. 4F and G). Moreover, western blot analysis showed altered expression of cell viability- and invasion-related proteins (Fig. 4H and I). These finding suggested that miR-505 inhibited proliferation, migration and invasion in MG63 cells in vitro.
Figure 4.

miR-505 inhibits MG63 cell proliferation, migration and invasion in vitro. (A) miR-505 expression levels were assessed in different osteosarcoma cell lines and a normal osteoblastic cell line. (B) The expression of miR-505 was tested in cells transfected with or without miR-505 mimics. (C) MTT assay of MG63 cells transduced with empty or miR-505 vectors. (D and E) Wound healing assay was used to investigate the migration ability of the cells. (F and G) Transwell invasion assay was used to determine the invasion ability of the MG63 cells in the different groups. (H and I) Western blot analysis showed the differential expression of cell viability- and invasion-related proteins MMP2/9 and cyclin D1, among the three groups. *P<0.01 vs. miR-NC, **P<0.01 vs. normal osteoblastic cell line hFOB1.19.

miR-505 directly downregulates HMGB1 in osteosarcoma cells

Since HMGB1 was found to be negatively correlated with miR-505 in osteosarcoma tissues, further experiments were performed to validate the interaction of miR-505 with HMGB1. As shown in Fig. 5A, the complementary sequence of miR-505 was present in the 3′-UTR of HMGB1 mRNA; a mutant was generated as underlined in the sequence. Then, HMGB11 expression was assessed in the miR-505 mimics, miR-NC and control groups by western blot analysis in U2-OS and MG63 cells. Notably, lower HMGB1 protein levels were found in the miR-505 mimic group (Fig. 5B; P<0.01). Next, HMGB1 mRNA amounts were detected by qRT-PCR in both cell lines, and HMGB1 was also downregulated with miR-505 overexpression (P<0.01) (Fig. 5C). Moreover, U2-OS and MG63 cells were transfected with miR-505 mimics or miR-NC, and luciferase reporter assay was performed to assess whether HMGB1 was an authentic target gene of miR-505. As shown in Fig. 5D, luciferase activity was significantly decreased in cells transfected with the HMGB1-WT-3′-UTR vector and miR-505 mimics, compared with that in cells transfected with control RNAs (P<0.01). Meanwhile, no significant change in relative luciferase activity was found when the miR-505 binding site was mutated. Taken together, these findings suggested that HMGB1 is a target of miR-505 in MG63 cells.
Figure 5.

miR-505 directly targets HMGB1 in osteosarcoma cells. (A) Bioinformatic tools were used to predict the site that miR-505 binds the 3′-UTR of HMGB1. (B) miR-505 expression affects HMGB1 protein expression in U2-OS and MG63 cells. (C) HMGB1 mRNA was significantly suppressed in the miR-505 mimics group in U2-OS and MG63 cells, detected by RT-qPCR. (D) Luciferase activity after transfection with wild-type/mutant-type 3′-UTR constructs in HMGB1. *P<0.01 compared with miR-NC.

miR-505 inhibits proliferation, migration and invasion in osteosarcoma cells by negatively regulating HMGB1

Although HMGB1 as a direct target of miR-505 in MG63 cells was validated by the luciferase reporter assay, whether miR-505 inhibits MGB63 cell proliferation, migration and invasion through binding to HMGB1 remained unclear. Thus, a pcDNA3.1/HMGB1 was generated for HMGB1 overexpression. Relative HMGB1 protein amounts were detected in the different groups as shown in Fig. 6A. Notably, HMGB1 overexpression showed increased abilities of growth, migration and invasion (P<0.01), as shown in Fig. 6B-D. Cell viability-related protein levels also showed a certain degree of increase (Fig. 6E). Taken together, the above data strongly suggested that miR-505 induced MG63 cell proliferation, migration and invasion by downregulating HMGB1.
Figure 6.

Overexpression of HMGB1 partly abrogates miR-505-induced inhibitory effects on MG63 cells. (A) The expression of HMGB1 in different groups was detected by western blotting analyses. (B) Cell migration ability was detected by wound-healing assay in MG63 cells transfected with miR-505 mimics or miR-505 mimics/empty vector or miR-505 mimics/HMGB1. (C) MTT assay was performed in MG63 cells. (D) Transwell chamber was used for cell invasive ability detection. (E) Western blotting analyses were used to detect the expression of MMP-2/9 and cyclin D1 in MG63 cells. *P<0.01 compared with mimics/empty vector.

Discussion

Metastasis and recurrence are the leading causes of mortality in most patients with cancers, including osteosarcoma. The optimal treatment strategy for such patients has yet to be defined. Although several clinical trials have reported that adjuvant chemotherapy is associated with improved outcomes in osteosarcoma patients, the prognosis of recurrent disease remains poor, with a long-term post-relapse survival of <20% (17–19). It is generally accepted that tumor cells acquiring migration and invasion abilities to depart from their original locations is the prerequisite for metastasis. Therefore, it is critical to identify effective agents which could significantly inhibit cell growth, migration and invasion of osteosarcoma cells. miRNAs were firstly associated with cancer in 2002, initially with chronic lymphocytic leukemia (CLL) and subsequently with many other malignancies (20). Osaki et al (21) indicated that miR-143 was the most downregulated miRNA in human osteosarcoma cell lines in a mouse model, and demonstrated that systemic administration of miR-143 with atelocollagen into cancer model mice suppressed spontaneous lung metastasis of osteosarcoma. Similarly, another study evaluated 23 osteosarcoma tissue samples by microRNA microarrays, and found that miR-133a and miR-133b levels are significantly decreased. Overexpression of miR-133b in osteosarcoma cell lines obviously inhibits cell proliferation, invasion and migration (22). In addition, a recent study reported that relative expression levels of miR-99a and mTOR mRNA were found to be associated with advanced clinicopathological characteristics (advanced surgical stage, metastasis, recurrence and poor response to chemotherapy) in patients with osteosarcoma, with low miR-99a expression correlating with shorter overall and disease-free survival rates; in addition, miR-99a was found to be an independent prognostic factor of patients with osteosarcoma (23). We also performed a microarray to obtain the miRNA profile in osteosarcoma. A total of 26 miRNAs showed altered expression in osteosarcoma tissues in this study and we subsequently focused on miR-505, the most downregulated one among our findings. To the best of our knowledge, multiple studies have found that miR-505 inhibited cell proliferation by inducing apoptosis, and promoted chemoresistance in breast cancer (24,25). In addition, transfection with miR-505 mimics inhibited proliferation, and reduced tumorigenicity in endometrial carcinoma cells (26). Lu et al (27) also reported that miR-505 was downregulated in human hepatoma tissues and cell lines. Importantly, miR-505 upregulation suppressed proliferation, invasion and epithelial-mesenchymal transition in hepatoma cells, via HMGB1 targeting. However, the exact role of miR-505 in osteosarcoma remains unclear. We demonstrated that miR-505 showed the largest decrease in osteosarcoma samples as validated by qRT-PCR. The clinical significance and biological functions of miR-505 in osteosarcoma were then investigated. As studies have demonstrated that TNM stage and tumor size are predictive prognostic factors for recurrence-free survival in osteosarcoma patients (28,29), we found that miR-505 expression levels were associated with TNM stage, and metastasis status, but not tumor size in the present study. Nevertheless, we determined the level of miR-505 and explored its clinical value in a small cohort and the conclusion was obtained only in a single center. Future studies would contribute to our understanding of the precise clinical significance, such as diagnostic or prognostic value of miR-505 in patients with osteosarcoma. In addition, in vitro assays suggest that miR-505 inhibited MG63 cell proliferation, migration and invasion. These inhibitory effects of miR-505 on cell malignancy behavior may explain why lower miR-505 levels were closed related with advanced pathological stage. HMGB1 was originally described as a nuclear non-histone DNA binding protein that functions as a structural co-factor critical for proper transcriptional regulation in somatic cells (30). It is passively released by necrotic cells or actively secreted by immune and cancer cells (31,32). Elevated HMGB1 expression is associated with unlimited replicative potential, evasion of programmed cell death, angiopoiesis, tissue invasion and metastasis (33,34). Jube et al (32) revealed that serum HMGB1 levels in malignant mesothelioma patients are higher than those obtained for healthy individuals. In addition, HMGB1 induces migration and proliferation of malignant mesothelioma cells; after treatment with monoclonal antibodies against HMGB1 or its receptor, motility, survival and anchorage-independent growth of HMGB1-secreting malignant mesothelioma cells are reduced. What is more, autophagy activation and HMGB1 release are considered key events underpinning colon carcinoma cell-elicited leukocyte attraction (35). In this study, we determined the levels of HMGB1 in osteosarcoma tissues and HMGB1 mRNA levels were elevated in osteosarcoma tissues as shown above. A recent study demonstrated that HMGB1 expression is associated with clinical prognosis in osteosarcoma. Patients with high HMGB1 expression showed increased tumor size, high TNM stage and nuclear grade, with HMGB1 expression considered an independent predictor of poor prognosis (36). Notably, HMGB1 is considered an active cytokine that regulates the bone microenvironment (15,37). In 2012, Huang et al (38) found that HMGB1 is upregulated during chemotherapy, regulating autophagy during chemotherapy in osteosarcoma cells. HMGB1 suppression increases sensitivity to chemotherapy. Conversely, HMGB1 overexpression increases resistance to chemotherapy in vitro. These findings confirmed that HMGB1 is an important regulator of autophagy-mediated cell survival (39). We further explored the relationship between HMGB1 and miR-505 in rhe present study. Indeed, Guo et al (40) proposed HMGB1 as a direct target of miR-22 in osteosarcoma, with miR-22 downregulating HMGB1-induced autophagy in osteosarcoma cells. HMGB1 was also reported to be involved in cell growth promotion in neuroblastoma by modulating PTEN expression, via miR-221/222 oncogenic clusters (41). Next, we confirmed that HMGB1 is a direct target of miR-505 in osteosarcoma cell lines, which was consistent with results revealed by Lu et al (27). The above data indicated that HMGB1 downregulation is likely mediated by miR-505 through its binding to the 3′UTR of HMGB1 mRNA, and help better understand the role of HMGB1 in osteosarcoma. However, how HMGB1 exerts its suppressor effects on osteosarcoma cells still needs to be further elucidated. Overall, the present study demonstrated that miR-505 downregulation is associated with poor clinical prognosis in patients with osteosarcoma; indeed, miR-505 inhibits osteosarcoma cell proliferation, migration and invasion by targeting HMGB1. These findings identified a novel tumor suppressive role for the miR-505/HMGB1 interaction in osteosarcoma.
  41 in total

Review 1.  Mini-review: The nuclear protein HMGB1 as a proinflammatory mediator.

Authors:  Helena Erlandsson Harris; Ulf Andersson
Journal:  Eur J Immunol       Date:  2004-06       Impact factor: 5.532

2.  miR-22 inhibits osteosarcoma cell proliferation and migration by targeting HMGB1 and inhibiting HMGB1-mediated autophagy.

Authors:  Shibing Guo; Rui Bai; Wanlin Liu; Aiqing Zhao; Zhenqun Zhao; Yuxin Wang; Yong Wang; Wei Zhao; Wenxuan Wang
Journal:  Tumour Biol       Date:  2014-04-22

3.  Prognostic factors in high-grade osteosarcoma of the extremities or trunk: an analysis of 1,702 patients treated on neoadjuvant cooperative osteosarcoma study group protocols.

Authors:  Stefan S Bielack; Beate Kempf-Bielack; Günter Delling; G Ulrich Exner; Silke Flege; Knut Helmke; Rainer Kotz; Mechthild Salzer-Kuntschik; Matthias Werner; Winfried Winkelmann; Andreas Zoubek; Heribert Jürgens; Kurt Winkler
Journal:  J Clin Oncol       Date:  2002-02-01       Impact factor: 44.544

4.  Expression of high mobility group box 1 protein predicts a poorer prognosis for patients with osteosarcoma.

Authors:  Jiliang He; Peng Zhang; Qinghu Li; Dongsheng Zhou; Ping Liu
Journal:  Oncol Lett       Date:  2015-11-10       Impact factor: 2.967

5.  Cancer cell secretion of the DAMP protein HMGB1 supports progression in malignant mesothelioma.

Authors:  Sandro Jube; Zeyana S Rivera; Marco E Bianchi; Amy Powers; Ena Wang; Ian Pagano; Harvey I Pass; Giovanni Gaudino; Michele Carbone; Haining Yang
Journal:  Cancer Res       Date:  2012-05-02       Impact factor: 12.701

6.  Down-regulation of miR-183 promotes migration and invasion of osteosarcoma by targeting Ezrin.

Authors:  Junfeng Zhu; Yupeng Feng; Zunfu Ke; Zheng Yang; Junyi Zhou; Xiaorong Huang; Liantang Wang
Journal:  Am J Pathol       Date:  2012-04-21       Impact factor: 4.307

7.  A phase II trial of sorafenib in relapsed and unresectable high-grade osteosarcoma after failure of standard multimodal therapy: an Italian Sarcoma Group study.

Authors:  G Grignani; E Palmerini; P Dileo; S D Asaftei; L D'Ambrosio; Y Pignochino; M Mercuri; P Picci; F Fagioli; P G Casali; S Ferrari; M Aglietta
Journal:  Ann Oncol       Date:  2011-04-28       Impact factor: 32.976

8.  Osteosarcoma: the addition of muramyl tripeptide to chemotherapy improves overall survival--a report from the Children's Oncology Group.

Authors:  Paul A Meyers; Cindy L Schwartz; Mark D Krailo; John H Healey; Mark L Bernstein; Donna Betcher; William S Ferguson; Mark C Gebhardt; Allen M Goorin; Michael Harris; Eugenie Kleinerman; Michael P Link; Helen Nadel; Michael Nieder; Gene P Siegal; Michael A Weiner; Robert J Wells; Richard B Womer; Holcombe E Grier
Journal:  J Clin Oncol       Date:  2008-02-01       Impact factor: 44.544

9.  Presurgical chemotherapy compared with immediate surgery and adjuvant chemotherapy for nonmetastatic osteosarcoma: Pediatric Oncology Group Study POG-8651.

Authors:  Allen M Goorin; Douglas J Schwartzentruber; Meenakshi Devidas; Mark C Gebhardt; Alberto G Ayala; Michael B Harris; Lee J Helman; Holcombe E Grier; Michael P Link
Journal:  J Clin Oncol       Date:  2003-04-15       Impact factor: 44.544

10.  Association between an elevated level of HMGB1 and non-small-cell lung cancer: a meta-analysis and literature review.

Authors:  Quansong Xia; Juan Xu; Huoying Chen; Yanzhang Gao; Feili Gong; Liya Hu; Li Yang
Journal:  Onco Targets Ther       Date:  2016-06-29       Impact factor: 4.147

View more
  20 in total

1.  miR-300 mitigates cancer-induced bone pain through targeting HMGB1 in rat models.

Authors:  Chenglong Liu; Jianping Yang; Haihua Liu; Tian Xia; Fei Zhang
Journal:  Genes Genomics       Date:  2019-12-23       Impact factor: 1.839

Review 2.  miRNA signatures in childhood sarcomas and their clinical implications.

Authors:  G M Viera; K B Salomao; G R de Sousa; M Baroni; L E A Delsin; J A Pezuk; M S Brassesco
Journal:  Clin Transl Oncol       Date:  2019-04-04       Impact factor: 3.405

3.  Long non-coding RNA FGD5-AS1 enhances osteosarcoma cell proliferation and migration by targeting miR-506-3p/RAB3D axis.

Authors:  Congda Li; Xiangbo Lin; Caiyun Zhang; Lei Wan; Jijun Yin; Bin Wang
Journal:  Hum Cell       Date:  2021-04-23       Impact factor: 4.174

4.  Circular RNA hsa_circ_0005909 modulates osteosarcoma progression via the miR-936/HMGB1 axis.

Authors:  Shuai Ding; Guangquan Zhang; Yanzheng Gao; Shulian Chen; Chen Cao
Journal:  Cancer Cell Int       Date:  2020-07-13       Impact factor: 5.722

5.  MicroRNA-505-3p inhibits development of glioma by targeting HMGB1 and regulating AKT expression.

Authors:  Zhenlin Cheng; Bin Wang; Cheng Zhang
Journal:  Oncol Lett       Date:  2020-06-09       Impact factor: 2.967

6.  MicroRNA-505 suppresses gastric cancer cell proliferation and invasion by directly targeting Polo-like kinase-1.

Authors:  Sheng-Chun Dang; Fei Wang; Xiao-Bao Qian; Malik Abdul; Qais-Ahmad Naseer; Wei Jin; Rong Hu; Qian Gu; Min Gu
Journal:  Onco Targets Ther       Date:  2019-01-24       Impact factor: 4.147

7.  Development of a Machine Learning-Based Autophagy-Related lncRNA Signature to Improve Prognosis Prediction in Osteosarcoma Patients.

Authors:  Guang-Zhi Zhang; Zuo-Long Wu; Chun-Ying Li; En-Hui Ren; Wen-Hua Yuan; Ya-Jun Deng; Qi-Qi Xie
Journal:  Front Mol Biosci       Date:  2021-05-21

8.  Curcumin Derivative C086 Combined with Cisplatin Inhibits Proliferation of Osteosarcoma Cells.

Authors:  Xi Jiang; Yulin Huang
Journal:  Med Sci Monit       Date:  2020-07-31

9.  Role of microRNA-92a in metastasis of osteosarcoma cells in vivo and in vitro by inhibiting expression of TCF21 with the transmission of bone marrow derived mesenchymal stem cells.

Authors:  Shuai Cao; Liangde Jiang; Lulu Shen; Zhizheng Xiong
Journal:  Cancer Cell Int       Date:  2019-02-12       Impact factor: 5.722

10.  microRNA-505 negatively regulates HMGB1 to suppress cell proliferation in renal cell carcinoma.

Authors:  Bing Zhong; Zhiqiang Qin; Hui Zhou; Fengming Yang; Ke Wei; Xi Jiang; Ruipeng Jia
Journal:  J Cell Physiol       Date:  2019-01-15       Impact factor: 6.384

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.