| Literature DB >> 29250091 |
Guangyang Wang1,2, Aoyue Bi1,2, Erick Amombo1,2, Huiying Li1, Liang Zhang1,2, Cheng Cheng1,2, Tao Hu1, Jinmin Fu3.
Abstract
Calcium enhances turfgrass response toEntities:
Keywords: PSII photochemistry; carbon and nitrogen assimilation; exogenous calcium; salt stress; tall fescue
Year: 2017 PMID: 29250091 PMCID: PMC5715236 DOI: 10.3389/fpls.2017.02032
Source DB: PubMed Journal: Front Plant Sci ISSN: 1664-462X Impact factor: 5.753
Photosynthetic parameters deduced by the JIP-test analysis of fluorescence transients.
| F0 = F20μ | 0.46a | 0.47a | 0.48a | 0.49a | 0.45a | 0.46a | 0.47a | 0.49a | Fluorescence at time t after onset of actinic illumination |
| FK | 1.05a | 1.08a | 1.07a | 0.98b | 1.12ab | 1.16a | 1.13ab | 1.05b | Fluorescence value at 300 μs |
| FJ | 1.25a | 1.25a | 1.27a | 1.19a | 1.27a | 1.30a | 1.31a | 1.24a | Fluorescence value at the J-step of OJIP |
| FI | 1.70a | 1.60b | 1.73a | 1.69a | 1.65b | 1.70ab | 1.73a | 1.70ab | Fluorescence value at the I-step of OJIP |
| FP = FM | 1.89a | 1.86a | 1.95a | 1.89a | Fluorescence value at the peak of OJIP test | ||||
| M0 | 1.61a | 1.77a | 1.61a | 1.44b | Approximate value of the initial slope of fluorescence transient curves | ||||
| VJ | 0.55ab | 0.56a | 0.54ab | 0.51b | Relative variable fluorescence at J-step | ||||
| Area | 10.45a | 15.41a | 12.86a | 10.45a | The area above the chlorophyll fluorescence curve between Fo and Fm | ||||
| N | 21.96a | 34.66a | 26.11a | 20.91a | Number of QA redox turnovers until Fm is reached | ||||
| ABS/RC | 0.65ab | 0.75a | 0.66ab | 0.55b | Absorbed photon flux per RC | ||||
| TR0/RC | 2.96b | 3.16a | 2.98b | 2.84b | 3.27ab | 3.34a | 3.16bc | 3.00c | Trapped excitation flux (leading to QA reduction) per RC |
| ET0/RC | 1.35a | 1.39a | 1.37a | 1.39a | Electron transport flux (further than | ||||
| RE0/RC | 0.08a | 0.12a | 0.09a | 0.09a | Electron flux reducing end electron acceptors at the PSI acceptor side, per RC | ||||
| φP0 = TR0/ABS | 0.74a | 0.75a | 0.75a | 0.75a | 0.75a | 0.75a | 0.75a | 0.74a | Maximum quantum yield for primary photochemistry |
| ψE0 = ET0/TR0 | 0.45ab | 0.44b | 0.46ab | 0.49a | Efficiency/probability with which a PSII trapped electron is transferred from QA to QB | ||||
| φE0 = ET0/ABS | 0.34b | 0.33b | 0.35ab | 0.37a | Quantum yield of the electron transport flux from QA to QB | ||||
| σR0 = RE0/ET0 | 0.06b | 0.08a | 0.07ab | 0.07ab | Efficiency/probability with which an electron from QB is transferred until PSI acceptors | ||||
| φR0 = RE0/ABS | 0.10b | 0.14a | 0.11b | 0.10b | Quantum yield for reduction of end Electron acceptors at the PSI acceptor side | ||||
| γRC | 0.20ab | 0.19b | 0.20ab | 0.21a | 0.18b | 0.19ab | 0.19ab | 0.20a | Probability that a PSII Chl molecule functions as RC |
| RC/ABS | 1.53b | 1.35b | 1.54b | 1.82a | Number of QA reducing RCs per PSII antenna Chl | ||||
| PIABS | 0.49b | 0.38b | 0.45b | 0.61a | 0.35b | 0.38b | 0.43ab | 0.51a | PI (potential) for energy conservation from exciton to the reduction of intersystem electron |
| PItotal | 0.03a | 0.04a | 0.04a | 0.04a | PI (potential) for energy conservation from exciton to the reduction of PSI end acceptors | ||||
Each parameter is carefully calculated according to previous method (Yusuf et al., .
Primer sequences for RT-PCR amplification analysis in tall fescue.
| F CTGTGGAGGCATTGAGGT | ||
| R CGCAGACACGAGGAATAAC | ||
| F CCAGAGGTTCTAAGGAAGGA | ||
| R CGTGGAGCGATGTGAGAT |
Gene sequences derived from the transcriptome data of tall fescue (Hu et al., .
Figure 1Polyphasic rise of chlorophyll fluorescence in tall fescue leaves before (A) and after (B) subjected to salt stress with different calcium regimes. S (Salt stress) and SC (Salt stess combined with exogenous calcium application) shows no difference when compared to CK 5 days later, while SE (Salt stess combined with calcium chelator, EGTA) revealed a weakened P-step (B).
Figure 2A “radar plot” of picked parameters characterizing different behavior of Photosystem II of tall fescue leaves exposed to diverse saline environment. All values are shown as percent of control (control plants = 1).
Figure 3Calcium addition gently alleviated the reduction of chlorophyll content (A) and electrolyte leakage upsurge (B). Three independent experiments were performed in chlorophyll content determination specially. Different letters above the same columns indicate statistic significant difference at P < 0.05 by Tukey's multiple range tests. Comparisons were carried out among the same tissue at same time, respectively.
Figure 4Exogenous calcium facilitated the carbon (A) and nitrogen (B) assimilation of tall fescue in salt environment. However, it showed no significant effect on Carbon Nitrogen ratio (C). Columns marked with different letters indicate statistic significant difference at P < 0.05 by Tukey's multiple range tests. “0-L” and “5-L” on the horizontal axis means experiments are carried out in shoots at 0 and 5 days after treatments (DAT), similarly, “5-R” represents roots at 5 DAT. Comparisons were carried out among the same tissue at same time, respectively.
Figure 5The quantification of calcium, potassium content in shoots and roots Calcium concentration gradient in shoots was actually confirmed (A). In addition, the potassium absorption was promoted by calcium application (B), which was obviously reflected in roots. Columns marked with different letters indicate statistic significant difference at P < 0.05 (Tukey's multiple range test). Comparisons were carried out among the same tissue at same time, respectively.
Figure 6ATP6E (A) and CAMK2 (B) transcriptional level in tall fescue exposed to salinity. Different letters above the same columns indicate statistic significant difference at P < 0.05 (Tukey's multiple range test). Calcium led to a 95.8% reduction in the ATP6E expression than the control under salinity stress conditions. Comparisons were carried out among the same tissue at same time, respectively.
Correlations between photochemical parameters and physiological indexes in tall fescue after 5-day treatments.
| Area | 1.000 | ||||||||||||
| N | 0.944 | 1.000 | |||||||||||
| Ψeo | 0.503 | 0.399 | 1.000 | ||||||||||
| δRo | 0.490 | 0.385 | 1.000 | ||||||||||
| VJ | −0.503 | −0.399 | 1.000 | ||||||||||
| ABS/RC | −0.587 | −0.448 | 1.000 | ||||||||||
| M0 | −0.594 | −0.455 | 1.000 | ||||||||||
| C-L | 0.671 | 0.559 | 1.000 | ||||||||||
| N-L | 0.524 | 0.427 | 1.000 | ||||||||||
| K-L | 0.175 | 0.350 | 0.042 | 0.175 | −0.042 | 0.007 | 0.077 | 0.168 | 0.175 | 1.000 | |||
| Ca-L | 0.413 | 0.399 | −0.413 | −0.434 | −0.434 | 0.420 | 0.266 | 0.238 | 1.000 | ||||
| K-R | 0.524 | 0.378 | 0.140 | 0.224 | 1.000 | ||||||||
| Ca-R | −0.231 | 0.559 | 1.000 |
Indicates statistical difference significance at P < 0.05 among the treatments by Tukey's multiple range tests.
Indicates statistical difference significance at P < 0.01 among the treatments by Tukey's multiple range tests.
L and R indicate leaves and roots of tall fescue of genotype TF133 respectively.
The underline values are all carefully selected to avoid blindness on browsing miscellaneous data.