| Literature DB >> 29242837 |
Carlos García1, Faiza Tebbji1, Michelle Daigneault2, Ning-Ning Liu3, Julia R Köhler3, Emma Allen-Vercoe2, Adnane Sellam1,4.
Abstract
Candida albicans is well known as a major human fungal pathogen, but it is also a permanent resident of healthy gastrointestinal tracts. Recent studies have shown that the human gut microbial metabolome represents an interesting source of bioactive molecules with a significant degree of chemical diversity. Some of these bioactive molecules may have useful antivirulence activities. For instance, intestinal bacterial species belonging to the Lachnospiraceae family were found to secrete molecules that attenuate Salmonella pathogenicity and repress the expression of virulence genes. Here, we have investigated whether the microbial gut metabolome (GM) contains molecules that might promote the commensal lifestyle and/or inhibit the expression of virulence of C. albicans in the intestine. We found that metabolites from human feces inhibited the growth of C. albicans and other opportunistic yeasts. A genetic screen in C. albicans suggested that TOR is the molecular target of the antifungal molecule(s) of the GM. In addition, we found that the GM metabolites inhibit both C. albicans hyphal growth and the invasion of human enterocytes. The antigrowth and antivirulence activities were partially recapitulated by secretions from Roseburia spp. and Bacteroides ovatus strains, respectively. This study demonstrates that the antimicrobial activity of the GM can be extended to a eukaryotic pathogen, C. albicans, illuminating the antagonistic interkingdom interactions between a fungus and intestinal commensal bacteria. IMPORTANCECandida albicans is a natural component of the human microbiota but also an opportunistic pathogen that causes life-threatening infections. The human gastrointestinal tract is the main reservoir of C. albicans, from where systemic infections originate as a consequence of the disruption of the intestinal mucosal barrier. Recent studies provided convincing evidence that overgrowth of C. albicans and other related species in the gut is predominantly associated with chronic intestinal inflammatory bowel diseases. Here, we showed, for the first time, the antagonistic interkingdom interactions between C. albicans and common intestinal commensal bacteria. From a therapeutic perspective, administering a defined bacterial community, such as the one described here with anti-Candida activity, could provide potential therapeutic protection against gastrointestinal inflammatory diseases.Entities:
Keywords: Candida albicans; TOR pathway; antifungal activity; gut microbial metabolome
Year: 2017 PMID: 29242837 PMCID: PMC5729221 DOI: 10.1128/mSphere.00555-17
Source DB: PubMed Journal: mSphere ISSN: 2379-5042 Impact factor: 4.389
FIG 1 Antifungal activity of the gut secreted metabolome. (A and B) The C. albicans SC5314 strain was grown in SC medium supplemented with 1% (A) and 8% (B) bioreactor effluent (DEC60 gut metabolome [GM]). Cells were grown at 30°C, and an OD595 reading was taken every 10 min. OD measurements for each GM concentration and control (cells treated with uninoculated bioreactor growth medium) are provided as the mean from triplicate assays. To determine whether the bioactive antifungal molecules were secreted by the components of the microbiota, spent culture medium was separated from bacterial cells by centrifugation followed by supernatant filtration. The histogram in each panel indicates OD595 after 24 h of exposure. (C) Antifungal activity of the GM on clinical C. albicans azole- (6692, S2, and G5) and echinocandin-resistant (DPL-1007 and DPL-1008) strains. (D) The GM inhibits the growth of representative strains of gut-resident yeasts, including C. glabrata, C. parapsilosis, C. krusei, and S. cerevisiae. For panels C and D, cells were grown in SC medium with 8% GM or control growth medium and OD595 readings were taken after 24 h of incubation at 30°C under agitation. Results represent mean growth inhibition (percent) after 24 h of treatment of at least three replicates. NF, nonfiltered; F, filtered.
FIG 2 The inhibitory effect of the human gut metabolome is widespread. For each human donor, results represent the average from three independent C. albicans cultures. C. albicans SC5314 cells were grown in SC medium with 1 and 8% GM or control medium, and an OD595 reading was taken after 24 h of incubation at 30°C under agitation. MET-1 is a defined therapeutic microbial ecosystem of 33 bacterial strains from donor 1 (DEC60). Bars show the means ± standard errors of the means. *, P < 0.02; **, P < 0.01; ***, P < 0.0003.
FIG 3 The gut metabolome inhibits C. albicans growth through the TOR pathway. (A) In solid SC-agar medium, cells treated with 8% GM resulted in colonies with reduced size. (B) Diameters (measured in arbitrary units) of at least 50 colonies grown in SC-agar with or without GM (8%) were measured. (C) Representative image of the sirolimus-resistant TOR1-1 strain (JRB12) colony size. (D) Mean diameter of TOR1-1 colonies. In panels B and D, bars represent the means ± standard errors of the means. *, P < 0.00001; ns, not significant (P > 0.12). (E) The GM reduces the phosphorylation level of the TOR effector, ribosomal protein S6. C. albicans cells were grown in SC medium and treated for 1 h with 8% GM. The same volume of culture medium was added to the control culture. Cell lysates were probed for P-S6 and tubulin (loading control) using anti-phosphorylated-Akt substrate and antitubulin antibodies, respectively. At least three biological replicates were obtained for each experiment shown.
Gene functions and biological processes associated with C. albicans response to GM
| GO category | Gene name | |
|---|---|---|
| Upregulated transcripts | ||
| Alpha-amino acid biosynthesis | 4.79e−8 | |
| Aspartate family amino acid biosynthesis | 5.78e−5 | |
| Arginine metabolism | 6e−4 | |
| Sulfur amino acid metabolism | 8.4e−4 | |
| Glutamine family amino acid biosynthesis | 1.33e−3 | |
| Carbohydrate metabolism | 1.71e−3 | |
| Methionine metabolism | 9.55e−3 | |
| Serine metabolism | 7.03e−3 | |
| Trehalose metabolism | 5.46e−3 | |
| Alpha-amino acid catabolism | 4.12e−3 | |
| Downregulated transcripts | ||
| Ribosome biogenesis | 1.89e−70 | |
| Ribosome localization | 2.80e−7 | |
| snRNA metabolic process | 5.84e−3 | |
| tRNA processing | 9.45e−3 | |
| snoRNA processing | 4.15e−2 | |
| GMP metabolic process | 7.62e−2 |
The P value was calculated using hypergeometric distribution, as described on the GO Term Finder website.
Gene ontology (GO) analysis was performed using GO Term Finder.
FIG 4 Antivirulence activity of the human gut metabolome. (A and B) The GM inhibits both hypha elongation (A) and hypha formation (B). C. albicans SC5314 cells growing at 37°C in the presence of FBS were treated with 2 and 8% GM for 1 h. The number of germ tubes of at least 100 cells treated with GM or not was counted and compared to cells treated with the control culture medium only (B). At the same time, filament lengths were measured and results are presented as the percentage of length reduction compared to the control condition (A). The presented data are representative of three biological replicates. (C) The GM contains molecules that modulate virulence-related gene expression. Transcript levels of bona fide yeast-to-hypha transition genes, including ALS1, ALS3, ECE1, HWP1, and SOD5, were evaluated in cells exposed to 8% GM for 1 h. Transcript levels were calculated using the comparative C method using the ACT1 gene as a reference. (D) The GM attenuates the damage to human colon epithelial cells (HT-29 cells) caused by C. albicans. Damage to HT-29 cells was assessed using an LDH release assay. For each GM concentration, cell damage was calculated as percentage of LDH activity of the GM-treated experiment culture relative to that of the control experiment culture (C. albicans invading HT-29 cells in the absence of GM). Results are expressed as the mean from three independent biological replicates.
FIG 5 Identification of bacterial species producing the anti-Candida molecules. (A) Both Roseburia intestinalis and R. faecis secreted molecules exert antifungal activity. C. albicans cells were grown in SC medium with 8% GM or control medium, and OD595 readings were taken after 24 h of incubation at 30°C under agitation. Results represent growth inhibition (percent) after 24 h of treatment of at least three replicates. (B and C) Both Bacteroides ovatus strain 5MM (B) and strain S1D6FAA (C) reduced C. albicans hypha elongation. A total of 100 cells with three hypha length ranges (1 to 20, 21 to 40, and >40), measured in arbitrary units, were counted. Results are presented as the number of cells with a hypha length in the corresponding range.
Primer sets used in real-time quantitative PCR
| Gene | 5′ primer | 3′ primer |
|---|---|---|
| GAAGCCCAATCCAAAAGA | CTTCTGGAGCAACTCTCAATTC | |
| CCTATCTGACTAAGACTGCACC | ACAGTTGGATTTGGCAGTGGA | |
| CGGTTGCGACTGCAAAGAC | GACCAACCCAAAACAGCATTCC | |
| CAGTTCCACTCATGCAACCATC | GCAATACCAATAATAGCAGCACCG | |
| ACGAGGGACACGGCAATGCT | GCGCCATTACCTTGAGGAGCAGTA | |
| CCGGCATCTCTTTTAACTGG | GAGATGGCGTTCCAGATGTT |