Correction to: CRISPR-like sequences in Helicobacter pylori and application in genotyping.

[This corrects the article DOI: 10.1186/s13099-017-0215-8.].

Correction to: Gut Pathog (2017) 9:65 10.1186/s13099-017-0215-8

In the original version of this article [1], published on 17 November 2017, Table 2 contains an error: the first “T” in the first sequence in the column ‘Consensus direct repeats (CDRs) sequences’ has been incorrectly underlined. In Table 2, the underlining indicates the Consensus sequence.

The sequence was originally underlined like this:

AACAGCACTTTCAATCAAGGGACTTACAA

The sequence should have been underlined like this:

AACAGCACTTTCAATCAAGGGACTTACAA

The original publication of this article has been corrected.