Molecular detection of Bordetella holmesii in two infants with pertussis-like syndrome: the first report from Iran.

BACKGROUND AND OBJECTIVES: Bordetella holmesii is associated with a pertussis-like respiratory syndrome in healthy individuals and also a rare cause of septicaemia, endocarditis, pneumonia, and septic arthritis, mostly in immunocompromised patients. Culture technique and real-time PCR are 2 methods used to detect Bordetella spp.
MATERIALS AND METHODS: In this study, 435 nasopharyngeal specimens of patients with suspected whooping cough were checked for the presence of B. holmesii using 2 methods of culture technique and real-time PCR.
RESULTS: In this study, we detected hIS1001 and IS481 of B. holmesii in 2 infants suspected of having pertussis-like syndrome.
CONCLUSION: Our observations demonstrate that accurate diagnosis is needed to discriminate between B. holmesii and B. pertussis infections among pertussis cases; otherwise, it could lead to misestimating pertussis rate and vaccine efficacy.

INTRODUCTION

Bordetella holmesii is a Gram- negative coccobacillus, strictly aerobic and slow-growing organism, which was first identified as a species in 1995 (1). Little information is available on the epidemiology and clinical manifestations of B. holmesii. Although B. holmesii has not been historically associated with a cough illness, this pathogen has recently been more associated with a pertussis-like respiratory syndrome in healthy individuals (2, 3). It is difficult to ensure whether B. holmesii is in fact responsible for the clinical symptoms, as the sequencing of B. holmesii genome has harbored any gene encoding virulence factors similar to those of B. pertussis (4). Moreover, B. holmesii is also a rare cause of septicemia, endocarditis, pneumonia and septic arthritis, mostly in immunocompromised patients (5).

Respiratory infection associated with B. holmesii is frequently misidentified as whooping cough with B. pertussis. Although no fatal cases of B. holmesii have been reported, invasive infections associated with this bacterium can cause substantial morbidities even in previously healthy individuals. Antimicrobial treatment can be difficult because susceptibility of B. holmesii to macrolides and third generation cephalosporin is lower than expected (6, 7).

Based on previous investigations, B. holmesii does not have a clear reservoir and transmission pattern. It is still unknown whether these species are pathogens for humans or they should be considered as opportunistic bacteria. However, the biological diagnosis has confirmed the presence of B. holmesii in human respiratory samples (7–10). Although Bordetella spp. are genetically similar to each other, they are different in the presence or absence of insertion sequences (ISs) and their copy number. For example, IS481 presents in B. pertussis, B. holmesii and B. bronchiseptica with 50–200, 8–10 and <5 copy number, respectively, while it has not been reported in B. parapertussis. Moreover, there is IS1001 in B. parapertussis and some of B. bronchiseptica; and hIS1001 has just been found in B. holmesii (11). Detection of ISs is the basis of molecular diagnosis among Bordetella species. Therefore, correct detection of Bordetella spp. need a precise molecular technique such as real-time PCR. On the other hand, the incorrect reports of pertussis-like syndrome associated with B. holmesii as whooping cough give rise to misestimating pertussis infection rate. It seems that B. holmesii may need a diagnostic assay and epidemiological surveillance. The present study aimed at detecting B. holmesii in clinical samples of patients suspected of having pertussis using real time PCR.

MATERIALS AND METHODS

Patients, sampling and culture.

Nasopharyngeal samples were taken from 435 pertussis suspected patients in all age ranges using Dacron swab. The swabs were put in Regan-Lowe (RL) agar (with oxacillin) as transport medium. One of the swabs was cultured on RL agar plates (with or without oxacillin in medium) and incubated at 35–36°C for 14 days. The second swab was used for DNA extraction and real-time PCR. In this study, the samples were not checked for the presence of viral or mycoplasmal infections.

DNA Extraction and Real-time PCR.

DNA was extracted from 200 μL of diluted specimen using High Pure PCR Template Preparation Kit, as recommended by the supplier (Roche Diagnostics, GmbH, Mannheim, Germany). The extracted DNAs were eluted in a 100μL volume. Primers and TaqMan probes were designed to amplify IS481, IS1001, IS1002, ptxP and hIS1001, as demonstrated in Table 1. ABI 7500 Real-Time PCR System (Applied Bio-system, Inc.) was used for amplification. The temperature profile included an initial denaturation of 10 minutes at 95°C, followed by 45 cycles 95°C for 15 seconds and 60°C for 1 minute. Acquisition of the fluorescence signal was set at 60°C during each cycle. Cycle threshold (Ct) values were determined automatically using the ABI SDS software. Positive control samples of purified DNA from the reference strains were B. petussis Tohama I, B. parapertussis 12822 and B. holmesii ATCC 51541; moreover, no template control samples (PCR-grade water) were included in each run. Eukaryotic RnaseP was used as internal control in each tube.

Table 1.

The primers and TaqMan probes was used in this study

Primer and probe name	Sequence (5′→3′)	Final concentration (μM)	Reference
IS481 Fwd	GCCGGATGAACACCCATAAG	0.25	(20)
IS481 Rev	GCGATCAATTGCTGGACCAT	0.25
IS481 probe(FAM)	CGATTGACCTTCCTACGTC-MGB	0.1
IS1001 Fwd	AATTGCTGCAAGCCAACCA	0. 25	(20)
IS1001 Rev	CCAGAGCCGTTTGAGTTCGT	0. 25
IS1001 probe(VIC)	ACATAGACCGTCAGCAG- MGB	0.1
IS1002 Fwd	CTAGGTCGAGCCCTTCTTGTTAAC	0. 25	(20)
IS1002 Rev	GCGGGCAAGCCACTTGTA	0. 25
IS1002 probe(CY5)	CATCGTCCAGTTCTGTTGCATCACCC-BHQ-3	0.1
ptxP Fwd	TTCGTCGTACAAAACCCTCGA	0. 25	(21)
ptxP Rev	GTTCATGCCGTGTTGGATTG	0. 25
ptxP probe(FAM)	CTTCCGTACATCCC-BHQ-1	0.1
hIS1001 Fwd	CCGTGCCAATCGGTAAAGTT	0. 25	(22)
hIS1001 Rev	AAGGGCTGGTTGGCCTGGAGCA	0. 25
hIS1001 probe(FAM)	GTCCTGCGTGACGAACTCAA	0.1
RNaseP Fwd	CCAAGTGTGAGGGCTGAAAAG	0. 25	(23)
RNaseP Rev	TGTTGTGGCTGATGAACTATAAAAGG	0. 25
RNaseP probe(Yakimayellow)	CCCCAGTCTCTGTCACCACTCCC-BHQ-1	0.1

RESULTS

Culture and real-time PCR.

The suspensions of samples were cultured on RL agar for 14 days. However, no colonies were isolated as Bordetella spp. on the RL agar. Considering the high sensitivity of real-time PCR technique, all 435 samples were checked for IS481, IS1001, ptxP and hIS1001. Among the samples, 2 were detected as B. holmesii, which had hIS1001 with Ct value of 37.9 and 37.2, respectively, and also had IS481 with Ct value of 42.4 and 41.4; however, they were negative for IS1001 and ptxP. The results of culture and real-time PCR of the 2 positive samples are demonstrated in Table 2.

Table 2.

Laboratory findings for two patients with pertussis-like syndrome

Patient No.	Culture	IS481	IS1001	IS1002	ptxP	hIS1001	RnaseP[*]
1	-	+ (41.4)	− (UD)	− (UD)	− (UD)	+ (37.9)	+ (28.83)
2	-	+ (42. 4)	− (UD)	− (UD)	− (UD)	+ (39.2)	+ (30.04)

UD means “undetectable”

Eukaryotic RnaseP was used as internal control in each tube

Demographic and clinical characteristics of the patients.

The first case belonged to a 5- month-old female, who was admitted to a general hospital in southwest of Iran (Ahwaz, Khuzestan) in July 2015. Her symptoms were proximal cough and post-tussive vomiting but no fever. This patient had received 2 DTP vaccine doses including whole- cell of pertussis (wP) at 2 and 4 month olds. Prior to hospital admission, she had been injected 2 doses of azithromycin (10 mg/kg per day) by a physician. The second case was a 3- year- old female, who referred to a general hospital in northeast of Iran (Shirvan, khorasan) in June 2015. She had received all the vaccines (She had been injected 4 doses at 2, 4, 6, and 18 month olds.). There was no antibiotic prescription for this patient before sampling. Neither of the patients had splenectomy experience or immunocompromised status. However, we found that the two patients had close contacts with persons that had persistent cough.

DISCUSSION

Bordetella spp can be diagnosed using 2 methods: culture and real-time PCR (12). Cephalexin is widely used in culture medium of Bordetella spp. (eg, Regan–Lowe agar) and it has been acknowledged that it has an inhibitory effect on the growth of B. holmesii, which possibly explains why most laboratories did not identify B. holmesii in nasopharyngeal specimens of patients with pertussis-like symptoms before 2000 (13). Hence, meticillin or oxacillin is preferred to be to add to culture medium instead of cephalexin (14). In this study, no colonies were isolated as B. holmesii on the RL agar (with or without antibiotic in medium). The most difficulties in the isolation of Bordetella spp. are inappropriate techniques of specimen collection, transportation, and detection. Real-time PCR is a sensitive and acceptable assay to detect Bordetella spp. infection. Most of the PCR tests are based on detection of insertion sequences (IS) present in multiple copies per genome, increasing the sensitivity of PCR tests. The IS481 is the target mostly used to detect B. pertussis. However, the IS481, which has been associated with pertussis-like disease, is also present in B. holmesii (15, 16). There are only 2 specific molecular diagnostic approaches available: One for B. pertussis, the target is the sequence of the pertussis toxin gene promoter (17) and the other for B. holmesii, the target is the hIS1001 sequence (18). A retrospective study of 177 samples using real-time PCRs specific for B. pertussis and for B. holmesii showed that B. holmesii DNA was detected in 20.3% of the samples collected from adolescents and adults (8, 9).

The pertussis vaccination program in Iran includes 3 doses of a whole-cell pertussis vaccine together with diphtheria and tetanus toxoid (DTwP) at months 2, 4, and 6 of life and 2 booster doses at 18 months and to 6 years old. The incidence of B. pertussis in Iran was 0.5 cases per 100 000 population in 2008, which was higher than the previous year, 0.19 cases per 100 000 population (19). We believe that the re-emergence of pertussis is overestimated because the infection associated with B. parapertussis and B. holmesii are similar to pertussis infection and have usually been reported as pertussis cases, though they have milder nature and shorter duration. Therefore, accurate diagnosis is the utmost importance in evaluating vaccine efficacy. Interestingly, the mice model has shown that neither whole-cell (wP) cellular (aP) B. pertussis vaccination conferred protection against B. holmesii. Although T-cell responses induced by wP or aP cross-reacted with B. holmesii, vaccine-induced antibodies failed to efficiently bind to B. holmesii (20).

The reservoir of B. holmesii and transmission between humans are currently unknown. However, one report in Japan has demonstrated that 5 patients infected with B. holmesii showed epidemiologic linkage (2). In particular, the fact that 4 of these patients attended the same junior high school suggests that B. holmesii may be transmitted from person to person (2). However, in their conclusions, the authors explained that they did not check for any other causes of clinical symptoms, such as viral or mycoplasma causes. We have reported the first molecular diagnosis of B. holmesii in Iran using real-time PCR. Our observations revealed that accurate diagnosis is needed to discriminate between B. holmesii and B. pertussis infections among pertussis cases because symptoms associated with these 2 diseases are similar. The laboratory capacity limitations to detect B. holmesii from B. pertussis, give raise to the rate of infections associated with B. holmesii, which have been underestimated. Further studies, surveillance enhancement, and precise diagnosis are required to fully elucidate the burden of B. holmesii infections among infants, adolescents and adults.