Literature DB >> 29238285

Generation of an Infectious Clone of a New Korean Isolate of Apple chlorotic leaf spot virus Driven by Dual 35S and T7 Promoters in a Versatile Binary Vector.

Ik-Hyun Kim1, Jae-Yeong Han1, In-Sook Cho2, HyeKyoung Ju1, Jae Sun Moon3,4, Eun-Young Seo1, Hong Gi Kim1, John Hammond5, Hyoun-Sub Lim1.   

Abstract

The full-length sequence of a new isolate of Apple chlorotic leaf spot virus (ACLSV) from Korea was divergent, but most closely related to the Japanese isolate A4, at 84% nucleotide identity. The full-length cDNA of the Korean isolate of ACLSV was cloned into a binary vector downstream of the bacteriophage T7 RNA promoter and the Cauliflower mosaic virus 35S promoter. Chenopodium quinoa was successfully infected using in vitro transcripts synthesized using the T7 promoter, detected at 20 days post inoculation (dpi), but did not produce obvious symptoms. Nicotiana occidentalis and C. quinoa were inoculated through agroinfiltration. At 32 dpi the infection rate was evaluated; no C. quinoa plants were infected by agroinfiltration, but infection of N. occidentalis was obtained.

Entities:  

Keywords:  Apple chlorotic leaf spot virus; T7 promoter; agroinfiltration; full-length infectious cDNA clone; in vitro transcription

Year:  2017        PMID: 29238285      PMCID: PMC5720609          DOI: 10.5423/PPJ.NT.05.2017.0106

Source DB:  PubMed          Journal:  Plant Pathol J        ISSN: 1598-2254            Impact factor:   1.795


Apple (Malus domestica, family Rosaceae), is an important fruit cultivated worldwide. Ten varieties are commonly cultivated commercially in Korea, mainly in Gyeongsang and Chungcheong Provinces, where 92% of Korean apples are produced. High-throughput sequencing methods have recently identified new viruses including Apple stem grooving virus (ASGV), Apple chlorotic leaf spot virus (ACLSV), Apple stem pitting virus (ASPV), Apple green crinkle-associated virus (AGCaV) and Apricot latent virus (Cho et al., 2016), and Apple mosaic virus (ApMV) in Korea (Lee et al., 2002). ACLSV is one of the most economically important viruses because infections can induce yield losses of 30–40% (Cembali et al., 2003; Nemchinov et al., 1995; Wu et al., 1998). Most apple cultivars do not produce obvious symptoms when infected with ACLSV, but we previously identified one sensitive apple cultivar that occasionally showed distinctive symptoms when infected with ACLSV (Han et al., 2015). Apple trees are propagated through grafting, and regularly pruned; therefore, latent ACLSV infections can be transmitted from infected rootstock plants, and through topworking, as there is no known vector. Currently, there are no procedures to certify that apple seedlings or budwood produced in Korea are free of ACLSV (Lee et al., 2013). Production and cultivation of virus-free material is fundamentally important to retard the spread of ACLSV and enhance productivity of apple trees in Korea. It is therefore important to breed and select ACLSV resistant plants, and desirable to have well-characterized local isolates with which to challenge-inoculate breeding stocks. ACLSV is the type species of the genus Trichovirus, and has a single-stranded positive sense RNA genome of 7,474–7,561 nucleotides excluding the poly(A) tail (German et al., 1990; Guo et al., 2016; Sato et al., 1993). The genomic RNA consists of 3 open reading frames (ORFs); ORF1 encodes the replication-associated protein, ORF2 the 50 kDa movement protein, and ORF3 the coat protein. ACLSV has been detected in Chungcheong and Gyeongsang Provinces (Han et al., 2015) by RT-PCR using primers ACLSV_F and ACLSV_R (Menzel et al., 2002), but there is still little information about this emerging virus in Korea. We therefore constructed an infectious clone of ACLSV-GW, originating from Gunwi, Gyeongsangbuk-do. We first designed RACE primers to sequence the 5′ non-coding region (NCR) of ACLSV-GW. Total RNA was extracted from ACLSV PCR-positive tissue using the RNeasy Mini kit (Qiagen Inc., Hilden, Germany) and amplification performed with 5′ RACE system for Rapid Amplification of cDNA Ends, v. 2.0 (Thermo Fisher Scientific Inc., Waltham, MA, USA) by the respective manufacturers’ protocols, using Gene specific primers (GSP) for 5′ RACE PCR (Table 1). PCR conditions were: 5 min at 94°C, followed by 37 cycles of 30 s, 94°C; 30 s, 53°C; and 30 s, 72°C; and 7 min final extension, using Blend Taq® polymerase (TOYOBO Co., Osaka, Japan). Amplified products were purified with MG PCR Product Purification SV (MGMED Inc., Seoul, South Korea), cloned into T-blunt vector Solgent, Daejeon, South Korea, and sequenced (Macrogen Inc, Seoul, South Korea). Based on RACE results of 5′ NCR, and 3′ conserved NCR sequences of other ACLSV isolates, we designed primers SalI_T7_CL_F and T30_XbaI_CL_R (Table 1) to amplify the full length product. Total RNA (1 μg) from ACLSV infected tissue and 1 μg of Oligo dT18 (10 pmol/μl) primer were mixed with RNase-free water to 12 μl, and incubated at 65°C for 5 min. Then 2 μl of dNTPs (10 mM each), 1 μl RNase inhibitor, 4 μl 5× RT buffer, and ReverTra Ace-α-® (TOYOBO Co., Ltd.) were added to the RNA-primer mixture for cDNA synthesis, incubated at 50°C for 20 min, and the reaction terminated at 99°C for 5 min. The subsequent PCR mixture consisted of 1 μl cDNA, 25 μl 2× buffer, 1 μl SalI_T7_CL_F (10 pmol) and 1 μl T30_XbaI_CL_R (10pmol) (Table 1), 10 μl 2 mM dNTPs, 1 μl KOD FX neo (TOYOBO Co., Ltd.), and 11 μl distilled water. PCR conditions were: 2 min at 94°C, and 33 cycles of 10 s, 98°C; 30 s, 63°C; and 4 min, 68°C. PCR products were purified as above, digested with SalI and XbaI, cloned into binary vector pGD (Goodin et al., 2002; Fig. 1), and the cloned sequence of ACLSV-GW determined (Macrogen Inc.; GenBank accession number KX506849). A phylogenetic tree was constructed by the maximum-likelihood method with 1,000 bootstrap replicates, using MEGA version 6 (Tamura et al., 2013), to compare ACLSV-GW to 14 full-length ACLSV sequences available from NCBI GenBank. The full sequence of Cherry mottle leaf virus (CMLV; Trichovirus) was used as outgroup for the phylogenetic tree. Sequence alignment was performed using Clustal Omega and DNAMAN (Lynnon LLC, San Ramon, CA, USA).
Table 1

Primers used in this study

NameSequence (5′ → 3′)FeatureExpected size
SalI_T7_CL_FAAAGTCGACTAATACGACTCACTATAGGATACTGATACAGTGTACACTCACSalIT7 Promoter (For amplify the full length ACLSV)7,590 bp
T30_XbaI_CL_RGAGTCTAGATTTTTTTTTTTTTTTTTTTTTTTTTTTTTTG-TAGTAAAATATTTAAAAGTCTACAGGCXbaI
GSP1TCAATTGAGATGTCAGCATCFor 5′ Race PCR (cDNA synthesis)-
GSP2GGTTCTCCAGAGTTTTGCAACFor 5′ Race PCR392 bp With Abridged Anchor Primer
CL_qPCR_FATGTGGTCGTGGAGGTCAAFor Real-time qRT-PCR110 bp
CL_qPCR_RCGGGTCCGAAGATGTAGTC
ACLSV_FTTCATGGAAAGACAGGGGCAAFor RT-PCR (Menzel et al., 2002)677 bp
ACLSV_RAAGTCTACAGGCTATTTATTATAAGTCTAA
Fig. 1

Diagram of construction of infectious clone of ACLSV-GW. The entire genome of Apple chlorotic leaf spot virus (ACLSV) was amplified. The amplified ACLSV sequence has an added SalI restriction enzyme site and T7 promoter sequence at its 5′ terminus and XbaI restriction enzyme site at its 3′ terminus. This product was cloned with binary vector pGD.

Sequence analysis indicated that ACLSV-GW is most closely related to Japanese isolate A4 (84% identity); four further isolates from Japan, India and China having > 80% nucleotide identities (Fig. 2) also fell within a clade of isolates from apple. Two other clades included isolates from stone (plum and peach) or pome fruit (apple, pear, and hawthorn), with a monophyletic clade of a peach isolate from the USA (Fig. 2). There is considerable diversity between isolates of ACLSV from different regions and hosts (e. g., Al Rwahnih et al., 2004; Katsiani et al., 2014), ranging from 67.2–90.2% full genome nucleotide identity (Guo et al., 2016; Niu et al., 2012). Based on the observed sequence identities and trade practices, we suggest that ACLSV-GW may be derived from apple graft-propagated material originally cultured in Japan.
Fig. 2

Phylogenetic tree based on Apple chlorotic leaf spot virus full-length genome sequences. The tree was constructed with MEGA 6.0 using the maximum-likelihood method with 1,000 bootstrap replicates; 14 full-length genome sequences of additional strains of ACLSV were obtained from National Center for Biotechnology Information (GenBank). The labels indicate Accession number/name of strain/country/host. The numbers at the nodes are bootstrap values above 50%. The scale bar indicates the number of nucleotide substitutions. The black arrow indicates an ACLSV-GW sequence.

An infectious clone of Japanese ACLSV isolate P-205 driven by the 35S promoter was infectious to C. quinoa by either biolistic or mechanical inoculation (Satoh et al., 1999); additional clones of P-205 driven separately by either the T7 or 35S promoters were infectious to C. quinoa (T7 transcripts; 35S, biolistic and agroinoculation), N. occidentalis (35S, biolistic and agroinoculation), and peach seedlings (35S, agroinfiltration) (Youssef et al., 2011). In our experiments we cloned a full-length Korean ACLSV isolate in a binary vector containing both the 35S and T7 promoters for versatile use by in vitro transcription or agroinfiltration from a single construct. For in vitro transcription plasmid DNA was linearized by digestion with XbaI, extracted twice with phenol/chloroform, then purified with MG PCR Product Purification SV. The transcription mixture contained 4 μg linearized plasmid DNA, 10 μl Transcription Optimized 5× Buffer, 5 μl 100 mM DTT, 50 units Promega, Madison, WI, USA, 5 μl rNTP capping mix, 5 μl 5 mM Ribo m7G Cap Analog, 40 units T7 RNA polymerase, and RNase free water to 50 μl. The mixture was incubated at 37°C for 1 h, and then an additional 20 units of T7 RNA polymerase added and incubated for 1 h longer. The integrity of transcribed RNA was evaluated by electrophoresis of an aliquot through a 1% agarose gel. The remainder of the mixture was precipitated with ethanol and eluted with 30 μl of GKP buffer pre-warmed to 58°C. Two leaves per C. quinoa plant were rubbed with 5 μl each of transcribed RNA. After 10 min, inoculated leaves were washed with distilled water. At 20 days post inoculation (dpi), total RNA of newly developed leaves near the top of plants were extracted by TRI Reagent® (Molecular Research Center Inc., Cincinnati, OH, USA) according to the manufacturer’s protocol and cDNAs were synthesized as described above. RT-PCR for detection was carried out as reported (Han et al., 2015). Fig. 3 shows leaves of C. quinoa inoculated with in vitro transcripts; although no obvious visible symptom were produced, RT-PCR of upper leaves yielded positive results, and bioassay verified that the leaves without symptoms contained infectious virus.
Fig. 3

C. quinoa mock-inoculated with GKP buffer (A, C) and inoculated with RNA transcripts of ACLSV-GW (B, D) 20 days post inoculation. (C, D) Close-up views of upper uninoculated leaf (no symptoms but RT-PCR and bioassay positive for D). (E) RT-PCR of in vitro transcript inoculated C. quinoa. Lane 1) Healthy plant, 2) ACLSV transcript inoculated plant, 3) Mock inoculated plant, and 4) positive control for PCR reaction using ACLSV plasmid DNA.

Previously, versatile binary vectors containing both the 35S and T7 promoters were used to construct infectious clones of AltMV, PVX, TuMV, and CGMMV (Lim et al., 2010; Park et al., 2017 and unpublished). However, a dual purpose ACLSV infectious clone has not previously been produced. C. quinoa and N. occidentalis were agroinfiltrated with pGD:ACLSV at inoculum concentrations of 0.6, 0.8, and 1.0 OD600 mixed with 1/10 volume of pGD:R007 HC-Pro (Han et al., 2016) at 0.6 OD600. At 32 dpi, young upper leaves were assayed for ACLSV infection by real-time qRT-PCR. Total RNAs of C. quinoa and N. occidentalis were extracted with Molecular Research Center Inc., Cincinnati, OH, USA and then with phenol; cDNA was synthesized from 500 ng total RNA. The qRT-PCR mixture consisted of 1 μl of cDNA, 10 μl of iQ™ SYBR® Green supermix (2X) (Bio-Rad Laboratories Inc., Hercules, CA, USA), 0.5 μl each of CL_qPCR_F and CL_qPCR_R (10 pmol) (Table 1), and 8 μl distilled water; qRT-PCR conditions were: 3 min at 95°C, 40 cycles of 10 s 95°C, 10 s 58°C, and 20 s 72°C, followed by melting at 0.5°C increments from 65°C to 95°C. No infection of C. quinoa was obtained by agroinfiltration, but two of twelve N. occidentalis plants inoculated with 0.8 OD600 pGD:ACLSV were infected with ACLSV-GW (Table 2). As for C. quinoa, no obvious symptoms were observed (Fig. 4), but qRT-PCR yielded positive results.
Table 2

Detection of ACLSV-GW using quantitative real-time RT-PCR

N. occidentalis (Ct value)C. quinoa (Ct value)
1N/D*N/D
2N/DN/D
3N/DN/D
4N/DN/D
526.76 ± 0.04N/D
6N/DN/D
7N/DN/D
8N/DN/D
9N/DN/D
10N/DN/D
1122.18 ± 0.04N/D
12N/DN/D
Negative controlN/DN/D
Positive control12.44 ± 0.0513.20 ± 0.04

N/D: Not detected.

Three replicates of each sample (71 ng of each cDNA sample).

Fig. 4

Healthy Nicotiana occidentalis (A, C) and N. occidentalis infected with ACLSV-GW by agroinfiltration (B, D) 32 days post inoculation (no symptoms but RT-PCR and bioassay positive). Entire views (A, B) and close-up views (C, D) of plants.

These results contrast with those of Youssef et al. (2011), who were able to infect C. quinoa, but not N. occidentalis, by transcript inoculation in parallel experiments. It may be that host-specific adaptations of the ACLSV genome affect the ability to infect these two hosts (Youssef et al., 2011). We report here rapid generation of a full-length infectious clone for both in vitro transcription and agroinfiltration inoculation of ACLSV using a single construct. Due to their long cropping cycle, frequent trade of propagation material with neighboring countries, and now also climate change, tree-fruit crops remain susceptible to introduction of new virus isolates. Our method for generation of a full length ACLSV infectious clone suitable for both transcript inoculation and agroinfiltration could be useful for studies in woody crop plants such as apple and pear, and, for ACLSV and other viruses, especially for the validation of rapid selection in breeding programs to select lines with resistance against emerging viruses. Whereas we have not yet tested direct inoculation of apple, Youssef et al. (2011) were able to infect peach seedlings by agroinfiltration, suggesting that either direct agroinfiltration or inoculation of apple from N. occidentalis tissue in which infection was established by agroinfiltration will be possible.
  12 in total

1.  Complete nucleotide sequences of the genomes of two isolates of apple chlorotic leaf spot virus from peach (Prunus persica) in China.

Authors:  Feiqing Niu; Song Pan; Zujian Wu; Dongmei Jiang; Shifang Li
Journal:  Arch Virol       Date:  2012-01-26       Impact factor: 2.574

2.  MEGA6: Molecular Evolutionary Genetics Analysis version 6.0.

Authors:  Koichiro Tamura; Glen Stecher; Daniel Peterson; Alan Filipski; Sudhir Kumar
Journal:  Mol Biol Evol       Date:  2013-10-16       Impact factor: 16.240

3.  Comparison of helper component-protease RNA silencing suppression activity, subcellular localization, and aggregation of three Korean isolates of Turnip mosaic virus.

Authors:  Jae-Yeong Han; Jinsoo Chung; Jungkyu Kim; Eun-Young Seo; James P Kilcrease; Gary R Bauchan; Seungmo Lim; John Hammond; Hyoun-Sub Lim
Journal:  Virus Genes       Date:  2016-04-08       Impact factor: 2.332

4.  Efficiency of VIGS and gene expression in a novel bipartite potexvirus vector delivery system as a function of strength of TGB1 silencing suppression.

Authors:  Hyoun-Sub Lim; Anna Maria Vaira; Leslie L Domier; Sung Chul Lee; Hong Gi Kim; John Hammond
Journal:  Virology       Date:  2010-04-09       Impact factor: 3.616

5.  Nucleotide sequence and genomic organization of apple chlorotic leaf spot closterovirus.

Authors:  S German; T Candresse; M Lanneau; J C Huet; J C Pernollet; J Dunez
Journal:  Virology       Date:  1990-11       Impact factor: 3.616

6.  Complete nucleotide sequences and construction of full-length infectious cDNA clones of cucumber green mottle mosaic virus (CGMMV) in a versatile newly developed binary vector including both 35S and T7 promoters.

Authors:  Chan-Hwan Park; Hye-Kyoung Ju; Jae-Yeong Han; Jong-Seo Park; Ik-Hyun Kim; Eun-Young Seo; Jung-Kyu Kim; John Hammond; Hyoun-Sub Lim
Journal:  Virus Genes       Date:  2016-12-02       Impact factor: 2.332

7.  pGD vectors: versatile tools for the expression of green and red fluorescent protein fusions in agroinfiltrated plant leaves.

Authors:  Michael M Goodin; Ralf G Dietzgen; Denise Schichnes; Steven Ruzin; Andrew O Jackson
Journal:  Plant J       Date:  2002-08       Impact factor: 6.417

8.  Strategies to facilitate the development of uncloned or cloned infectious full-length viral cDNAs: Apple chlorotic leaf spot virus as a case study.

Authors:  Fater Youssef; Armelle Marais; Chantal Faure; Pascal Gentit; Thierry Candresse
Journal:  Virol J       Date:  2011-10-31       Impact factor: 4.099

9.  Deep Sequencing Analysis of Apple Infecting Viruses in Korea.

Authors:  In-Sook Cho; Davaajargal Igori; Seungmo Lim; Gug-Seoun Choi; John Hammond; Hyoun-Sub Lim; Jae Sun Moon
Journal:  Plant Pathol J       Date:  2016-10-01       Impact factor: 1.795

10.  Genome Sequences of Three Apple chlorotic leaf spot virus Isolates from Hawthorns in China.

Authors:  Wei Guo; Wenyan Zheng; Mei Wang; Xiaohong Li; Yue Ma; Hongyan Dai
Journal:  PLoS One       Date:  2016-08-12       Impact factor: 3.240

View more
  1 in total

1.  Full-Length Infectious Clones of Two New Isolates of Tomato Mosaic Virus Induce Distinct Symptoms Associated with Two Differential Amino Acid Residues in 128-kDa Protein.

Authors:  Go-Woon Choi; June-Pyo Oh; In-Sook Cho; Hye-Kyoung Ju; Wen-Xing Hu; Boram Kim; Eun-Young Seo; Jong-Seok Park; Leslie L Domier; John Hammond; Kihak Song; Hyoun-Sub Lim
Journal:  Plant Pathol J       Date:  2019-10-01       Impact factor: 1.795

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.