Literature DB >> 29225754

Methicillin resistance and selective genetic determinants of Staphylococcus aureus isolates with bovine mastitis milk origin.

Zohreh Ahangari1, Masoud Ghorbanpoor1, Masoud Reza Seifiabad Shapouri1, Darioush Gharibi1, Kiarash Ghazvini2,3.   

Abstract

BACKGROUND AND OBJECTIVES: Staphylococcus aureus is one of the major causes of bovine mastitis, which can be transmitted from animals to humans. Methicillin-resistant S. aureus (MRSA) isolates are more attentive and if not treated promptly, they can cause death. The aim of this study was to determine the prevalence of methicillin resistance and frequency of selected virulence factors of S. aureus isolates with bovine mastitis milk origin in Ahvaz, southwest of Iran.
MATERIALS AND METHODS: During a two-year period (2014-2015), 75 S. aureus isolates were recovered from referred clinical and sub-clinical bovine mastitis milk samples. The isolates were phenotypically investigated for resistance to cefoxitin by Kirby-Bauer method. DNA were analyzed by PCR for mecA and selected genes that encode the virulence factors.
RESULTS: According to the results, the spa, ebpS, fnb, bbp, clfA, clfB, and cna genes were detected in 98.7, 97.3, 97.3, 86.7, 84, 84 and 65.3% of the isolates, respectively. Among the 75 isolates, only one (1.3%) isolate was methicillin-resistant. Totally, 39 isolates (50.7%) had all of these virulence factors except mecA. The results showed that 96% of the isolates had at least the fnb, ebpS and spa genes, signifying the noteworthy role of these genes in the pathogenesis of S. aureus bovine intra-mammary infection in this area.
CONCLUSION: In the present study, the prevalence of mecA was relatively low, possibly indicating that cows do not play a significant role in community-acquired MRSA infection in this area. According to the results, studied virulence factors were somewhat prevalent, bearing in mind the probable risk of transmission of these isolates from cows to humans, especially those that are in close contact with infected cattle. The data presented here can be used for the introduction of a protective vaccine against this infection.

Entities:  

Keywords:  Bovine mastitis; Methicillin resistance; Staphylococcus aureus; Virulence factor

Year:  2017        PMID: 29225754      PMCID: PMC5719509     

Source DB:  PubMed          Journal:  Iran J Microbiol        ISSN: 2008-3289


INTRODUCTION

Staphylococcus aureus is a Gram-positive bacterium and one of the most important pathogenic coagulase positive staphylococci in humans and animals. This agent can cause various diseases in humans such as endocarditis, pneumonia, and life-threatening septicemia (1). In animals, S. aureus is responsible for a range of diseases, including mastitis, which cause considerable economic losses in the animal husbandry industry (2). S. aureus may be transmitted from animal or animal products to human (3). S. aureus isolates which are resistant to semi-synthetic β-lactam antibiotics are known as MRSA. Usually, MRSA isolates possess a gene (mecA) to inactivate many antibiotics, including β-lactam drugs. Although the presence of mecA gene is closely related to the resistance to β-lactams, there are reports of mecA-negative MRSA (4). Some reports show (5, 6) that MRSA strains are expanding, and there are concerns about the treatment of the diseases caused by these isolates. Although the most common type of MRSA infection is hospital-acquired, but the community-acquired type of MRSA infection has been widely observed during the past decade (7). It has been shown that S. aureus is a major cause of contagious bovine mastitis (8, 9). Antibiotic treatment of staphylococcal mastitis has often been ineffective, owing to the development of antibiotic-resistant strains, such as MRSA (10). Therefore, the introduction of new prevention methods is highly recommended. S. aureus possesses many virulence factors. The majority of them are in the form of cell surface proteins. Matrix adhesion molecules, as one of the most common categories of surface proteins, mediating bacterial binding to host tissue and the extracellular matrix, such as collagen, fibronectin and fibrinogen (1). The binding is the first step of staphylococcal infection, so S. aureus surface components such as elastin binding protein (EbpS), collagen binding protein (Cna), fibronectin binding proteins A and B (FnbA, FnbB), fibrinogen binding protein (Fib), clumping factor A and B (ClfA, ClfB), and bone sialoprotein binding protein (Bbp) have an important role in colonization of this agent (1, 11, 12). The presence of these surface proteins is critical to the success of the organism as a commensal bacterium and as a pathogen (1). Staphylococcal protein A (SpA) is a multifunctional surface protein that is bound to an FC fragment of IgG of numerous mammalian species (human, mouse, rabbit, ruminants), causing immune evasion (13) and can act as a B-cell super-antigen (1, 14). It is, therefore, an important S. aureus virulence factor. During the past decade, community-acquired MRSA infection has been increasingly observed, urging to highlight the role of animals in this type of infection. On the other hand, S. aureus can express many virulence factors, including surface proteins like adhesions that are covalently attached to peptidoglycan. Study of the prevalence of these proteins in any area is important in defining biomarkers that can be used for diagnostic purposes and in identifying potential vaccine specific for that region. In Iran, data on the genotypic and phenotypic characteristics of S. aureus isolates with bovine origin are very limited. The aim of this study was to determine the prevalence of some of the virulence factors of S. aureus isolates with bovine mastitis milk origin in Ahvaz, southwest of Iran. This data is essential for improving our understanding of pathogenesis and risk of interspecies transmission as well as adopting a proper preventive approach for this infection.

MATERIALS AND METHODS

Sample collection.

During a two-year period (2014–2015), referred clinical and sub-clinical bovine mastitis milk samples were inoculated on blood agar. After 24–48 h of incubation at 37°C, isolated colonies were examined by Gram staining under microscope for their morphological characters. The Gram-positive cocci were sub-cultured on blood agar plates. Suspected staphylococcal isolates were identifed by biochemical tests and oxidase negative, and catalase, coagulase and D-mannitol positive isolates were considered as probable S. aureus isolates (15).

Molecular confirmation of suspected S. aureus isolates.

All probable S. aureus isolates and a standard MRSA strain (ATCC 33591) as a positive control were examined for the presence of aroA gene by PCR amplification with a pair of specific primers for aroA, which encodes 5-enolpyruvylshikimate-3-phosphate synthase (16). In order to extract the whole bacterial DNA, 3–5 colonies of each isolates were suspended in 200 microliter of sterile deionized water and heated at 100°C for 10 minutes. In order to remove the sediment and collect the supernatant, containing the crude extract of bacterial DNA for PCR amplification, the tubes were centrifuged at 10000 rpm for 5 minutes (17). For aroA amplification, the reaction was performed in a final volume of 25 μl containing: 12.5 μl of the 2x Master Mix with 1.5 mM MgCl2 final concentration (Amplicon, Denmark), 1 μl (20 mM) of each aroA specific primers (Bioneer, South Korea), 3 μl DNA template (about 300 ng) and distilled water up to final volume of 25 μl in 0.2 ml reaction tube. The tubes were subjected to thermal cycling (Eppendorf, Mastercycler® 5330, Germany) using the program shown in Table 1. The PCR products were analyzed by gel electrophoresis using 1% agarose gel containing safe stain (Sinaclon, Iran) and visualized by trans-illuminator (Uvitec, England). The size of the amplified products was estimated by comparison with a DNA ladder (Fermentas, USA). The aroA positive isolates were considered as S. aureus and the DNA stored at −70°C, for analysis of selected virulence factors.
Table 1.

List of primer sequences and thermal conditions used for amplification of selective genetic determinants in S. aureus isolates with bovine mastitis milk origin

GenePrimerSequenceSizePCR Cycling ConditionsReference
aroAForwardAAGGGCGAAATAGAAGTGCCGGGC128395°C-2 min; 40 × (95°C-60 s, 58°C-60 s, 72°C-90 s); 72°C-10 min.16
ReverseCACAAGCAACTGCAAGCAT

fnbForwardTACCATACTGCTGTGGATAGYGAA82295°C-5 min; 30 × (95°C-30 s, 60°C-30 s, 72°C-60 s); 72°C-5 min.19
ReverseTTAGCTTACTTTTGGAAGTGTATCTTCTTC
bbpForwardTCAAAAGAAAAGCCAATGGCAAACG50020
ReverseACCGTTGGCGTGTAACCTGCTG

clfAForwardATTGGCGTGGCTTCAGTGCT28895°C-5 min; 30 × (95°C-30 s, 55°C-30 s, 72°C-30 s); 72°C-5 min.21
ReverseCGTTTCTTCCGTAGTTGCATTTG
clfBForwardACATCAGTAATAGTAGGGGCAAC204
ReverseTTCGCACTGTTTGTGTTTGCAC

cnaForwardTTCACAAGCTTGGTATCAAGAGCATGG45095°C-5 min; 30 × (95°C-30 s, 60°C-30 s, 72°C-30 s); 72°C-5 min.20
ReverseGAGTGCCTTCCCAAACCTTTTGAGC
spaForwardATATCTGGTGGCGTAACACCTGCTG21122
ReverseCGCATCAGCTTTTGGAGCTTGAGAG

ebpSForwardGCAAGTAATAGTGCTTCTGCCGCTTCA55095°C-5 min; 30 × (95°C-30 s, 61°C-30 s, 72°C-45 s); 72°C-5 min.20
ReverseCATTTTCCGGTGAACCTGAACCGTAGT

mecAForwardGTAGAAATGACTGAACGTCCGATAA30795°C-5 min; 30 × (95°C-30 s, 50°C-30 s, 72°C-30 s); 72°C-5 min.21
ReverseAATTCCACATTGTTTCGGTCTAA
List of primer sequences and thermal conditions used for amplification of selective genetic determinants in S. aureus isolates with bovine mastitis milk origin

Phenotypic detection of MRSA.

Screening of S. aureus isolates for detection of phenotypic methicillin-resistant strains was performed by antibiotic susceptibility test, using 30 μg cefoxitin discs (padtanteb, Iran) on Mueller Hinton Agar (Himedia, India) by disc diffusion (Kirby-Bauer) method, according to the guidelines of clinical and laboratory standards institute (CLSI) (18). According to CLSI recommendation, complete inhibition zone diameter of ≤21mm was considered as S. aureus mecA positive and those with an inhibition zone of >22 mm were as mecA negative. A standard MRSA strain (ATCC 33591) was used as positive control.

Molecular detection of virulence genes.

The presence of seven virulence-related genes (clfA, clf B, spa, fnb, bbp, ebpS and cna) and a methicillin-resistant mediated (mecA) gene was investigated in 75 S. aureus isolates with bovine mastitis milk origin. To detect virulence factors, a duplex or monoplex PCR was performed with specific primers and thermal conditions listed in Table 1. The reaction mixture was the same, as for the amplification of aroA gene except for using specific primers of each selected gene(s). The PCR conditions for the amplification of genes are presented in Table 1. A standard S. aureus (ATCC 33591) and distilled water were used as positive and negative controls, respectively. The PCR products and a DNA ladder (Fermentas, USA) were loaded in a 1.5% agarose gel containing safe stain. The DNA bands were visualized using trans-illuminator (Uvitec, England).

RESULTS

Out of 78 biochemically-suspected S. aureus isolates, 75 were aroA positive and confirmed as S. aureus. The products of PCR amplification of aroA gene in all isolates were uniform in size, approximately 1283bp (Fig. 1).
Fig. 1.

Agarose gel electrophoresis of the PCR products for amplification of aroA in S. aureus suspected isolates, Lanes 1 and 3: negative and positive controls, respectively, lanes 4–6, aroA positive isolates and lane 2, 100bp ladder

Agarose gel electrophoresis of the PCR products for amplification of aroA in S. aureus suspected isolates, Lanes 1 and 3: negative and positive controls, respectively, lanes 4–6, aroA positive isolates and lane 2, 100bp ladder

Phenotype and genotype detection of methicillin-resistant S. aureus.

Screening of 75 S. aureus isolates for detection of phenotypic methicillin-resistant strains showed that only 1 (1.3%) isolate was resistant to methicillin and had a complete inhibition zone diameter of 15 mm. PCR amplification of mecA confirmed the presence of mecA gene in this strain (Fig. 2).
Fig. 2.

Agarose gel electrophoresis of the PCR products for amplification of mecA in suspected MRSA Lane 1: positive control S. aureus (ATCC 33591), lane 2: MRSA isolate, lanes 3, 4 negative mecA isolates, lane 6: negative control and lane 5, 100bp ladder.

Agarose gel electrophoresis of the PCR products for amplification of mecA in suspected MRSA Lane 1: positive control S. aureus (ATCC 33591), lane 2: MRSA isolate, lanes 3, 4 negative mecA isolates, lane 6: negative control and lane 5, 100bp ladder.

Frequency and distribution of virulence determinants.

The results of the detection of virulence determinants (clfA, clf B, spa, fnb, bbp, ebpS and cna) in S. aureus isolates using PCR are shown in Figs. 3 and 4.
Fig. 3.

Agarose gel electrophoresis of the PCR products for detection of clfA, clfB, cna and spa gene of some S. aureus isolates, Lanes 1 and 3 negative and positive controls for clfA and clfB genes, lanes 4 and 5, clfA+ clfB+ isolates, lanes 6 and 8 negative and positive controls for cna and spa genes, lane 9 and 10, cna+ spa+ and spa+ isolates respectively, lanes 2 and 7, 100bp ladder.

Fig. 4.

Agarose gel electrophoresis of the PCR products for detection of fnb, bbp and ebpS gene of some S. aureus isolates, Lanes 1 and 3 negative and positive controls for fnb and bbp genes, lanes 4 and 5, fnb+ bbp+ isolates, lanes 6 and 8 negative and positive controls for ebpS gene, lane 9 and 10, ebpS+ and ebpS− isolates, respectively. lanes 2 and 7, 100bp ladder.

Agarose gel electrophoresis of the PCR products for detection of clfA, clfB, cna and spa gene of some S. aureus isolates, Lanes 1 and 3 negative and positive controls for clfA and clfB genes, lanes 4 and 5, clfA+ clfB+ isolates, lanes 6 and 8 negative and positive controls for cna and spa genes, lane 9 and 10, cna+ spa+ and spa+ isolates respectively, lanes 2 and 7, 100bp ladder. Agarose gel electrophoresis of the PCR products for detection of fnb, bbp and ebpS gene of some S. aureus isolates, Lanes 1 and 3 negative and positive controls for fnb and bbp genes, lanes 4 and 5, fnb+ bbp+ isolates, lanes 6 and 8 negative and positive controls for ebpS gene, lane 9 and 10, ebpS+ and ebpS− isolates, respectively. lanes 2 and 7, 100bp ladder. Evaluation of 75 S. aureus isolates for the presence of the spa, clfA, clf B, bbp, fnb, can, ebpS and mecA genes showed that the spa with 98.7% prevalence is the most common evaluated gene. The fnb and ebpS genes with an equal prevalence of 97.3% were also amongst the most prevalent genes of these isolates. The prevalence of clfA and clf B were equally 84% and bbp and cna with the respected prevalence of 86.7% and 65.3% were the least common analyzed genes. Accordingly, 38 isolates (50.7%) possessed all of these virulence factors except mecA. Based on the results, 96% of the tested isolates have at least the fnb, ebpS and spa genes, indicating the important role of these genes in the pathogenesis of bovine S. aureus mastitis in southwest of Iran. Among the 75 isolates, only 1 (1.3%) was both phenotypically and genotypically methicillin-resistant. The prevalence of selected virulence-related genotypes in tested isolates is listed in Table 2.
Table 2.

Frequency of selected virulence-related genotypes in 75 isolates of S. aureus with bovine mastitis origin

GenotypesNumber in 75 isolates (Percentage)
clfA+, clfB+, spa+, cna+, fnb+, bbp+, ebpS+38 (50.7)
clfA+, clfB+, spa+, fnb+, bbp+, ebpS+17 (24)
spa+, cna+, fnb+, bbp+, ebpS+6 (8)
clfA+, clfB+, spa+, fnb+, ebpS+3 (4)
spa+, cna+, fnb+, ebpS+2 (2.7)
clfA+, clfB+, spa+, cna+, fnb+, ebpS+1 (1.3)
clfA+, clfB+, fnb+, bbp+, ebpS+1 (1.3)
clfA+, clfB+, spa+, fnb+, ebpS+1 (1.3)
spa+, fnb+, bbp+, ebpS+1 (1.3)
spa+, cna+, fnb+, ebpS+1 (1.3)
clfA+, clfB+, spa+, ebpS+1 (1.3)
clfA+, clfB+, spa+1 (1.3)
spa+, fnb+, ebpS+, mecA+1 (1.3)
spa+, fnb+, bbp+1 (1.3)
Frequency of selected virulence-related genotypes in 75 isolates of S. aureus with bovine mastitis origin

DISCUSSION

S. aureus is the most frequent opportunistic pathogen in humans and one of the major causes of chronic and sub-clinical mastitis in dairy cattle. The present study was performed since there was limited data on virulence factors of S. aureus with bovine mastitic milk origin in southwest of Iran. The resistance of S. aureus against various antibiotics is a critical concern worldwide, but the methicillin resistance is the most well studied characteristic of this agent. MRSA usually spreads from human to human, but its transmission from animal to human is also possible (24, 25). Although MRSA has increasingly been recognized in farm animal populations in recent years, limited data is available with respect to the prevalence of MRSA in bovine mastitis milk sample in Iran. Our results suggest that there is a low prevalence (1.3%) of MRSA isolates in mastitis milk samples. This is consistent with studies of Virgin et al. (26) and Haran et al. (27) in USA and Hata et al. (28) in Japan, reporting the prevalence of 1–2% for MRSA. This sampling protocol, in addition to the selective double enrichment protocol for MRSA, may account for success in detecting MRSA and the higher rates of prevalence of MSSA isolates compared to previous studies. In contrast to our finding, Kumar et al. 2011 (29) in India reported a 9.3% (10 of 107 isolates) prevalence for mecA positive S. aureus isolates from bovine mastitis milk. Such relatively high prevalence (16.7%) has also been reported in studies of Havaei et al. (30) in Esfahan, Iran. The inconsistency may be due to the difference in methodology, time and location of the studied area. S. aureus can produce a group of other virulence factors, including adhesions factors needed for bacterial attachment to the host epithelial surfaces that is essential for the colonization, as the first step for initiation of infection. Therefore, identification of major virulence factors such as adhesins and determination of their frequency in isolates of S. aureus in any particular area is necessary for vaccine development. A vaccine that induce an efficient immune response to these proteins could be efficient against different S. aureus strains that use adhesins for colonization (31, 32). Recently, few studies have been performed regarding S. aureus derived from bovine or ovine mastitis. In this regard, Momtaz et al. (33) detected some virulence factors of S. aureus isolates from clinical and subclinical bovine mastitis samples in the center of Iran. Saei et al. (34) detected some virulence genes of S. aureus isolates with ovine mastitis origin in the northwest of Iran. S. aureus protein A is a major virulence factor that is responsible for evasion from host immune responses (14). In the present research, the prevalence of this gene was 98.7%, showing the significant role of this gene in virulence of the tested S. aureus isolates. Consistent with this finding, in the studies of Momtaz et al. (33) in center of Iran, Klein et al. (35) in Brazil and Gogoi-Tiwari et al. (36) in Australia, the prevalence of this gene in S. aureus isolates in dairy bovine mastitis milk sample was reported to be 80.2%, 85.9% and 87.7%, respectively. The fnb and ebpS with a similar prevalence of 97.3% were the second most prevalent virulence genes in the present study. In relative consistency with our finding, the frequency of fnb in comparable studies in other countries was reported to be 56% to 96% (35–37). Based on the study of Saei et al. (34) on S. aureus isolates from ovine mastitis in the northwest of Iran, the frequency of fnbA and fnbB were 90% and 77.7%, respectively. In contrast to the results of present study, the ebpS were detected in 25% of S. aureus isolates with bovine mastitis in Poland (38). However, consistent with our findings, Ikawaty et al. (37) found ebpS in all of the tested isolates. It seems that these two genes have a critical role in the pathogenesis of mastitis in animals. S. aureus may interact with bone sialoprotein, a glycoprotein of bone, and dentine extracellular matrix to colonize at the site of infection (39). In our study, 86.9% of isolates possessed the bbp gene, but in similar research in Australia (34), this gene was detected in only 9.1% of isolates. However, Puacz et al. (40) reported the presence of 93.9% of this gene in S. aureus derived from bovine mastitis in central-eastern Poland. Our result revealed that the frequency of clfA and clfB in examining isolates is equally 84%. The prevalence of clfA in isolates with bovine mastitis was reported to be 19%–100% and clfB was detected in 91.8%–92.9% of the isolates (33, 35–37). Although cna is a major virulence factor in staphylococcal diseases, this gene had the lowest frequency (65.3%) in the tested isolates. Consistent with this finding, the prevalence of this gene in the study of Gogoi-Tiwari et al, (36), Ikawaty et al. (37) and Klein et al. (35) was reported to be 31.2%, 49% and 22.4%, respectively. Rhem et al. (41) and Elasri et al. (42) stated the role of the Cna protein in the osteomyelitis due to S. aureus, but according to the study of Elasri et al. (42), this protein does not have any important contribution in human skeletal muscle infections, though it contributes to human S. aureus keratitis. Consequently, cna may not play an important role in the pathogenesis of bovine mastitis due to S. aureus. According to our findings, 75 isolates of S. aureus from bovine mastitis milk samples could be grouped in 14 genotype profiles, based on the selected following genes (Table 2) and the most frequent profile with a prevalence of 50.7% belongs to the one that possessed at least 7 of 8 selected genes. These findings confirm the inconsistency of this bacterium in the southwest of Iran and help us in establishing a suitable protective approach to decrease the occurrence of this important disease in dairy farms. Similarly, based on 7 genes, Coelho et al. (43) reported 27 different profiles for S. aureus isolates recovered from intra-mammary infections amongst 25 dairy cattle farms in Rio de Janeiro, Brazil. In conclusion, although S. aureus isolates with bovine mastitis origin differ in their genetic profile in the southwest of Iran, 96% of all isolates simultaneously possessed fnb, ebpS and spa genes, representing the significant role of these genes in pathogenesis of bovine intra-mammary infection due to prevalence of S. aureus in this area. This can help in the exploration and control of S. aureus mastitis in bovine dairy farms. Whether the comparative prevalence of selected virulence genes of S. aureus is applicable to the introduction of a protective vaccine against staphylococcal bovine mastitis, cannot be deducted from the data existing in this research. However, it may be useful bearing in mind this evidence, in the development of an effective vaccine against this important disease. On the other hand, it seems that in tested area, the risk for the spread of MRSA from bovine sources into the human population will be low. However, high risk persons who are in close contact with MRSA-infected cattle, including veterinarians, slaughterhouse staff, and livestock workers, may get infected with bovine mastitis milk.
  35 in total

Review 1.  Adhesion, invasion and evasion: the many functions of the surface proteins of Staphylococcus aureus.

Authors:  Timothy J Foster; Joan A Geoghegan; Vannakambadi K Ganesh; Magnus Höök
Journal:  Nat Rev Microbiol       Date:  2014-01       Impact factor: 60.633

2.  A bone sialoprotein-binding protein from Staphylococcus aureus: a member of the staphylococcal Sdr family.

Authors:  H s Tung; B Guss; U Hellman; L Persson; K Rubin; C Rydén
Journal:  Biochem J       Date:  2000-02-01       Impact factor: 3.857

3.  Detection and expression of methicillin/oxacillin resistance in multidrug-resistant and non-multidrug-resistant Staphylococcus aureus in Central Sydney, Australia.

Authors:  John Merlino; Jason Watson; Barbara Rose; Mary Beard-Pegler; Thomas Gottlieb; Ross Bradbury; Colin Harbour
Journal:  J Antimicrob Chemother       Date:  2002-05       Impact factor: 5.790

4.  Genetic variation among Staphylococcus aureus strains from bovine milk and their relevance to methicillin-resistant isolates from humans.

Authors:  Eiji Hata; Ken Katsuda; Hideki Kobayashi; Ikuo Uchida; Kiyoshi Tanaka; Masashi Eguchi
Journal:  J Clin Microbiol       Date:  2010-04-14       Impact factor: 5.948

5.  Staphylococcus aureus of bovine origin: genetic diversity, prevalence and the expression of adhesin-encoding genes.

Authors:  Raphael Contelli Klein; Mary Hellen Fabres-Klein; Maria Aparecida V Paiva Brito; Luciano Gomes Fietto; Andréa de Oliveira Barros Ribon
Journal:  Vet Microbiol       Date:  2012-05-28       Impact factor: 3.293

6.  The Microbial Surface Components Recognizing Adhesive Matrix Molecules (MSCRAMMs) Genes among Clinical Isolates of Staphylococcus aureus from Hospitalized Children.

Authors:  Abdolmajid Ghasemian; Shahin Najar Peerayeh; Bita Bakhshi; Mohsen Mirzaee
Journal:  Iran J Pathol       Date:  2015

Review 7.  Efficacy of Staphylococcus aureus vaccines for bovine mastitis: a systematic review.

Authors:  U P Pereira; D G S Oliveira; L R Mesquita; G M Costa; L J Pereira
Journal:  Vet Microbiol       Date:  2010-11-05       Impact factor: 3.293

8.  The collagen-binding adhesin is a virulence factor in Staphylococcus aureus keratitis.

Authors:  M N Rhem; E M Lech; J M Patti; D McDevitt; M Höök; D B Jones; K R Wilhelmus
Journal:  Infect Immun       Date:  2000-06       Impact factor: 3.441

Review 9.  Methicillin resistance in staphylococci: molecular and biochemical basis and clinical implications.

Authors:  H F Chambers
Journal:  Clin Microbiol Rev       Date:  1997-10       Impact factor: 26.132

Review 10.  Staphylococcus aureus in veterinary medicine.

Authors:  Vincent Peton; Yves Le Loir
Journal:  Infect Genet Evol       Date:  2013-08-23       Impact factor: 3.342

View more
  4 in total

Review 1.  Nanoparticles for treatment of bovine Staphylococcus aureus mastitis.

Authors:  Samah Attia Algharib; Ali Dawood; Shuyu Xie
Journal:  Drug Deliv       Date:  2020-12       Impact factor: 6.419

2.  Risk Factors for the Occurrence of Methicillin-Resistant Staphylococcus aureus in Dairy Herds: An Update.

Authors:  Arne Schnitt; Bernd-Alois Tenhagen
Journal:  Foodborne Pathog Dis       Date:  2019-08-28       Impact factor: 3.171

3.  Bovine subclinical mastitis-associated methicillin-resistant Staphylococcus aureus, selective genotyping and antimicrobial susceptibility profile of the isolates in Kurdistan province of Iran.

Authors:  Fereshteh Khazaie; Elham Ahmadi
Journal:  Iran J Microbiol       Date:  2021-02

4.  Antibiotic Resistance and Molecular Profiling of the Clinical Isolates of Staphylococcus aureus Causing Bovine Mastitis from India.

Authors:  Umarani Brahma; Akash Suresh; Shweta Murthy; Vasundhra Bhandari; Paresh Sharma
Journal:  Microorganisms       Date:  2022-04-18
  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.