Literature DB >> 29201274

Slower Dynamics and Aged Mitochondria in Sporadic Alzheimer's Disease.

Patricia Martín-Maestro1,2,3, Ricardo Gargini1, Esther García1,2, George Perry4, Jesús Avila1,2, Vega García-Escudero1,2,5.   

Abstract

Sporadic Alzheimer's disease corresponds to 95% of cases whose origin is multifactorial and elusive. Mitochondrial dysfunction is a major feature of Alzheimer's pathology, which might be one of the early events that trigger downstream principal events. Here, we show that multiple genes that control mitochondrial homeostasis, including fission and fusion, are downregulated in Alzheimer's patients. Additionally, we demonstrate that some of these dysregulations, such as diminished DLP1 levels and its mitochondrial localization, as well as reduced STOML2 and MFN2 fusion protein levels, take place in fibroblasts from sporadic Alzheimer's disease patients. The analysis of mitochondrial network disruption using CCCP indicates that the patients' fibroblasts exhibit slower dynamics and mitochondrial membrane potential recovery. These defects lead to strong accumulation of aged mitochondria in Alzheimer's fibroblasts. Accordingly, the analysis of autophagy and mitophagy involved genes in the patients demonstrates a downregulation indicating that the recycling mechanism of these aged mitochondria might be impaired. Our data reinforce the idea that mitochondrial dysfunction is one of the key early events of the disease intimately related with aging.

Entities:  

Mesh:

Substances:

Year:  2017        PMID: 29201274      PMCID: PMC5672147          DOI: 10.1155/2017/9302761

Source DB:  PubMed          Journal:  Oxid Med Cell Longev        ISSN: 1942-0994            Impact factor:   6.543


1. Introduction

Alzheimer's disease (AD) is a common and devastating dementia that is pathologically defined by the accumulation of extracellular amyloid beta- (Aβ-) containing plaques and intraneuronal hyperphosphorylated Tau protein aggregates associated with neuronal loss in the cerebral cortex. Studies of whole-genome gene expression profiling have identified that AD patients exhibit mitochondrial impairment together with altered calcium signaling and inflammation [1]. Defects in mitochondrial function generate oxidative stress increase due to mitochondrial electron transport chain leakage. The generated reactive oxygen species (ROS) oxidize multiple cell components, being an important issue to trigger protein misfolding [2]. It has been proposed that oxidative stress could be one of the primary events in the development of AD and plays a pivotal role in its pathogenesis [3, 4]. At the same time, mitochondria are targets of ROS causing the oxidation of their components increasing mitochondrial deterioration. This mitochondrial dysfunction may be one of the earliest and most prominent features of AD [5, 6]. Several works that show downregulation of mitochondrial genes in Alzheimer's have also demonstrated a reduced metabolic rate in the brain of these patients measured by fluorodeoxyglucose PET [7]. Metabolic abnormalities besides the damage of both components and the structure of mitochondria are well described in AD [8-10]. Moreover, several models have revealed that mitochondrial dysfunction triggers the aberrant processing of APP and tau [11-15]. Another deregulated aspect in AD is calcium signaling, which is closely related to functional the status of mitochondria. Experimental models have demonstrated that mitochondrial dysfunction favors tau phosphorylation, microtubule depolymerization, and neurofibrillary tangle-like pathology [11]. Hippocampal neurons exhibited AD-like tau phosphorylation and high calcium levels due to glutamate exposition impairing mitochondrial function [16]. Mitochondria are dynamic organelles that continuously undergo fission and fusion events which are necessary for cell survival as well as adaptation to changing conditions needed for cell growth, division and morphology, and distribution of mitochondria [17]. Mitochondrial dynamics is regulated by a machinery involving large dynamin-related GTPases where mitofusin 1 (MFN1), mitofusin 2 (MFN2), and optic atrophy 1 (OPA1) are involved in mitochondrial fusion [18], whereas mitochondrial fission is mediated by dynamin-like protein 1 (DLP1) through the interaction with four mitochondrial receptor proteins [18-20]. Dynamic fusion and fission processes allow damaged mitochondria to be recycled by a degradation mechanism termed mitophagy [21]. This pathway is partially driven by PINK1 and PARK2. When mitochondria are damaged and membrane potential is lost, there is a rapid recruitment of PARK2 to the mitochondria mediated by PINK1 that promotes K63-linked ubiquitin chain signaling [22]. Adaptor proteins of the autophagic system that recognize the ubiquitinated cargo through ubiquitin-binding domains (UBDs) and microtubule-associated proteins 1A/1B light chain 3 (LC3)/GABAA receptor-associated protein (GABARAP) attach to autophagosomal membranes via an LC3-interacting region (LIR) [22]. The autophagy machinery promotes the ubiquitinated cargo engulfment by autophagosomes and its final degradation [23]. In AD, mitochondrial failure might arise from a deficient dynamic balance of mitochondrial fission and fusion that is greatly shifted toward fission, and it may result in the presence of dysfunctional mitochondria in damaged neurons as well as fibroblasts from AD patients characterized by their accumulation into the perinuclear areas [24, 25]. In addition, autophagy dysfunction in brain and peripheral tissues of AD patients is widely documented [26]. This has been mainly associated to reduce degradative function, insufficient lysosomal pH acidification, and low hydrolases activity [27, 28] impairing the recycling of damaged mitochondria and generating a mitophagy failure [26]. In the present work, we have demonstrated a downregulation of genes involved in mitochondrial dynamics as well as in autophagy and mitophagy in Alzheimer's patients. Consequently, we have found slower mitochondrial dynamics correlating with diminished STOML2, MFN2, and DLP1 levels, showing the last one reduced mitochondrial localization, and therefore causing the accumulation of aged mitochondria in fibroblasts from AD patients.

2. Materials and Methods

2.1. Primary Cells and Culture Conditions

Primary skin fibroblasts were obtained from Coriell Institute for Medical Research (NJ, USA). Five fibroblast cell lines from SAD patients and five correspondent apparently healthy sex- and age-matched samples have been used (see Table 1 for details about age, sex, and stage of the disease). Human fibroblasts were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% (v/v) heat-inactivated fetal bovine serum (FBS), 2 mM glutamine, 10 U/ml penicillin, and 10 μg/ml streptomycin, in 5% CO2 in a humid incubator at 37°C. The use of fibroblasts has been restricted to a maximum of 10 cell passages to avoid replicative senescence, and cultures were always kept below confluence.
Table 1

Core set of fibroblast cell lines.

LineAge/sexClinical diagnosis
AG1136263/FNonaffected
AG0581367/FNonaffected
AG0780366/MNonaffected
AG0731060/FNonaffected
AG1102079/FNonaffected
AG0580963/FModerate dementia
AG0626367/FModerate dementia
AG0626266/MModerate dementia
AG0686960/FModerate dementia
AG0581079/FSevere dementia

Coriell Institute for Medical Research.

2.2. Microarray Analysis

The analysis of specific gene expression profiling by array (Affymetrix Human Gene 1.0 ST Array) of DLP1, GDAP1, MIEF1, MFN2, OPA1, STOML2, Optineurin, ATG5, ATG12, Beclin1, PI3K class III, ULK1, AMBRA1, BNIP3, BNIP3L, FUNDC1, VDAC1, and VPC/p97 of human brain samples was retrieved from Berchtold data set [29]. This study contains 253 samples from 84 patients, of which 173 are samples of different brain zones of 56 healthy subjects (aged 20–99 years) and 80 are samples of different brain zones of 28 AD patients (aged 28–99 years). Microarray data were obtained from 4 brain regions: the hippocampus, entorhinal cortex, superior frontal cortex, and postcentral gyrus. A similar analysis was performed in an additional data set of human brain samples classified into healthy (n = 47) versus AD (n = 32) patients obtained from the Hisayama study [30]. Differences in gene expression between healthy and AD patients were calculated using Student's t-test.

2.3. Antibodies

The primary antibodies used were TOMM20 (sc-11415), MFN2 (sc-515647), and STOML2 (sc-376165) and were purchased from Santa Cruz Biotechnology, Santa Cruz, CA, USA; DLP1 (611112, BD Biosciences); GAPDH (ab8245, Abcam, Cambridge, UK); and β-tubulin (T4026, Sigma-Aldrich). The secondary antibodies for Western blot studies were horseradish peroxidase-conjugated antimouse IgGs (P0161, DAKO) and for immunofluorescence were antirabbit IgGs alexa-488 or antimouse alexa-555 labelled (Molecular Probes, Millipore, Waltham, MA).

2.4. Western Blot Analysis

The cells and tissue samples were homogenized in lysis buffer (50 mM pH 7.5 HCl-Tris, 300 mM NaCl, 0.5% SDS, and 1% Triton X-100) and incubated 15 min at 95°C. Protein concentration of the extracts was measured using the DC protein assay kit (500–0111, Bio-Rad). Equal amounts of total protein extract from healthy and SAD cells were resolved by SDS-PAGE and then transferred to nitrocellulose (G9917809, Amersham, Germany) or PVDF (IPVH00010, Merk Millipore, Cork, Ireland) membranes. Western blot and immunoreactive proteins were developed using an enhanced chemiluminescence detection kit (NEL105001EA, Perkin Elmer) following instructions of the supplier. Quantification was performed by densitometry of the obtained bands in each lane with respect to the correspondent housekeeping protein such as GAPDH or β-tubulin band in each experiment (Quantity One software, Bio-Rad).

2.5. Lentivirus Production

Pseudotyped lentivectors were produced using reagents and protocols from Prof. Didier Trono. Briefly, viral stocks were produced by transient cotransfection of 293 T cells with 5 μg of the corresponding lentivector plasmid, 5 μg of the packaging plasmid pCMVdR8.74 (Addgene plasmid 22036) and 2 μg of the VSV-G envelope protein plasmid pMD2G (Addgene plasmid 12259) using Lipofectamine and Plus reagents following instructions of the supplier (18324 and 11514, resp., Life Technologies). Lentiviral titer was calculated by infecting cells with increasing amounts of lentiviral supernatant, and the percentage of infected cells was detected by flow cytometry (FACSCalibur, BD Biosciences, San Jose, CA).

2.6. Mitochondrial Dynamics Study

Cells were infected at an approximate multiplicity of infection (MOI) of 5–10 with a lentivector encoding DsRed2-Mito construct obtained from Clontech (632421) that was kindly provided by Dr. Ismael Santa-María (Columbia University, NY). Cells were treated with 20 μM carbonyl cyanide m-chlorophenylhydrazone (CCCP, Sigma, St. Louis Missouri) for 6 h and, in the reversible condition, CCCP was removed after 1 h and the medium was replaced for DMEM 10% FCS. After the treatments cells were fixed with 4% paraformaldehyde (PFA) and the mitochondrial pattern was observed with an Axioskop2 plus microscope coupled to a CCD color camera (Zeiss). For analysis, we used the Mitochondrial Network Analysis (MiNa) toolset, a combination of different ImageJ macros that allows the semiautomated analysis of mitochondrial networks in cultured mammalian cells [31]. Briefly, the image was converted to binary by thresholding following the conversion to a skeleton that represents the features in the original image using a wireframe of lines of one pixel wide. All pixels within a skeleton were then grouped into three categories: end point pixels, slab pixels, and junction pixels. The plugin analyzes how the pixels are spatially related and defined to measure the length of each branch and the number of branches in each skeletonized feature as well as the mitochondrial network morphology. The parameters used in the study were (1) individuals, punctate, rods, and large/round mitochondrial structures; (2) networks, mitochondrial structures with at least a single node and three branches; (3) the mean number of branches per network; and (4) the average of length of rods/branches. Ten randomly chosen fields containing between 10 and 15 cells were used to quantify the pattern of mitochondria. We classify the mitochondrial morphology into three different subtypes according to the length of the branches: filamentous (long and spaghetti-like shape; branch > 2.3 μm), fragmented (completely dotted; branch < 1.8 μm), and intermediate pattern (when both filamentous and fragmented mitochondria were found; 1.8 μm ≥ branch ≥ 2.3 μm).

2.7. Immunocytochemistry

Fibroblasts were grown on sterile glass coverslips, treated as described for each experiment, followed by washing with PBS and fixing with 4% PFA in PBS for 30 min at room temperature. After blocking with PBS containing 1% BSA and permeabilizing with 0.1% Triton X-100 and 1 M glycine for 30 minutes, cells were then stained with DLP1 and TOMM20 antibody diluted according to the manufacturer's recommendation in blocking buffer overnight at 4°C. Cells were washed with PBS and stained with secondary antibody (1 : 500 in blocking buffer) for 2 h at room temperature. Samples were mounted with ProlongGold Antifade (P-36930, Life Technologies) and randomly chosen field images were obtained in an Invert Confocal LSM510 (Zeiss, Oberkochen, Germany) fluorescence microscope.

2.8. Colocalization Study

Colocalization analysis was performed with ImageJ software (Bethesda, MD). The background of different channels was edited with the subtract background tool with a rolling ball radius of 30 pixels, and binary images were obtained by a threshold intensity. The logical operation AND of the Image Calculator tool was used to generate an image harboring only overlapping structures of both channels. Colocalization measurement was obtained by quantifying the area occupied by the overlapping elements per cell. At least 200 cells were measured for each cell line.

2.9. Mitochondrial Potential Measurement

After treatment, fibroblasts were incubated with 200 nM TMRM (T668, Molecular Probes, Waltham, MA, USA) for 30 min at 37°C and analyzed by flow cytometry (FACSCalibur, BD Biosciences). Mitochondrial membrane potential for each condition was represented as the percentage of the fluorescence intensity mean with respect to the fluorescence intensity mean exhibited when these cells remained untreated.

2.10. Study of Mitochondrial Age

MitoTimer transgene was amplified by PCR from the plasmid pTRE-Tight-MitoTimer (Plasmid number 50547, Addgene, MA, USA) using the oligos: CCTGGAGAATTCAGATCTCCAC and GATCCTGATCACTACAGGAACAGGTGGTGGC, and amplicon was cloned into lentiviral construct pLVX-TetOne-Puro (631849, Clontech, CA, USA) by restriction sites EcoRI and BclI. Fibroblasts were infected by packaged lentiviral particles at an approximated MOI of 5–10. Forty-eight hours postinfection, the expression of the transgene was induced with 2 μg/ml of doxycycline during 24 h and then removed from the media to analyze it at different times. On the other hand, after 24 h of doxycycline, cells were treated with CCCP (20 μM) for 24 h and then removed from media to be analyzed. Red and green fluorescence intensity was followed over time by flow cytometry (FACSCalibur, BD Biosciences). Aged mitochondrial quantification was calculated as the percentage of red fluorescence intensity mean at each point with respect to the one of the untreated cells at the beginning of the study (doxycycline removal, 0 h).

2.11. Statistical Analysis

Graphs represent means and standard deviations of the values obtained from experimental triplicates. When necessary, values represented in the graphs were obtained by normalizing every SAD sample data with its correspondent age-matched healthy sample. Statistical comparison of the data sets was performed by the Student's t-test. Two-way analysis of variance test was performed to examine the differences between experimental factors and their interaction. A post hoc Bonferroni test was used when more than two experimental groups were compared.

3. Results

3.1. Gene Expression Alteration of Mitochondrial Dynamics Proteins in AD Brains

Mitochondrial function disruption has been proposed long time ago as an early alteration in Alzheimer's pathology [32]. Mitochondria are a dynamic tubular network that undergo fission and fusion as a fundamental process for mitochondrial renewal and elimination of damaged ones [21]. Here, we observed that several fission proteins such as DLP1, GADP1, and MIEF1 appeared diminished in AD brain samples in Berchtold et al. [29] and Hokama et al. [30] data sets (Figure 1(a)). Multiple works have shown DLP1 is recruited to mitochondria to constrict the membranes upon assembly into spirals and to induce the scission of mitochondria upon GTP hydrolysis [33]. Membrane stabilization of DLP1 is regulated by GADP1 and MIEF1 [33]. On the other hand, fusion proteins such as MFN2, OPA1, and STOML2 have been shown diminished in Alzheimer's brain in both data sets (Figure 1(b)). Fusion is coordinated by MFN1/2 and OPA1, where the first one catalyzes the fusion of external membrane and the second one is associated to the internal membrane [34, 35]. An additional system named hyperfusion is controlled by STOML2/OPA1, which is stimulated under stress conditions favoring cell survival [36]. In summary, we could observe that both fission and fusion processes were reduced in AD brain accordingly with the mitochondrial dysfunction that takes place in this pathology.
Figure 1

Downregulation of dynamics genes in AD brains. (a)-(b) Analysis of microarray expression in two independent data sets of genes involved in mitochondrial fission (a) and fusion (b). Graphs show dot plots of the expression of the indicated genes using in upper row n = 253 samples from 84 patients, of which n = 56 are healthy subjects and n = 28 are AD patients retrieved from Berchtold data set [29] and in lower row n = 47 controls and n = 32 AD brain samples from the Hisayama study data set [30]. Correspondent p value was determined by Student's t-test and is showed for each graph.

3.2. Downregulation of Mitochondrial Dynamics Proteins in SAD Fibroblasts

Taking into account the previous results, we next examined whether proteins that control mitochondrial dynamics could be altered in patient-derived peripheral cells such as fibroblasts. As several works have shown reduced levels of DLP1 in neurons as well as in fibroblasts from sporadic AD patients [37, 38], we focused our attention in this protein. We could observe a decrease in DLP1 fission protein level, in SAD cells as it was previously described by Zhu and coworkers [38] (Figure 2(a)). DLP1 function depends on its subcellular localization [39]; therefore, we studied its distribution by immunofluorescence analysis of mitochondria labeled with TOMM20 (Figure 2(b)). Quantitative analysis revealed a decrease of DLP1 on mitochondria in SAD fibroblasts compared to healthy ones (Figure 2(c)). Additionally, the mitochondrial surface was increased in SAD fibroblasts with respect to the healthy ones (Figure 2(d)), as we have previously reported [26]. Finally, as it has been described for patients' brain [40], we have also observed diminished fusion protein levels such as MFN2/mitofusin2 and STOML2 in SAD fibroblasts (Figures 2(e), 2(f), and 2(g)). These data indicate that the putative mitochondrial defect associated to AD may be also found in fibroblasts.
Figure 2

Decreased fission and fusion protein levels in SAD cells. (a) Representative Western blot analysis and quantification of DLP1 in healthy and SAD fibroblasts under basal conditions. (b) Representative confocal microscopy images showing TOMM20 in green and DLP1 in red in basal conditions. (c) Quantification of the amount of DLP1 in mitochondria per cell in the images represented in (b). (d) Quantification of mitochondrial surface measured by TOMM20 label per cell in the images represented in (b). (e)–(g) Representative Western blot analysis and quantification of MFN2/mitofusin 2 (f) and STOML2 (g) in healthy and SAD fibroblasts under basal conditions. Graphs show means and standard deviations of the healthy/AD age- and sex-matched couple samples: AG11020/AG05810 and AG11362/AG05809; AG07310/AG06869; AG05813/AG06263; AG07803/AG06262 (a)–(e) and AG11020/AG05810; AG11362/AG05809; and AG07310/AG06869 (g). Scale bar: 40 μm. ∗p < 0.05.

3.3. Mitochondrial Dynamics Alteration in SAD Fibroblasts

Abnormal mitochondrial distribution and morphology have been described in SAD fibroblasts [38]. These data together with the downregulation of mitochondrial dynamics proteins previously described led us to conclude that mitochondrial dynamics may be altered in SAD fibroblasts. To seek for a possible functional defect in mitochondrial dynamics, we studied a reversible process of mitochondrial fragmentation. Healthy and SAD cells, which had similar growth rates, were plated and infected with a lentivector encoding Mito-DsRed2 for better mitochondria visualization and treated with carbonyl cyanide m-chlorophenylhydrazone (CCCP). These conditions induce a reversible depolarization of mitochondria without causing any toxic effect, and the viability of fibroblasts was not compromised (data not shown). The analysis of the images was done by the Mitochondrial Network Analysis (MiNa) toolset [31]. The patterns of mitochondria were classified into three categories according to the length of the branches: filamentous, fragmented, and intermediate (Figure 3(a); see Materials and Methods). Analysis was carried out by the quantification of mitochondrial shape in all the different experimental conditions. SAD and healthy cells exhibited similar mitochondrial pattern under resting conditions (Figure 3(b)) where most cells showed a filamentous and intermediate morphology. Conversely, the mitochondrial morphology was mainly fragmented when we treated the cells with CCCP for 7 h (Figure 3(c)).
Figure 3

Mitochondrial dynamics alterations in SAD fibroblasts. (a) Representative confocal microscopy images showing the three different mitochondrial morphologies in which they will be classified followed by binary image and the subsequently morphological skeleton generated by Mitochondrial Network Analysis (MiNa) toolset [31]. (b)–(c) Quantification of mitochondrial morphology of healthy and SAD couple under basal conditions (b) and treated with 20 μM CCCP for 7 h (c). (d) Time course of the mitochondrial morphology recovery in healthy and AD fibroblasts reversibly treated with CCCP. Mitochondrial morphology classification according to the length of the branches in filamentous (branch > 2.3 μm), fragmented (branch < 1.8 μm), and intermediate (1.8 ≥ branch ≥ 2.3 μm) patterns. Graphs represent the data of AG11362/AG05809 healthy/AD age- and sex-matched couple. Scale bar: 40 μm.

Although there were no substantial differences in the static pictures before and after CCCP treatment between healthy and SAD fibroblasts, we sought for a possible alteration during the process of fragmentation or fusion as a consequence of the dynamic proteins' downregulation as described. With this aim, we carried out a time course analysis of the mitochondrial morphology recovery over the time. Thus, fibroblasts were treated with CCCP for 6 h (t = 0 h); afterwards, they were allowed to recover during different time points (Figure 3(d)). We saw that after CCCP removal, there was a rapid initial recovery of filamentous morphology of both healthy and SAD cells within the first 30 min. However, after this time point, there was no recovery of filamentous morphology in SAD cells in the following 30 min, contrary to healthy fibroblasts that exhibited a quicker increase of filamentous mitochondria. Moreover, we observed that both healthy and SAD fibroblasts recovered the filamentous morphology over the time up to the percentages of untreated cells (Figure 3(d), −360 min). Thus, we chose 1 h of recovery after CCCP treatment to analyze the mitochondrial morphology recovery in all the control/SAD fibroblasts couples used in this work (Figures 4(a), 4(b), 4(c), and 4(d)). As before, healthy and SAD cells exhibited similar mitochondrial pattern under resting conditions (Figures 4(a) and 4(b)) or after 7 h of CCCP treatment (Figures 4(a) and 4(c)). However, after the reversible challenge with CCCP, SAD fibroblasts exhibited significantly increased percentage of cells with fragmented mitochondria with respect to their correspondent healthy fibroblasts, which showed a significantly higher proportion of cells that had recovered filamentous morphology (Figures 4(a) and 4(d)). Additionally, we could observe that CCCP treatment induced similar mitochondrial potential membrane (ΔΨm) loss in healthy and SAD fibroblasts (Figure 4(e)). However, when these cells were allowed to recover, only healthy fibroblasts recovered ΔΨm up to the levels of untreated cells (Figure 4(e)). On the contrary, SAD fibroblasts although some increase of ΔΨm was observed indicating that cells tend to recover, there were no significant differences with respect to total CCCP condition and still maintaining significant differences with respect to untreated condition (Figure 4(e)). These results suggest a delayed recovery of mitochondrial filamentous morphology and membrane potential in SAD fibroblasts after a reversible insult.
Figure 4

Delayed recovery of mitochondrial filamentous morphology in SAD fibroblasts. (a) Representative confocal microscopy images showing the mitochondrial morphology of healthy and SAD fibroblasts untreated (control), after 7 h with 20 μM CCCP (total CCCP) or after 6 h of CCCP treatment followed by 1 h without it (reversion). (b)–(d) Quantification of mitochondrial morphology of healthy-SAD couples when the cells remain untreated (b), treated with CCCP for 7 h (c), or reversibly treated with CCCP (d). (e) Mitochondrial membrane potential measured by TMRM of fibroblasts treated as in (a). Mitochondrial morphology classification according the length of the branches in filamentous (branch > 2.3 μm), fragmented (branch < 1.8 μm), and intermediate (1.8 ≥ branch ≥ 2.3 μm) patterns. n = 3 different healthy/AD sex- and age-matched couple samples: AG11362/AG05809, AG07310/AG06869, and AG11362/AG05809. Scale bar: 40 μm. ∗p < 0.05 and ∗∗p < 0.01; ns: not significant.

Then, we moved further into the morphological features of mitochondria to study in detail the mitochondrial network. We examined the mitochondrial network skeleton in representative images of the three experimental conditions (control, reversion and total CCCP) in both healthy and SAD fibroblasts, and the network parameter values were then calculated (Figure 5(a)). Although, there were no differences in the number of individuals (puncta and rods mitochondrial structures, Figure 5(b)) as well as networks (mitochondrial structures with at least a single node and three branches, Figure 5(c)) between healthy and SAD cells, we observed that the treatment with CCCP increased the number of individuals and networks in both cases (Figures 5(b) and 5(c)). The augmented number of networks was related to the fragmentation of larger networks with more branches into many smaller networks as it was reflected by the decreased number of branches per network after the treatment with CCCP (Figure 5(d)). Additionally, we analyzed the length of the branches in each condition (Figure 5(e)). As expected, we saw that the branch length was remarkably diminished after the CCCP treatment in both cells lines (Figure 5(e)). Surprisingly, we noticed that after 1 h of recovery without CCCP, the length of the branches in SAD cells was the same than after 7 h of CCCP. In contrast, healthy fibroblasts exhibited a recovery of the branch length up to the values of the untreated condition, suggesting once again a delayed recovery of the mitochondrial network in SAD cells (Figure 5(e)).
Figure 5

Analysis of mitochondria network. (a) Representative images showing mitochondrial morphological skeleton obtained with MiNa toolset [31] of healthy and SAD fibroblasts untreated (control), after 6 h of CCCP treatment followed by 1 h without it (reversion) or after 7 h with 20 μM CCCP (total CCCP). (b)–(e) Quantification of number of individuals (b), networks (c), branches per network (d), or length of the branches (e) of n = 3 different healthy/AD sex- and age-matched couple samples: AG11362/AG05809, AG07310/AG06869, and AG11362/AG05809. ∗∗p < 0.01; ns: not significant.

3.4. Increased Mitochondrial Aging in SAD Fibroblasts due to Recycling Impairment

To investigate whether the mitochondrial dynamics failure could affect the quality of the mitochondria, we analyzed the mitochondrial turnover in healthy and SAD fibroblasts by using the MitoTimer tool. With this aim, we cloned the MitoTimer gene [41] into a lentiviral vector that encodes all the regulatory elements to allow transgene expression activation in response to doxycycline, pLVX-TetOne-Puro (631849, Clontech, CA, USA). MitoTimer provides a fluorescent readout which directly relates to the mitochondrial turnover and quality control described in several studies based on a time-sensitive fluorescent protein [41-43]. It consists of the timer fluorescent protein fused to the mitochondrial targeting sequence of COX8A subunit, which targets MitoTimer to the mitochondrial matrix. Timer, initially fluorescence green, changes over time so the emission shifts from green to red. Healthy and SAD fibroblasts were infected with the lentivirus encoding MitoTimer and, after 48 h, transgene expression was induced by doxycycline treatment for 24 h, after what CCCP was added during 24 h (Figure 6(a)). We monitored by flow cytometry the amount of aged mitochondria measured by red fluorescence. After doxycycline removal, aged mitochondria were increased similarly in both healthy and SAD fibroblasts during the first 24 h (Figure 6(b), 24 h). However, the recycling of these aged mitochondria was slightly faster in healthy cells with respect to SAD ones (Figure 6(b), 48 h). When we boosted mitochondrial recycling process by the addition of CCCP, we could observe that aged mitochondria were diminished in healthy fibroblasts due to an efficient degradation of dysfunctional mitochondria (Figure 6(c), 24 h healthy). Meanwhile, in SAD fibroblasts, there was no degradation of aged mitochondria during the treatment with CCCP (Figure 6(c), 24 h SAD). After removal of CCCP, there were still significant differences in the amount of aged mitochondria between healthy and SAD fibroblasts (Figure 6(c), 48 h), correlating with our previous results of a slower mitochondrial dynamics and membrane potential recovery. Our results indicate that SAD fibroblasts exhibited aged mitochondria compared to healthy cells and the recycling process was impaired. This result correlates with our previous work in which we have demonstrated a functional impairment of autophagy and, more specifically, of mitophagy in this set of SAD fibroblasts [26].
Figure 6

Aged mitochondria due to defective mitochondrial recycling in AD. (a) Scheme of the function of lentiviral MitoTimer tool. (b) Graph showing intensity of red fluorescence per cell measured by flow cytometry over timer in healthy and SAD fibroblasts previously infected by a lentivirus encoding MitoTimer and treated for 24 h with doxycycline. (c) Graph representing a similar study but in the presence of CCCP (20 μM) for 24 h after doxycycline removal. (b)–(c) Values represent means and standard deviations of the percentage of red fluorescence intensity mean per cell (aged mitochondria) with respect to control condition that is the average of red fluorescence intensity mean after doxycycline removal without CCCP (0 h time point) (n = 3 independent experiments using the healthy/SAD couple AG01362/AG05859, †p < 0.08, and ∗p < 0.05). (d)–(e). Analysis of microarray expression of genes involved in autophagy (d) and mitophagy (e). Graphs show dot plots of the expression of the indicated genes using in upper rows n = 253 samples from 84 patients, of which n = 56 are healthy subjects and n = 28 are AD patients retrieved from Berchtold data set [29], and in lower rows n = 47 controls and n = 32 AD brain samples retrieved from the Hisayama study [13]. Correspondent p value was determined by Student's t-test and is showed for each graph.

3.5. Alzheimer's Disease Patients Exhibit Reduced Expression of Autophagy and Mitophagy-Associated Genes

Numerous works have focused their efforts in the study of mitochondrial recycling mechanisms due to their relevance in aging [44]. Mitochondrial fusion and fission processes are closely related with the removal of damaged mitochondria executed by mitophagy. Due to the fact that we have observed the accumulation of aged mitochondria in SAD fibroblasts, we wondered whether autophagy and mitophagy genes may be altered in the two sets of samples where we previously observed a downregulation of mitochondrial dynamics genes. We observed that a high number of autophagy associated genes such as Optineurin, ATG5, ATG12, Beclin1, PI3K class III, and ULK1 (Figure 6(d)) and mitophagy such as AMBRA1, BNIP3, BNIP3L, FUNDC1, VDAC1, and VCP/P97 (Figure 6(e)) were downregulated in AD brain with respect to healthy controls.

4. Discussion

4.1. Alteration of the Expression of Fission and Fusion-Related Genes

Alzheimer's is the most prevalent neurodegenerative disease and is characterized by progressive dementia that initiates as short-term memory impairment. In the past decade, a wide number of gene profiling analysis have been performed in patient-derived postmortem brains as well as peripheral tissues. These studies have revealed a narrow relationship of mitochondrial dysfunction, calcium signaling, and neuroinflammation with AD pathology [1]. Particularly interesting is the involvement of mitochondria in AD, in fact, several lines of evidence propose mitochondrial anomalies as one of the primary factors that lead to late-onset SAD pathology [9, 45]. Here, we analyzed gene profiling data of genes involved in mitochondrial dynamics and we could observe a pleiotropic downregulation of gene expression of both fission and fusion processes, correlative to other studies in which diminished levels of these proteins have been demonstrated in patients' brain [40]. Accordingly, we have shown that SAD fibroblasts exhibited lower levels of proteins involved in fission-like DLP1 and fusion such as MFN2 and STOML2. Other authors have shown that mitochondrial failure may arise from a deficient dynamic balance of mitochondrial fission and fusion that, in AD, is greatly shifted toward fission, due to a defect in fusion. This may result in the presence of dysfunctional mitochondria in damaged neurons as well as fibroblasts from AD patients characterized by their accumulation into perinuclear areas [24, 25]. We confirmed the downregulation of several fission genes, but also important fusion genes such as MFN2 and OPA1 appeared downregulated, what had been demonstrated to inhibit this process [46, 47]. Furthermore, fusion and fission proteins have been found diminished in fibroblasts suggesting that both processes are affected.

4.2. Downregulation of Fusion and Fission Genes Lead to Slower Dynamics

Vulnerable neurons in AD's brain exhibit significant reduction in mitochondrial length and increased width with a significant augmented overall size consistent with unopposed fission suggesting alterations of mitochondrial dynamics [38, 48]. In agreement with these findings, abnormal distribution of mitochondria was found in pyramidal neurons of AD-affected individuals where mitochondria were redistributed away from axons [40]. Accordingly, levels of fusion proteins OPA1, MFN1, and MFN2 were significantly reduced, whereas levels of Fis1 were significantly increased in AD [40]. Primary hippocampal neurons treated with Aβ-derived diffusible ligands (ADDLs) demonstrated shortened mitochondria in neurons and alteration of fission and fusion proteins [40]. Moreover, time-lapse recordings in these neurons showed impairment of both fission and fusion processes, with fusion being more severely affected [40]. These authors discuss that the observed imbalance of fusion and fission proteins does not explain the observed time-lapse recordings where both processes are affected. This last result correlates with our observations of slower mitochondrial dynamics after the addition and removal of CCCP. Abnormal mitochondrial morphology had been previously found in fibroblasts from sporadic AD patients, where they become significantly elongated and form a highly connected network [38]. However, in our hands, we could not detect significant differences in the number of individuals, networks, branches per network, or length of the branches of mitochondria between healthy and SAD fibroblasts. Only increased mitochondrial surface was detected in SAD fibroblasts. This discrepancy in mitochondrial morphology with the data reported in neurons may be due to variations in the expression pattern of proteins involved in dynamics as well as different mitochondrial function requirements between both cell types. As we have seen a pleiotropic downregulation of fusion and fission genes in brains, our functional study in fibroblasts was focused in both processes. Accordingly, we could observe that the whole dynamics system was affected. The alteration in mitochondrial dynamics leads to severe consequences in the cell such as structural changes in the cristae formation and assembly of electron transport complex compromising bioenergetics and causing calcium dyshomeostasis, increased oxidative stress, mtDNA damage, and synaptic dysfunction [25]. In addition to the defect observed in fusion/fission, defects in mitochondrial mobility have also been observed in AD causing a mitochondrial reduction in neurites [25]. Aβ induces a reduction in motile mitochondria [49], and ADDLs impair anterograde and retrograde axonal transport of mitochondria in hippocampal neurons [50]. We have also observed the downregulation of many genes involved in mitochondrial transport such as the family of dynactins (DCTN1, 2, 3, 5, and 6), dyneins (DYNC1H1, DYNC1I1, and DYNC1LI1), kinesins (KIF1B and KIF5C), and Miro (data not shown). It has been described that PINK1 and PARK2 target Miro for phosphorylation and degradation to arrest mitochondrial motility keeping in quarantine damaged mitochondria prior to their clearance by mitophagy [51]. Therefore, Miro downregulation may affect to the correct segregation of dysfunctional mitochondria and its subsequently recycling.

4.3. Autophagy/Mitophagy Defect and the Resulting Accumulation of Damaged Mitochondria

Numerous works have demonstrated that autophagy is dysregulated in AD pathology, even when autophagy induction has been considered a therapeutic target [52]. More recently, we have reported mitophagy impairment in these patients' brain and peripheral tissue due to insufficient generation of autophagic vesicles together with deficient PARK2 signaling, leading to the accumulation of damaged mitochondria, strong oxidative damage, and accumulation of polyubiquitinated proteins [26]. Accordingly, we now report the downregulation of multiple genes involved in autophagy and mitophagy that was accompanied by the accumulation of aged mitochondria. For this study, we have developed a new lentiviral vector that allows the induction of MitoTimer tool [41, 53] under the control of doxycycline. Our vector has the ability to infect any kind of cell independently of its proliferative state and through a single virus infection achieves the complete regulation of the transgene. This tool will allow the study of mitochondrial aging as well as recycling in vitro and in vivo in any cell or animal model.

5. Conclusions

Here, we report numerous data that reveal a deep deregulation of mitochondrial homeostasis in Alzheimer's disease. We have observed a downregulation of mitochondrial fusion and fission in the disease. Accordingly, mitochondrial dynamics is slowed down in these patients' fibroblasts after an insult. This is accompanied by a downregulation of autophagy and mitophagy genes together with the accumulation of aged mitochondria which may be a cornerstone of Alzheimer's pathology due to their involvement in ROS production, elevated calcium levels, and neuroinflammation observed in these patients. Our data continue in fueling the hypothesis that AD is an acceleration of aging caused by malfunction of recycling.
  53 in total

Review 1.  Mitochondria in Alzheimer's disease.

Authors:  Russell H Swerdlow; Stephen J Kish
Journal:  Int Rev Neurobiol       Date:  2002       Impact factor: 3.230

2.  PARK2 enhancement is able to compensate mitophagy alterations found in sporadic Alzheimer's disease.

Authors:  Patricia Martín-Maestro; Ricardo Gargini; George Perry; Jesús Avila; Vega García-Escudero
Journal:  Hum Mol Genet       Date:  2015-12-31       Impact factor: 6.150

Review 3.  New methods for monitoring mitochondrial biogenesis and mitophagy in vitro and in vivo.

Authors:  Jessica A Williams; Katrina Zhao; Shengkan Jin; Wen-Xing Ding
Journal:  Exp Biol Med (Maywood)       Date:  2017-01-01

Review 4.  A synergistic dysfunction of mitochondrial fission/fusion dynamics and mitophagy in Alzheimer's disease.

Authors:  Renato X Santos; Sónia C Correia; Xinglong Wang; George Perry; Mark A Smith; Paula I Moreira; Xiongwei Zhu
Journal:  J Alzheimers Dis       Date:  2010       Impact factor: 4.472

5.  Dynamin-related protein Drp1 is required for mitochondrial division in mammalian cells.

Authors:  E Smirnova; L Griparic; D L Shurland; A M van der Bliek
Journal:  Mol Biol Cell       Date:  2001-08       Impact factor: 4.138

6.  Mitochondria-targeted catalase reduces abnormal APP processing, amyloid β production and BACE1 in a mouse model of Alzheimer's disease: implications for neuroprotection and lifespan extension.

Authors:  Peizhong Mao; Maria Manczak; Marcus J Calkins; Quang Truong; Tejaswini P Reddy; Arubala P Reddy; Ulziibat Shirendeb; Herng-Hsiang Lo; Peter S Rabinovitch; P Hemachandra Reddy
Journal:  Hum Mol Genet       Date:  2012-04-05       Impact factor: 6.150

7.  Deubiquitinating enzymes regulate PARK2-mediated mitophagy.

Authors:  Yuqing Wang; Mauro Serricchio; Miluska Jauregui; Riya Shanbhag; Tasha Stoltz; Caitlin T Di Paolo; Peter K Kim; G Angus McQuibban
Journal:  Autophagy       Date:  2015-04-03       Impact factor: 16.016

Review 8.  The role of oxidative abnormalities in the pathophysiology of Alzheimer's disease.

Authors:  J P Blass; G E Gibson
Journal:  Rev Neurol (Paris)       Date:  1991       Impact factor: 2.607

9.  MitoTimer: a novel tool for monitoring mitochondrial turnover.

Authors:  Genaro Hernandez; Christine Thornton; Aleksandr Stotland; Diana Lui; Jon Sin; Jennifer Ramil; Najib Magee; Allen Andres; Giovanni Quarato; Raquel S Carreira; M Richard Sayen; Roland Wolkowicz; Roberta A Gottlieb
Journal:  Autophagy       Date:  2013-10-11       Impact factor: 16.016

Review 10.  Mitochondrial dynamics and mitochondrial quality control.

Authors:  Hong-Min Ni; Jessica A Williams; Wen-Xing Ding
Journal:  Redox Biol       Date:  2014-11-20       Impact factor: 11.799

View more
  24 in total

1.  Autophagy Induction by Bexarotene Promotes Mitophagy in Presenilin 1 Familial Alzheimer's Disease iPSC-Derived Neural Stem Cells.

Authors:  Patricia Martín-Maestro; Andrew Sproul; Hector Martinez; Dominik Paquet; Meri Gerges; Scott Noggle; Anatoly A Starkov
Journal:  Mol Neurobiol       Date:  2019-06-16       Impact factor: 5.590

Review 2.  Mitochondrial dynamics and transport in Alzheimer's disease.

Authors:  Padraig J Flannery; Eugenia Trushina
Journal:  Mol Cell Neurosci       Date:  2019-06-16       Impact factor: 4.314

Review 3.  Drosophila as a model to explore secondary injury cascades after traumatic brain injury.

Authors:  Lori M Buhlman; Gokul Krishna; T Bucky Jones; Theresa Currier Thomas
Journal:  Biomed Pharmacother       Date:  2021-08-27       Impact factor: 7.419

Review 4.  The use of fibroblasts as a valuable strategy for studying mitochondrial impairment in neurological disorders.

Authors:  Margrethe A Olesen; Francisca Villavicencio-Tejo; Rodrigo A Quintanilla
Journal:  Transl Neurodegener       Date:  2022-07-04       Impact factor: 9.883

5.  Regulatory roles of external cholesterol in human airway epithelial mitochondrial function through STARD3 signalling.

Authors:  Liyang Li; Yifei Liu; Xuanqi Liu; Nannan Zheng; Yutong Gu; Yuanlin Song; Xiangdong Wang
Journal:  Clin Transl Med       Date:  2022-06

Review 6.  Mitochondria and Reactive Oxygen Species in Aging and Age-Related Diseases.

Authors:  Carlotta Giorgi; Saverio Marchi; Ines C M Simoes; Ziyu Ren; Giampaolo Morciano; Mariasole Perrone; Paulina Patalas-Krawczyk; Sabine Borchard; Paulina Jędrak; Karolina Pierzynowska; Jędrzej Szymański; David Q Wang; Piero Portincasa; Grzegorz Węgrzyn; Hans Zischka; Pawel Dobrzyn; Massimo Bonora; Jerzy Duszynski; Alessandro Rimessi; Agnieszka Karkucinska-Wieckowska; Agnieszka Dobrzyn; Gyorgy Szabadkai; Barbara Zavan; Paulo J Oliveira; Vilma A Sardao; Paolo Pinton; Mariusz R Wieckowski
Journal:  Int Rev Cell Mol Biol       Date:  2018-06-22       Impact factor: 6.813

7.  Guidelines for the use and interpretation of assays for monitoring autophagy (4th edition)1.

Authors:  Daniel J Klionsky; Amal Kamal Abdel-Aziz; Sara Abdelfatah; Mahmoud Abdellatif; Asghar Abdoli; Steffen Abel; Hagai Abeliovich; Marie H Abildgaard; Yakubu Princely Abudu; Abraham Acevedo-Arozena; Iannis E Adamopoulos; Khosrow Adeli; Timon E Adolph; Annagrazia Adornetto; Elma Aflaki; Galila Agam; Anupam Agarwal; Bharat B Aggarwal; Maria Agnello; Patrizia Agostinis; Javed N Agrewala; Alexander Agrotis; Patricia V Aguilar; S Tariq Ahmad; Zubair M Ahmed; Ulises Ahumada-Castro; Sonja Aits; Shu Aizawa; Yunus Akkoc; Tonia Akoumianaki; Hafize Aysin Akpinar; Ahmed M Al-Abd; Lina Al-Akra; Abeer Al-Gharaibeh; Moulay A Alaoui-Jamali; Simon Alberti; Elísabet Alcocer-Gómez; Cristiano Alessandri; Muhammad Ali; M Abdul Alim Al-Bari; Saeb Aliwaini; Javad Alizadeh; Eugènia Almacellas; Alexandru Almasan; Alicia Alonso; Guillermo D Alonso; Nihal Altan-Bonnet; Dario C Altieri; Élida M C Álvarez; Sara Alves; Cristine Alves da Costa; Mazen M Alzaharna; Marialaura Amadio; Consuelo Amantini; Cristina Amaral; Susanna Ambrosio; Amal O Amer; Veena Ammanathan; Zhenyi An; Stig U Andersen; Shaida A Andrabi; Magaiver Andrade-Silva; Allen M Andres; Sabrina Angelini; David Ann; Uche C Anozie; Mohammad Y Ansari; Pedro Antas; Adam Antebi; Zuriñe Antón; Tahira Anwar; Lionel Apetoh; Nadezda Apostolova; Toshiyuki Araki; Yasuhiro Araki; Kohei Arasaki; Wagner L Araújo; Jun Araya; Catherine Arden; Maria-Angeles Arévalo; Sandro Arguelles; Esperanza Arias; Jyothi Arikkath; Hirokazu Arimoto; Aileen R Ariosa; Darius Armstrong-James; Laetitia Arnauné-Pelloquin; Angeles Aroca; Daniela S Arroyo; Ivica Arsov; Rubén Artero; Dalia Maria Lucia Asaro; Michael Aschner; Milad Ashrafizadeh; Osnat Ashur-Fabian; Atanas G Atanasov; Alicia K Au; Patrick Auberger; Holger W Auner; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Yenniffer Ávalos; Sanja Aveic; Célia Alexandra Aveleira; Tamar Avin-Wittenberg; Yucel Aydin; Scott Ayton; Srinivas Ayyadevara; Maria Azzopardi; Misuzu Baba; Jonathan M Backer; Steven K Backues; Dong-Hun Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Ahruem Baek; Seung-Hoon Baek; Sung Hee Baek; Giacinto Bagetta; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xiyuan Bai; Yidong Bai; Nandadulal Bairagi; Shounak Baksi; Teresa Balbi; Cosima T Baldari; Walter Balduini; Andrea Ballabio; Maria Ballester; Salma Balazadeh; Rena Balzan; Rina Bandopadhyay; Sreeparna Banerjee; Sulagna Banerjee; Ágnes Bánréti; Yan Bao; Mauricio S Baptista; Alessandra Baracca; Cristiana Barbati; Ariadna Bargiela; Daniela Barilà; Peter G Barlow; Sami J Barmada; Esther Barreiro; George E Barreto; Jiri Bartek; Bonnie Bartel; Alberto Bartolome; Gaurav R Barve; Suresh H Basagoudanavar; Diane C Bassham; Robert C Bast; Alakananda Basu; Henri Batoko; Isabella Batten; Etienne E Baulieu; Bradley L Baumgarner; Jagadeesh Bayry; Rupert Beale; Isabelle Beau; Florian Beaumatin; Luiz R G Bechara; George R Beck; Michael F Beers; Jakob Begun; Christian Behrends; Georg M N Behrens; Roberto Bei; Eloy Bejarano; Shai Bel; Christian Behl; Amine Belaid; Naïma Belgareh-Touzé; Cristina Bellarosa; Francesca Belleudi; Melissa Belló Pérez; Raquel Bello-Morales; Jackeline Soares de Oliveira Beltran; Sebastián Beltran; Doris Mangiaracina Benbrook; Mykolas Bendorius; Bruno A Benitez; Irene Benito-Cuesta; Julien Bensalem; Martin W Berchtold; Sabina Berezowska; Daniele Bergamaschi; Matteo Bergami; Andreas Bergmann; Laura Berliocchi; Clarisse Berlioz-Torrent; Amélie Bernard; Lionel Berthoux; Cagri G Besirli; Sebastien Besteiro; Virginie M Betin; Rudi Beyaert; Jelena S Bezbradica; Kiran Bhaskar; Ingrid Bhatia-Kissova; Resham Bhattacharya; Sujoy Bhattacharya; Shalmoli Bhattacharyya; Md Shenuarin Bhuiyan; Sujit Kumar Bhutia; Lanrong Bi; Xiaolin Bi; Trevor J Biden; Krikor Bijian; Viktor A Billes; Nadine Binart; Claudia Bincoletto; Asa B Birgisdottir; Geir Bjorkoy; Gonzalo Blanco; Ana Blas-Garcia; Janusz Blasiak; Robert Blomgran; Klas Blomgren; Janice S Blum; Emilio Boada-Romero; Mirta Boban; Kathleen Boesze-Battaglia; Philippe Boeuf; Barry Boland; Pascale Bomont; Paolo Bonaldo; Srinivasa Reddy Bonam; Laura Bonfili; Juan S Bonifacino; Brian A Boone; Martin D Bootman; Matteo Bordi; Christoph Borner; Beat C Bornhauser; Gautam Borthakur; Jürgen Bosch; Santanu Bose; Luis M Botana; Juan Botas; Chantal M Boulanger; Michael E Boulton; Mathieu Bourdenx; Benjamin Bourgeois; Nollaig M Bourke; Guilhem Bousquet; Patricia Boya; Peter V Bozhkov; Luiz H M Bozi; Tolga O Bozkurt; Doug E Brackney; Christian H Brandts; Ralf J Braun; Gerhard H Braus; Roberto Bravo-Sagua; José M Bravo-San Pedro; Patrick Brest; Marie-Agnès Bringer; Alfredo Briones-Herrera; V Courtney Broaddus; Peter Brodersen; Jeffrey L Brodsky; Steven L Brody; Paola G Bronson; Jeff M Bronstein; Carolyn N Brown; Rhoderick E Brown; Patricia C Brum; John H Brumell; Nicola Brunetti-Pierri; Daniele Bruno; Robert J Bryson-Richardson; Cecilia Bucci; Carmen Buchrieser; Marta Bueno; Laura Elisa Buitrago-Molina; Simone Buraschi; Shilpa Buch; J Ross Buchan; Erin M Buckingham; Hikmet Budak; Mauricio Budini; Geert Bultynck; Florin Burada; Joseph R Burgoyne; M Isabel Burón; Victor Bustos; Sabrina Büttner; Elena Butturini; Aaron Byrd; Isabel Cabas; Sandra Cabrera-Benitez; Ken Cadwell; Jingjing Cai; Lu Cai; Qian Cai; Montserrat Cairó; Jose A Calbet; Guy A Caldwell; Kim A Caldwell; Jarrod A Call; Riccardo Calvani; Ana C Calvo; Miguel Calvo-Rubio Barrera; Niels Os Camara; Jacques H Camonis; Nadine Camougrand; Michelangelo Campanella; Edward M Campbell; François-Xavier Campbell-Valois; Silvia Campello; Ilaria Campesi; Juliane C Campos; Olivier Camuzard; Jorge Cancino; Danilo Candido de Almeida; Laura Canesi; Isabella Caniggia; Barbara Canonico; Carles Cantí; Bin Cao; Michele Caraglia; Beatriz Caramés; Evie H Carchman; Elena Cardenal-Muñoz; Cesar Cardenas; Luis Cardenas; Sandra M Cardoso; Jennifer S Carew; Georges F Carle; Gillian Carleton; Silvia Carloni; Didac Carmona-Gutierrez; Leticia A Carneiro; Oliana Carnevali; Julian M Carosi; Serena Carra; Alice Carrier; Lucie Carrier; Bernadette Carroll; A Brent Carter; Andreia Neves Carvalho; Magali Casanova; Caty Casas; Josefina Casas; Chiara Cassioli; Eliseo F Castillo; Karen Castillo; Sonia Castillo-Lluva; Francesca Castoldi; Marco Castori; Ariel F Castro; Margarida Castro-Caldas; Javier Castro-Hernandez; Susana Castro-Obregon; Sergio D Catz; Claudia Cavadas; Federica Cavaliere; Gabriella Cavallini; Maria Cavinato; Maria L Cayuela; Paula Cebollada Rica; Valentina Cecarini; Francesco Cecconi; Marzanna Cechowska-Pasko; Simone Cenci; Victòria Ceperuelo-Mallafré; João J Cerqueira; Janete M Cerutti; Davide Cervia; Vildan Bozok Cetintas; Silvia Cetrullo; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Oishee Chakrabarti; Tapas Chakraborty; Trinad Chakraborty; Mounia Chami; Georgios Chamilos; David W Chan; Edmond Y W Chan; Edward D Chan; H Y Edwin Chan; Helen H Chan; Hung Chan; Matthew T V Chan; Yau Sang Chan; Partha K Chandra; Chih-Peng Chang; Chunmei Chang; Hao-Chun Chang; Kai Chang; Jie Chao; Tracey Chapman; Nicolas Charlet-Berguerand; Samrat Chatterjee; Shail K Chaube; Anu Chaudhary; Santosh Chauhan; Edward Chaum; Frédéric Checler; Michael E Cheetham; Chang-Shi Chen; Guang-Chao Chen; Jian-Fu Chen; Liam L Chen; Leilei Chen; Lin Chen; Mingliang Chen; Mu-Kuan Chen; Ning Chen; Quan Chen; Ruey-Hwa Chen; Shi Chen; Wei Chen; Weiqiang Chen; Xin-Ming Chen; Xiong-Wen Chen; Xu Chen; Yan Chen; Ye-Guang Chen; Yingyu Chen; Yongqiang Chen; Yu-Jen Chen; Yue-Qin Chen; Zhefan Stephen Chen; Zhi Chen; Zhi-Hua Chen; Zhijian J Chen; Zhixiang Chen; Hanhua Cheng; Jun Cheng; Shi-Yuan Cheng; Wei Cheng; Xiaodong Cheng; Xiu-Tang Cheng; Yiyun Cheng; Zhiyong Cheng; Zhong Chen; Heesun Cheong; Jit Kong Cheong; Boris V Chernyak; Sara Cherry; Chi Fai Randy Cheung; Chun Hei Antonio Cheung; King-Ho Cheung; Eric Chevet; Richard J Chi; Alan Kwok Shing Chiang; Ferdinando Chiaradonna; Roberto Chiarelli; Mario Chiariello; Nathalia Chica; Susanna Chiocca; Mario Chiong; Shih-Hwa Chiou; Abhilash I Chiramel; Valerio Chiurchiù; Dong-Hyung Cho; Seong-Kyu Choe; Augustine M K Choi; Mary E Choi; Kamalika Roy Choudhury; Norman S Chow; Charleen T Chu; Jason P Chua; John Jia En Chua; Hyewon Chung; Kin Pan Chung; Seockhoon Chung; So-Hyang Chung; Yuen-Li Chung; Valentina Cianfanelli; Iwona A Ciechomska; Mariana Cifuentes; Laura Cinque; Sebahattin Cirak; Mara Cirone; Michael J Clague; Robert Clarke; Emilio Clementi; Eliana M Coccia; Patrice Codogno; Ehud Cohen; Mickael M Cohen; Tania Colasanti; Fiorella Colasuonno; Robert A Colbert; Anna Colell; Miodrag Čolić; Nuria S Coll; Mark O Collins; María I Colombo; Daniel A Colón-Ramos; Lydie Combaret; Sergio Comincini; Márcia R Cominetti; Antonella Consiglio; Andrea Conte; Fabrizio Conti; Viorica Raluca Contu; Mark R Cookson; Kevin M Coombs; Isabelle Coppens; Maria Tiziana Corasaniti; Dale P Corkery; Nils Cordes; Katia Cortese; Maria do Carmo Costa; Sarah Costantino; Paola Costelli; Ana Coto-Montes; Peter J Crack; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Riccardo Cristofani; Tamas Csizmadia; Antonio Cuadrado; Bing Cui; Jun Cui; Yixian Cui; Yong Cui; Emmanuel Culetto; Andrea C Cumino; Andrey V Cybulsky; Mark J Czaja; Stanislaw J Czuczwar; Stefania D'Adamo; Marcello D'Amelio; Daniela D'Arcangelo; Andrew C D'Lugos; Gabriella D'Orazi; James A da Silva; Hormos Salimi Dafsari; Ruben K Dagda; Yasin Dagdas; Maria Daglia; Xiaoxia Dai; Yun Dai; Yuyuan Dai; Jessica Dal Col; Paul Dalhaimer; Luisa Dalla Valle; Tobias Dallenga; Guillaume Dalmasso; Markus Damme; Ilaria Dando; Nico P Dantuma; April L Darling; Hiranmoy Das; Srinivasan Dasarathy; Santosh K Dasari; Srikanta Dash; Oliver Daumke; Adrian N Dauphinee; Jeffrey S Davies; Valeria A Dávila; Roger J Davis; Tanja Davis; Sharadha Dayalan Naidu; Francesca De Amicis; Karolien De Bosscher; Francesca De Felice; Lucia De Franceschi; Chiara De Leonibus; Mayara G de Mattos Barbosa; Guido R Y De Meyer; Angelo De Milito; Cosimo De Nunzio; Clara De Palma; Mauro De Santi; Claudio De Virgilio; Daniela De Zio; Jayanta Debnath; Brian J DeBosch; Jean-Paul Decuypere; Mark A Deehan; Gianluca Deflorian; James DeGregori; Benjamin Dehay; Gabriel Del Rio; Joe R Delaney; Lea M D Delbridge; Elizabeth Delorme-Axford; M Victoria Delpino; Francesca Demarchi; Vilma Dembitz; Nicholas D Demers; Hongbin Deng; Zhiqiang Deng; Joern Dengjel; Paul Dent; Donna Denton; Melvin L DePamphilis; Channing J Der; Vojo Deretic; Albert Descoteaux; Laura Devis; Sushil Devkota; Olivier Devuyst; Grant Dewson; Mahendiran Dharmasivam; Rohan Dhiman; Diego di Bernardo; Manlio Di Cristina; Fabio Di Domenico; Pietro Di Fazio; Alessio Di Fonzo; Giovanni Di Guardo; Gianni M Di Guglielmo; Luca Di Leo; Chiara Di Malta; Alessia Di Nardo; Martina Di Rienzo; Federica Di Sano; George Diallinas; Jiajie Diao; Guillermo Diaz-Araya; Inés Díaz-Laviada; Jared M Dickinson; Marc Diederich; Mélanie Dieudé; Ivan Dikic; Shiping Ding; Wen-Xing Ding; Luciana Dini; Jelena Dinić; Miroslav Dinic; Albena T Dinkova-Kostova; Marc S Dionne; Jörg H W Distler; Abhinav Diwan; Ian M C Dixon; Mojgan Djavaheri-Mergny; Ina Dobrinski; Oxana Dobrovinskaya; Radek Dobrowolski; Renwick C J Dobson; Jelena Đokić; Serap Dokmeci Emre; Massimo Donadelli; Bo Dong; Xiaonan Dong; Zhiwu Dong; Gerald W Dorn Ii; Volker Dotsch; Huan Dou; Juan Dou; Moataz Dowaidar; Sami Dridi; Liat Drucker; Ailian Du; Caigan Du; Guangwei Du; Hai-Ning Du; Li-Lin Du; André du Toit; Shao-Bin Duan; Xiaoqiong Duan; Sónia P Duarte; Anna Dubrovska; Elaine A Dunlop; Nicolas Dupont; Raúl V Durán; Bilikere S Dwarakanath; Sergey A Dyshlovoy; Darius Ebrahimi-Fakhari; Leopold Eckhart; Charles L Edelstein; Thomas Efferth; Eftekhar Eftekharpour; Ludwig Eichinger; Nabil Eid; Tobias Eisenberg; N Tony Eissa; Sanaa Eissa; Miriam Ejarque; Abdeljabar El Andaloussi; Nazira El-Hage; Shahenda El-Naggar; Anna Maria Eleuteri; Eman S El-Shafey; Mohamed Elgendy; Aristides G Eliopoulos; María M Elizalde; Philip M Elks; Hans-Peter Elsasser; Eslam S Elsherbiny; Brooke M Emerling; N C Tolga Emre; Christina H Eng; Nikolai Engedal; Anna-Mart Engelbrecht; Agnete S T Engelsen; Jorrit M Enserink; Ricardo Escalante; Audrey Esclatine; Mafalda Escobar-Henriques; Eeva-Liisa Eskelinen; Lucile Espert; Makandjou-Ola Eusebio; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Francesco Facchiano; Bengt Fadeel; Claudio Fader; Alex C Faesen; W Douglas Fairlie; Alberto Falcó; Bjorn H Falkenburger; Daping Fan; Jie Fan; Yanbo Fan; Evandro F Fang; Yanshan Fang; Yognqi Fang; Manolis Fanto; Tamar Farfel-Becker; Mathias Faure; Gholamreza Fazeli; Anthony O Fedele; Arthur M Feldman; Du Feng; Jiachun Feng; Lifeng Feng; Yibin Feng; Yuchen Feng; Wei Feng; Thais Fenz Araujo; Thomas A Ferguson; Álvaro F Fernández; Jose C Fernandez-Checa; Sonia Fernández-Veledo; Alisdair R Fernie; Anthony W Ferrante; Alessandra Ferraresi; Merari F Ferrari; Julio C B Ferreira; Susan Ferro-Novick; Antonio Figueras; Riccardo Filadi; Nicoletta Filigheddu; Eduardo Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; Vittorio Fineschi; Francesca Finetti; Steven Finkbeiner; Edward A Fisher; Paul B Fisher; Flavio Flamigni; Steven J Fliesler; Trude H Flo; Ida Florance; Oliver Florey; Tullio Florio; Erika Fodor; Carlo Follo; Edward A Fon; Antonella Forlino; Francesco Fornai; Paola Fortini; Anna Fracassi; Alessandro Fraldi; Brunella Franco; Rodrigo Franco; Flavia Franconi; Lisa B Frankel; Scott L Friedman; Leopold F Fröhlich; Gema Frühbeck; Jose M Fuentes; Yukio Fujiki; Naonobu Fujita; Yuuki Fujiwara; Mitsunori Fukuda; Simone Fulda; Luc Furic; Norihiko Furuya; Carmela Fusco; Michaela U Gack; Lidia Gaffke; Sehamuddin Galadari; Alessia Galasso; Maria F Galindo; Sachith Gallolu Kankanamalage; Lorenzo Galluzzi; Vincent Galy; Noor Gammoh; Boyi Gan; Ian G Ganley; Feng Gao; Hui Gao; Minghui Gao; Ping Gao; Shou-Jiang Gao; Wentao Gao; Xiaobo Gao; Ana Garcera; Maria Noé Garcia; Verónica E Garcia; Francisco García-Del Portillo; Vega Garcia-Escudero; Aracely Garcia-Garcia; Marina Garcia-Macia; Diana García-Moreno; Carmen Garcia-Ruiz; Patricia García-Sanz; Abhishek D Garg; Ricardo Gargini; Tina Garofalo; Robert F Garry; Nils C Gassen; Damian Gatica; Liang Ge; Wanzhong Ge; Ruth Geiss-Friedlander; Cecilia Gelfi; Pascal Genschik; Ian E Gentle; Valeria Gerbino; Christoph Gerhardt; Kyla Germain; Marc Germain; David A Gewirtz; Elham Ghasemipour Afshar; Saeid Ghavami; Alessandra Ghigo; Manosij Ghosh; Georgios Giamas; Claudia Giampietri; Alexandra Giatromanolaki; Gary E Gibson; Spencer B Gibson; Vanessa Ginet; Edward Giniger; Carlotta Giorgi; Henrique Girao; Stephen E Girardin; Mridhula Giridharan; Sandy Giuliano; Cecilia Giulivi; Sylvie Giuriato; Julien Giustiniani; Alexander Gluschko; Veit Goder; Alexander Goginashvili; Jakub Golab; David C Goldstone; Anna Golebiewska; Luciana R Gomes; Rodrigo Gomez; Rubén Gómez-Sánchez; Maria Catalina Gomez-Puerto; Raquel Gomez-Sintes; Qingqiu Gong; Felix M Goni; Javier González-Gallego; Tomas Gonzalez-Hernandez; Rosa A Gonzalez-Polo; Jose A Gonzalez-Reyes; Patricia González-Rodríguez; Ing Swie Goping; Marina S Gorbatyuk; Nikolai V Gorbunov; Kıvanç Görgülü; Roxana M Gorojod; Sharon M Gorski; Sandro Goruppi; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Martin Graef; Markus H Gräler; Veronica Granatiero; Daniel Grasso; Joshua P Gray; Douglas R Green; Alexander Greenhough; Stephen L Gregory; Edward F Griffin; Mark W Grinstaff; Frederic Gros; Charles Grose; Angelina S Gross; Florian Gruber; Paolo Grumati; Tilman Grune; Xueyan Gu; Jun-Lin Guan; Carlos M Guardia; Kishore Guda; Flora Guerra; Consuelo Guerri; Prasun Guha; Carlos Guillén; Shashi Gujar; Anna Gukovskaya; Ilya Gukovsky; Jan Gunst; Andreas Günther; Anyonya R Guntur; Chuanyong Guo; Chun Guo; Hongqing Guo; Lian-Wang Guo; Ming Guo; Pawan Gupta; Shashi Kumar Gupta; Swapnil Gupta; Veer Bala Gupta; Vivek Gupta; Asa B Gustafsson; David D Gutterman; Ranjitha H B; Annakaisa Haapasalo; James E Haber; Aleksandra Hać; Shinji Hadano; Anders J Hafrén; Mansour Haidar; Belinda S Hall; Gunnel Halldén; Anne Hamacher-Brady; Andrea Hamann; Maho Hamasaki; Weidong Han; Malene Hansen; Phyllis I Hanson; Zijian Hao; Masaru Harada; Ljubica Harhaji-Trajkovic; Nirmala Hariharan; Nigil Haroon; James Harris; Takafumi Hasegawa; Noor Hasima Nagoor; Jeffrey A Haspel; Volker Haucke; Wayne D Hawkins; Bruce A Hay; Cole M Haynes; Soren B Hayrabedyan; Thomas S Hays; Congcong He; Qin He; Rong-Rong He; You-Wen He; Yu-Ying He; Yasser Heakal; Alexander M Heberle; J Fielding Hejtmancik; Gudmundur Vignir Helgason; Vanessa Henkel; Marc Herb; Alexander Hergovich; Anna Herman-Antosiewicz; Agustín Hernández; Carlos Hernandez; Sergio Hernandez-Diaz; Virginia Hernandez-Gea; Amaury Herpin; Judit Herreros; Javier H Hervás; Daniel Hesselson; Claudio Hetz; Volker T Heussler; Yujiro Higuchi; Sabine Hilfiker; Joseph A Hill; William S Hlavacek; Emmanuel A Ho; Idy H T Ho; Philip Wing-Lok Ho; Shu-Leong Ho; Wan Yun Ho; G Aaron Hobbs; Mark Hochstrasser; Peter H M Hoet; Daniel Hofius; Paul Hofman; Annika Höhn; Carina I Holmberg; Jose R Hombrebueno; Chang-Won Hong Yi-Ren Hong; Lora V Hooper; Thorsten Hoppe; Rastislav Horos; Yujin Hoshida; I-Lun Hsin; Hsin-Yun Hsu; Bing Hu; Dong Hu; Li-Fang Hu; Ming Chang Hu; Ronggui Hu; Wei Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Jinlian Hua; Yingqi Hua; Chongmin Huan; Canhua Huang; Chuanshu Huang; Chuanxin Huang; Chunling Huang; Haishan Huang; Kun Huang; Michael L H Huang; Rui Huang; Shan Huang; Tianzhi Huang; Xing Huang; Yuxiang Jack Huang; Tobias B Huber; Virginie Hubert; Christian A Hubner; Stephanie M Hughes; William E Hughes; Magali Humbert; Gerhard Hummer; James H Hurley; Sabah Hussain; Salik Hussain; Patrick J Hussey; Martina Hutabarat; Hui-Yun Hwang; Seungmin Hwang; Antonio Ieni; Fumiyo Ikeda; Yusuke Imagawa; Yuzuru Imai; Carol Imbriano; Masaya Imoto; Denise M Inman; Ken Inoki; Juan Iovanna; Renato V Iozzo; Giuseppe Ippolito; Javier E Irazoqui; Pablo Iribarren; Mohd Ishaq; Makoto Ishikawa; Nestor Ishimwe; Ciro Isidoro; Nahed Ismail; Shohreh Issazadeh-Navikas; Eisuke Itakura; Daisuke Ito; Davor Ivankovic; Saška Ivanova; Anand Krishnan V Iyer; José M Izquierdo; Masanori Izumi; Marja Jäättelä; Majid Sakhi Jabir; William T Jackson; Nadia Jacobo-Herrera; Anne-Claire Jacomin; Elise Jacquin; Pooja Jadiya; Hartmut Jaeschke; Chinnaswamy Jagannath; Arjen J Jakobi; Johan Jakobsson; Bassam Janji; Pidder Jansen-Dürr; Patric J Jansson; Jonathan Jantsch; Sławomir Januszewski; Alagie Jassey; Steve Jean; Hélène Jeltsch-David; Pavla Jendelova; Andreas Jenny; Thomas E Jensen; Niels Jessen; Jenna L Jewell; Jing Ji; Lijun Jia; Rui Jia; Liwen Jiang; Qing Jiang; Richeng Jiang; Teng Jiang; Xuejun Jiang; Yu Jiang; Maria Jimenez-Sanchez; Eun-Jung Jin; Fengyan Jin; Hongchuan Jin; Li Jin; Luqi Jin; Meiyan Jin; Si Jin; Eun-Kyeong Jo; Carine Joffre; Terje Johansen; Gail V W Johnson; Simon A Johnston; Eija Jokitalo; Mohit Kumar Jolly; Leo A B Joosten; Joaquin Jordan; Bertrand Joseph; Dianwen Ju; Jeong-Sun Ju; Jingfang Ju; Esmeralda Juárez; Delphine Judith; Gábor Juhász; Youngsoo Jun; Chang Hwa Jung; Sung-Chul Jung; Yong Keun Jung; Heinz Jungbluth; Johannes Jungverdorben; Steffen Just; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Daniel Kaganovich; Alon Kahana; Renate Kain; Shinjo Kajimura; Maria Kalamvoki; Manjula Kalia; Danuta S Kalinowski; Nina Kaludercic; Ioanna Kalvari; Joanna Kaminska; Vitaliy O Kaminskyy; Hiromitsu Kanamori; Keizo Kanasaki; Chanhee Kang; Rui Kang; Sang Sun Kang; Senthilvelrajan Kaniyappan; Tomotake Kanki; Thirumala-Devi Kanneganti; Anumantha G Kanthasamy; Arthi Kanthasamy; Marc Kantorow; Orsolya Kapuy; Michalis V Karamouzis; Md Razaul Karim; Parimal Karmakar; Rajesh G Katare; Masaru Kato; Stefan H E Kaufmann; Anu Kauppinen; Gur P Kaushal; Susmita Kaushik; Kiyoshi Kawasaki; Kemal Kazan; Po-Yuan Ke; Damien J Keating; Ursula Keber; John H Kehrl; Kate E Keller; Christian W Keller; Jongsook Kim Kemper; Candia M Kenific; Oliver Kepp; Stephanie Kermorgant; Andreas Kern; Robin Ketteler; Tom G Keulers; Boris Khalfin; Hany Khalil; Bilon Khambu; Shahid Y Khan; Vinoth Kumar Megraj Khandelwal; Rekha Khandia; Widuri Kho; Noopur V Khobrekar; Sataree Khuansuwan; Mukhran Khundadze; Samuel A Killackey; Dasol Kim; Deok Ryong Kim; Do-Hyung Kim; Dong-Eun Kim; Eun Young Kim; Eun-Kyoung Kim; Hak-Rim Kim; Hee-Sik Kim; Jeong Hun Kim; Jin Kyung Kim; Jin-Hoi Kim; Joungmok Kim; Ju Hwan Kim; Keun Il Kim; Peter K Kim; Seong-Jun Kim; Scot R Kimball; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Matthew A King; Kerri J Kinghorn; Conan G Kinsey; Vladimir Kirkin; Lorrie A Kirshenbaum; Sergey L Kiselev; Shuji Kishi; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Richard N Kitsis; Josef T Kittler; Ole Kjaerulff; Peter S Klein; Thomas Klopstock; Jochen Klucken; Helene Knævelsrud; Roland L Knorr; Ben C B Ko; Fred Ko; Jiunn-Liang Ko; Hotaka Kobayashi; Satoru Kobayashi; Ina Koch; Jan C Koch; Ulrich Koenig; Donat Kögel; Young Ho Koh; Masato Koike; Sepp D Kohlwein; Nur M Kocaturk; Masaaki Komatsu; Jeannette König; Toru Kono; Benjamin T Kopp; Tamas Korcsmaros; Gözde Korkmaz; Viktor I Korolchuk; Mónica Suárez Korsnes; Ali Koskela; Janaiah Kota; Yaichiro Kotake; Monica L Kotler; Yanjun Kou; Michael I Koukourakis; Evangelos Koustas; Attila L Kovacs; Tibor Kovács; Daisuke Koya; Tomohiro Kozako; Claudine Kraft; Dimitri Krainc; Helmut Krämer; Anna D Krasnodembskaya; Carole Kretz-Remy; Guido Kroemer; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Sabine Kuenen; Lars Kuerschner; Thomas Kukar; Ajay Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Sharad Kumar; Shinji Kume; Caroline Kumsta; Chanakya N Kundu; Mondira Kundu; Ajaikumar B Kunnumakkara; Lukasz Kurgan; Tatiana G Kutateladze; Ozlem Kutlu; SeongAe Kwak; Ho Jeong Kwon; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert La Spada; Patrick Labonté; Sylvain Ladoire; Ilaria Laface; Frank Lafont; Diane C Lagace; Vikramjit Lahiri; Zhibing Lai; Angela S Laird; Aparna Lakkaraju; Trond Lamark; Sheng-Hui Lan; Ane Landajuela; Darius J R Lane; Jon D Lane; Charles H Lang; Carsten Lange; Ülo Langel; Rupert Langer; Pierre Lapaquette; Jocelyn Laporte; Nicholas F LaRusso; Isabel Lastres-Becker; Wilson Chun Yu Lau; Gordon W Laurie; Sergio Lavandero; Betty Yuen Kwan Law; Helen Ka-Wai Law; Rob Layfield; Weidong Le; Herve Le Stunff; Alexandre Y Leary; Jean-Jacques Lebrun; Lionel Y W Leck; Jean-Philippe Leduc-Gaudet; Changwook Lee; Chung-Pei Lee; Da-Hye Lee; Edward B Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Heung Kyu Lee; Jae Man Lee; Jason S Lee; Jin-A Lee; Joo-Yong Lee; Jun Hee Lee; Michael Lee; Min Goo Lee; Min Jae Lee; Myung-Shik Lee; Sang Yoon Lee; Seung-Jae Lee; Stella Y Lee; Sung Bae Lee; Won Hee Lee; Ying-Ray Lee; Yong-Ho Lee; Youngil Lee; Christophe Lefebvre; Renaud Legouis; Yu L Lei; Yuchen Lei; Sergey Leikin; Gerd Leitinger; Leticia Lemus; Shuilong Leng; Olivia Lenoir; Guido Lenz; Heinz Josef Lenz; Paola Lenzi; Yolanda León; Andréia M Leopoldino; Christoph Leschczyk; Stina Leskelä; Elisabeth Letellier; Chi-Ting Leung; Po Sing Leung; Jeremy S Leventhal; Beth Levine; Patrick A Lewis; Klaus Ley; Bin Li; Da-Qiang Li; Jianming Li; Jing Li; Jiong Li; Ke Li; Liwu Li; Mei Li; Min Li; Min Li; Ming Li; Mingchuan Li; Pin-Lan Li; Ming-Qing Li; Qing Li; Sheng Li; Tiangang Li; Wei Li; Wenming Li; Xue Li; Yi-Ping Li; Yuan Li; Zhiqiang Li; Zhiyong Li; Zhiyuan Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Weicheng Liang; Yongheng Liang; YongTian Liang; Guanghong Liao; Lujian Liao; Mingzhi Liao; Yung-Feng Liao; Mariangela Librizzi; Pearl P Y Lie; Mary A Lilly; Hyunjung J Lim; Thania R R Lima; Federica Limana; Chao Lin; Chih-Wen Lin; Dar-Shong Lin; Fu-Cheng Lin; Jiandie D Lin; Kurt M Lin; Kwang-Huei Lin; Liang-Tzung Lin; Pei-Hui Lin; Qiong Lin; Shaofeng Lin; Su-Ju Lin; Wenyu Lin; Xueying Lin; Yao-Xin Lin; Yee-Shin Lin; Rafael Linden; Paula Lindner; Shuo-Chien Ling; Paul Lingor; Amelia K Linnemann; Yih-Cherng Liou; Marta M Lipinski; Saška Lipovšek; Vitor A Lira; Natalia Lisiak; Paloma B Liton; Chao Liu; Ching-Hsuan Liu; Chun-Feng Liu; Cui Hua Liu; Fang Liu; Hao Liu; Hsiao-Sheng Liu; Hua-Feng Liu; Huifang Liu; Jia Liu; Jing Liu; Julia Liu; Leyuan Liu; Longhua Liu; Meilian Liu; Qin Liu; Wei Liu; Wende Liu; Xiao-Hong Liu; Xiaodong Liu; Xingguo Liu; Xu Liu; Xuedong Liu; Yanfen Liu; Yang Liu; Yang Liu; Yueyang Liu; Yule Liu; J Andrew Livingston; Gerard Lizard; Jose M Lizcano; Senka Ljubojevic-Holzer; Matilde E LLeonart; David Llobet-Navàs; Alicia Llorente; Chih Hung Lo; Damián Lobato-Márquez; Qi Long; Yun Chau Long; Ben Loos; Julia A Loos; Manuela G López; Guillermo López-Doménech; José Antonio López-Guerrero; Ana T López-Jiménez; Óscar López-Pérez; Israel López-Valero; Magdalena J Lorenowicz; Mar Lorente; Peter Lorincz; Laura Lossi; Sophie Lotersztajn; Penny E Lovat; Jonathan F Lovell; Alenka Lovy; Péter Lőw; Guang Lu; Haocheng Lu; Jia-Hong Lu; Jin-Jian Lu; Mengji Lu; Shuyan Lu; Alessandro Luciani; John M Lucocq; Paula Ludovico; Micah A Luftig; Morten Luhr; Diego Luis-Ravelo; Julian J Lum; Liany Luna-Dulcey; Anders H Lund; Viktor K Lund; Jan D Lünemann; Patrick Lüningschrör; Honglin Luo; Rongcan Luo; Shouqing Luo; Zhi Luo; Claudio Luparello; Bernhard Lüscher; Luan Luu; Alex Lyakhovich; Konstantin G Lyamzaev; Alf Håkon Lystad; Lyubomyr Lytvynchuk; Alvin C Ma; Changle Ma; Mengxiao Ma; Ning-Fang Ma; Quan-Hong Ma; Xinliang Ma; Yueyun Ma; Zhenyi Ma; Ormond A MacDougald; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; Sandra Maday; Frank Madeo; Muniswamy Madesh; Tobias Madl; Julio Madrigal-Matute; Akiko Maeda; Yasuhiro Maejima; Marta Magarinos; Poornima Mahavadi; Emiliano Maiani; Kenneth Maiese; Panchanan Maiti; Maria Chiara Maiuri; Barbara Majello; Michael B Major; Elena Makareeva; Fayaz Malik; Karthik Mallilankaraman; Walter Malorni; Alina Maloyan; Najiba Mammadova; Gene Chi Wai Man; Federico Manai; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Masoud H Manjili; Ravi Manjithaya; Patricio Manque; Bella B Manshian; Raquel Manzano; Claudia Manzoni; Kai Mao; Cinzia Marchese; Sandrine Marchetti; Anna Maria Marconi; Fabrizio Marcucci; Stefania Mardente; Olga A Mareninova; Marta Margeta; Muriel Mari; Sara Marinelli; Oliviero Marinelli; Guillermo Mariño; Sofia Mariotto; Richard S Marshall; Mark R Marten; Sascha Martens; Alexandre P J Martin; Katie R Martin; Sara Martin; Shaun Martin; Adrián Martín-Segura; Miguel A Martín-Acebes; Inmaculada Martin-Burriel; Marcos Martin-Rincon; Paloma Martin-Sanz; José A Martina; Wim Martinet; Aitor Martinez; Ana Martinez; Jennifer Martinez; Moises Martinez Velazquez; Nuria Martinez-Lopez; Marta Martinez-Vicente; Daniel O Martins; Joilson O Martins; Waleska K Martins; Tania Martins-Marques; Emanuele Marzetti; Shashank Masaldan; Celine Masclaux-Daubresse; Douglas G Mashek; Valentina Massa; Lourdes Massieu; Glenn R Masson; Laura Masuelli; Anatoliy I Masyuk; Tetyana V Masyuk; Paola Matarrese; Ander Matheu; Satoaki Matoba; Sachiko Matsuzaki; Pamela Mattar; Alessandro Matte; Domenico Mattoscio; José L Mauriz; Mario Mauthe; Caroline Mauvezin; Emanual Maverakis; Paola Maycotte; Johanna Mayer; Gianluigi Mazzoccoli; Cristina Mazzoni; Joseph R Mazzulli; Nami McCarty; Christine McDonald; Mitchell R McGill; Sharon L McKenna; BethAnn McLaughlin; Fionn McLoughlin; Mark A McNiven; Thomas G McWilliams; Fatima Mechta-Grigoriou; Tania Catarina Medeiros; Diego L Medina; Lynn A Megeney; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Alfred J Meijer; Annemarie H Meijer; Jakob Mejlvang; Alicia Meléndez; Annette Melk; Gonen Memisoglu; Alexandrina F Mendes; Delong Meng; Fei Meng; Tian Meng; Rubem Menna-Barreto; Manoj B Menon; Carol Mercer; Anne E Mercier; Jean-Louis Mergny; Adalberto Merighi; Seth D Merkley; Giuseppe Merla; Volker Meske; Ana Cecilia Mestre; Shree Padma Metur; Christian Meyer; Hemmo Meyer; Wenyi Mi; Jeanne Mialet-Perez; Junying Miao; Lucia Micale; Yasuo Miki; Enrico Milan; Małgorzata Milczarek; Dana L Miller; Samuel I Miller; Silke Miller; Steven W Millward; Ira Milosevic; Elena A Minina; Hamed Mirzaei; Hamid Reza Mirzaei; Mehdi Mirzaei; Amit Mishra; Nandita Mishra; Paras Kumar Mishra; Maja Misirkic Marjanovic; Roberta Misasi; Amit Misra; Gabriella Misso; Claire Mitchell; Geraldine Mitou; Tetsuji Miura; Shigeki Miyamoto; Makoto Miyazaki; Mitsunori Miyazaki; Taiga Miyazaki; Keisuke Miyazawa; Noboru Mizushima; Trine H Mogensen; Baharia Mograbi; Reza Mohammadinejad; Yasir Mohamud; Abhishek Mohanty; Sipra Mohapatra; Torsten Möhlmann; Asif Mohmmed; Anna Moles; Kelle H Moley; Maurizio Molinari; Vincenzo Mollace; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Costanza Montagna; Mervyn J Monteiro; Andrea Montella; L Ruth Montes; Barbara Montico; Vinod K Mony; Giacomo Monzio Compagnoni; Michael N Moore; Mohammad A Moosavi; Ana L Mora; Marina Mora; David Morales-Alamo; Rosario Moratalla; Paula I Moreira; Elena Morelli; Sandra Moreno; Daniel Moreno-Blas; Viviana Moresi; Benjamin Morga; Alwena H Morgan; Fabrice Morin; Hideaki Morishita; Orson L Moritz; Mariko Moriyama; Yuji Moriyasu; Manuela Morleo; Eugenia Morselli; Jose F Moruno-Manchon; Jorge Moscat; Serge Mostowy; Elisa Motori; Andrea Felinto Moura; Naima Moustaid-Moussa; Maria Mrakovcic; Gabriel Muciño-Hernández; Anupam Mukherjee; Subhadip Mukhopadhyay; Jean M Mulcahy Levy; Victoriano Mulero; Sylviane Muller; Christian Münch; Ashok Munjal; Pura Munoz-Canoves; Teresa Muñoz-Galdeano; Christian Münz; Tomokazu Murakawa; Claudia Muratori; Brona M Murphy; J Patrick Murphy; Aditya Murthy; Timo T Myöhänen; Indira U Mysorekar; Jennifer Mytych; Seyed Mohammad Nabavi; Massimo Nabissi; Péter Nagy; Jihoon Nah; Aimable Nahimana; Ichiro Nakagawa; Ken Nakamura; Hitoshi Nakatogawa; Shyam S Nandi; Meera Nanjundan; Monica Nanni; Gennaro Napolitano; Roberta Nardacci; Masashi Narita; Melissa Nassif; Ilana Nathan; Manabu Natsumeda; Ryno J Naude; Christin Naumann; Olaia Naveiras; Fatemeh Navid; Steffan T Nawrocki; Taras Y Nazarko; Francesca Nazio; Florentina Negoita; Thomas Neill; Amanda L Neisch; Luca M Neri; Mihai G Netea; Patrick Neubert; Thomas P Neufeld; Dietbert Neumann; Albert Neutzner; Phillip T Newton; Paul A Ney; Ioannis P Nezis; Charlene C W Ng; Tzi Bun Ng; Hang T T Nguyen; Long T Nguyen; Hong-Min Ni; Clíona Ní Cheallaigh; Zhenhong Ni; M Celeste Nicolao; Francesco Nicoli; Manuel Nieto-Diaz; Per Nilsson; Shunbin Ning; Rituraj Niranjan; Hiroshi Nishimune; Mireia Niso-Santano; Ralph A Nixon; Annalisa Nobili; Clevio Nobrega; Takeshi Noda; Uxía Nogueira-Recalde; Trevor M Nolan; Ivan Nombela; Ivana Novak; Beatriz Novoa; Takashi Nozawa; Nobuyuki Nukina; Carmen Nussbaum-Krammer; Jesper Nylandsted; Tracey R O'Donovan; Seónadh M O'Leary; Eyleen J O'Rourke; Mary P O'Sullivan; Timothy E O'Sullivan; Salvatore Oddo; Ina Oehme; Michinaga Ogawa; Eric Ogier-Denis; Margret H Ogmundsdottir; Besim Ogretmen; Goo Taeg Oh; Seon-Hee Oh; Young J Oh; Takashi Ohama; Yohei Ohashi; Masaki Ohmuraya; Vasileios Oikonomou; Rani Ojha; Koji Okamoto; Hitoshi Okazawa; Masahide Oku; Sara Oliván; Jorge M A Oliveira; Michael Ollmann; James A Olzmann; Shakib Omari; M Bishr Omary; Gizem Önal; Martin Ondrej; Sang-Bing Ong; Sang-Ging Ong; Anna Onnis; Juan A Orellana; Sara Orellana-Muñoz; Maria Del Mar Ortega-Villaizan; Xilma R Ortiz-Gonzalez; Elena Ortona; Heinz D Osiewacz; Abdel-Hamid K Osman; Rosario Osta; Marisa S Otegui; Kinya Otsu; Christiane Ott; Luisa Ottobrini; Jing-Hsiung James Ou; Tiago F Outeiro; Inger Oynebraten; Melek Ozturk; Gilles Pagès; Susanta Pahari; Marta Pajares; Utpal B Pajvani; Rituraj Pal; Simona Paladino; Nicolas Pallet; Michela Palmieri; Giuseppe Palmisano; Camilla Palumbo; Francesco Pampaloni; Lifeng Pan; Qingjun Pan; Wenliang Pan; Xin Pan; Ganna Panasyuk; Rahul Pandey; Udai B Pandey; Vrajesh Pandya; Francesco Paneni; Shirley Y Pang; Elisa Panzarini; Daniela L Papademetrio; Elena Papaleo; Daniel Papinski; Diana Papp; Eun Chan Park; Hwan Tae Park; Ji-Man Park; Jong-In Park; Joon Tae Park; Junsoo Park; Sang Chul Park; Sang-Youel Park; Abraham H Parola; Jan B Parys; Adrien Pasquier; Benoit Pasquier; João F Passos; Nunzia Pastore; Hemal H Patel; Daniel Patschan; Sophie Pattingre; Gustavo Pedraza-Alva; Jose Pedraza-Chaverri; Zully Pedrozo; Gang Pei; Jianming Pei; Hadas Peled-Zehavi; Joaquín M Pellegrini; Joffrey Pelletier; Miguel A Peñalva; Di Peng; Ying Peng; Fabio Penna; Maria Pennuto; Francesca Pentimalli; Cláudia Mf Pereira; Gustavo J S Pereira; Lilian C Pereira; Luis Pereira de Almeida; Nirma D Perera; Ángel Pérez-Lara; Ana B Perez-Oliva; María Esther Pérez-Pérez; Palsamy Periyasamy; Andras Perl; Cristiana Perrotta; Ida Perrotta; Richard G Pestell; Morten Petersen; Irina Petrache; Goran Petrovski; Thorsten Pfirrmann; Astrid S Pfister; Jennifer A Philips; Huifeng Pi; Anna Picca; Alicia M Pickrell; Sandy Picot; Giovanna M Pierantoni; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Karolina Pierzynowska; Federico Pietrocola; Miroslawa Pietruczuk; Claudio Pignata; Felipe X Pimentel-Muiños; Mario Pinar; Roberta O Pinheiro; Ronit Pinkas-Kramarski; Paolo Pinton; Karolina Pircs; Sujan Piya; Paola Pizzo; Theo S Plantinga; Harald W Platta; Ainhoa Plaza-Zabala; Markus Plomann; Egor Y Plotnikov; Helene Plun-Favreau; Ryszard Pluta; Roger Pocock; Stefanie Pöggeler; Christian Pohl; Marc Poirot; Angelo Poletti; Marisa Ponpuak; Hana Popelka; Blagovesta Popova; Helena Porta; Soledad Porte Alcon; Eliana Portilla-Fernandez; Martin Post; Malia B Potts; Joanna Poulton; Ted Powers; Veena Prahlad; Tomasz K Prajsnar; Domenico Praticò; Rosaria Prencipe; Muriel Priault; Tassula Proikas-Cezanne; Vasilis J Promponas; Christopher G Proud; Rosa Puertollano; Luigi Puglielli; Thomas Pulinilkunnil; Deepika Puri; Rajat Puri; Julien Puyal; Xiaopeng Qi; Yongmei Qi; Wenbin Qian; Lei Qiang; Yu Qiu; Joe Quadrilatero; Jorge Quarleri; Nina Raben; Hannah Rabinowich; Debora Ragona; Michael J Ragusa; Nader Rahimi; Marveh Rahmati; Valeria Raia; Nuno Raimundo; Namakkal-Soorappan Rajasekaran; Sriganesh Ramachandra Rao; Abdelhaq Rami; Ignacio Ramírez-Pardo; David B Ramsden; Felix Randow; Pundi N Rangarajan; Danilo Ranieri; Hai Rao; Lang Rao; Rekha Rao; Sumit Rathore; J Arjuna Ratnayaka; Edward A Ratovitski; Palaniyandi Ravanan; Gloria Ravegnini; Swapan K Ray; Babak Razani; Vito Rebecca; Fulvio Reggiori; Anne Régnier-Vigouroux; Andreas S Reichert; David Reigada; Jan H Reiling; Theo Rein; Siegfried Reipert; Rokeya Sultana Rekha; Hongmei Ren; Jun Ren; Weichao Ren; Tristan Renault; Giorgia Renga; Karen Reue; Kim Rewitz; Bruna Ribeiro de Andrade Ramos; S Amer Riazuddin; Teresa M Ribeiro-Rodrigues; Jean-Ehrland Ricci; Romeo Ricci; Victoria Riccio; Des R Richardson; Yasuko Rikihisa; Makarand V Risbud; Ruth M Risueño; Konstantinos Ritis; Salvatore Rizza; Rosario Rizzuto; Helen C Roberts; Luke D Roberts; Katherine J Robinson; Maria Carmela Roccheri; Stephane Rocchi; George G Rodney; Tiago Rodrigues; Vagner Ramon Rodrigues Silva; Amaia Rodriguez; Ruth Rodriguez-Barrueco; Nieves Rodriguez-Henche; Humberto Rodriguez-Rocha; Jeroen Roelofs; Robert S Rogers; Vladimir V Rogov; Ana I Rojo; Krzysztof Rolka; Vanina Romanello; Luigina Romani; Alessandra Romano; Patricia S Romano; David Romeo-Guitart; Luis C Romero; Montserrat Romero; Joseph C Roney; Christopher Rongo; Sante Roperto; Mathias T Rosenfeldt; Philip Rosenstiel; Anne G Rosenwald; Kevin A Roth; Lynn Roth; Steven Roth; Kasper M A Rouschop; Benoit D Roussel; Sophie Roux; Patrizia Rovere-Querini; Ajit Roy; Aurore Rozieres; Diego Ruano; David C Rubinsztein; Maria P Rubtsova; Klaus Ruckdeschel; Christoph Ruckenstuhl; Emil Rudolf; Rüdiger Rudolf; Alessandra Ruggieri; Avnika Ashok Ruparelia; Paola Rusmini; Ryan R Russell; Gian Luigi Russo; Maria Russo; Rossella Russo; Oxana O Ryabaya; Kevin M Ryan; Kwon-Yul Ryu; Maria Sabater-Arcis; Ulka Sachdev; Michael Sacher; Carsten Sachse; Abhishek Sadhu; Junichi Sadoshima; Nathaniel Safren; Paul Saftig; Antonia P Sagona; Gaurav Sahay; Amirhossein Sahebkar; Mustafa Sahin; Ozgur Sahin; Sumit Sahni; Nayuta Saito; Shigeru Saito; Tsunenori Saito; Ryohei Sakai; Yasuyoshi Sakai; Jun-Ichi Sakamaki; Kalle Saksela; Gloria Salazar; Anna Salazar-Degracia; Ghasem H Salekdeh; Ashok K Saluja; Belém Sampaio-Marques; Maria Cecilia Sanchez; Jose A Sanchez-Alcazar; Victoria Sanchez-Vera; Vanessa Sancho-Shimizu; J Thomas Sanderson; Marco Sandri; Stefano Santaguida; Laura Santambrogio; Magda M Santana; Giorgio Santoni; Alberto Sanz; Pascual Sanz; Shweta Saran; Marco Sardiello; Timothy J Sargeant; Apurva Sarin; Chinmoy Sarkar; Sovan Sarkar; Maria-Rosa Sarrias; Surajit Sarkar; Dipanka Tanu Sarmah; Jaakko Sarparanta; Aishwarya Sathyanarayan; Ranganayaki Sathyanarayanan; K Matthew Scaglione; Francesca Scatozza; Liliana Schaefer; Zachary T Schafer; Ulrich E Schaible; Anthony H V Schapira; Michael Scharl; Hermann M Schatzl; Catherine H Schein; Wiep Scheper; David Scheuring; Maria Vittoria Schiaffino; Monica Schiappacassi; Rainer Schindl; Uwe Schlattner; Oliver Schmidt; Roland Schmitt; Stephen D Schmidt; Ingo Schmitz; Eran Schmukler; Anja Schneider; Bianca E Schneider; Romana Schober; Alejandra C Schoijet; Micah B Schott; Michael Schramm; Bernd Schröder; Kai Schuh; Christoph Schüller; Ryan J Schulze; Lea Schürmanns; Jens C Schwamborn; Melanie Schwarten; Filippo Scialo; Sebastiano Sciarretta; Melanie J Scott; Kathleen W Scotto; A Ivana Scovassi; Andrea Scrima; Aurora Scrivo; David Sebastian; Salwa Sebti; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Iban Seiliez; Ekihiro Seki; Scott B Selleck; Frank W Sellke; Joshua T Selsby; Michael Sendtner; Serif Senturk; Elena Seranova; Consolato Sergi; Ruth Serra-Moreno; Hiromi Sesaki; Carmine Settembre; Subba Rao Gangi Setty; Gianluca Sgarbi; Ou Sha; John J Shacka; Javeed A Shah; Dantong Shang; Changshun Shao; Feng Shao; Soroush Sharbati; Lisa M Sharkey; Dipali Sharma; Gaurav Sharma; Kulbhushan Sharma; Pawan Sharma; Surendra Sharma; Han-Ming Shen; Hongtao Shen; Jiangang Shen; Ming Shen; Weili Shen; Zheni Shen; Rui Sheng; Zhi Sheng; Zu-Hang Sheng; Jianjian Shi; Xiaobing Shi; Ying-Hong Shi; Kahori Shiba-Fukushima; Jeng-Jer Shieh; Yohta Shimada; Shigeomi Shimizu; Makoto Shimozawa; Takahiro Shintani; Christopher J Shoemaker; Shahla Shojaei; Ikuo Shoji; Bhupendra V Shravage; Viji Shridhar; Chih-Wen Shu; Hong-Bing Shu; Ke Shui; Arvind K Shukla; Timothy E Shutt; Valentina Sica; Aleem Siddiqui; Amanda Sierra; Virginia Sierra-Torre; Santiago Signorelli; Payel Sil; Bruno J de Andrade Silva; Johnatas D Silva; Eduardo Silva-Pavez; Sandrine Silvente-Poirot; Rachel E Simmonds; Anna Katharina Simon; Hans-Uwe Simon; Matias Simons; Anurag Singh; Lalit P Singh; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Sudha B Singh; Sunaina Singh; Surinder Pal Singh; Debasish Sinha; Rohit Anthony Sinha; Sangita Sinha; Agnieszka Sirko; Kapil Sirohi; Efthimios L Sivridis; Panagiotis Skendros; Aleksandra Skirycz; Iva Slaninová; Soraya S Smaili; Andrei Smertenko; Matthew D Smith; Stefaan J Soenen; Eun Jung Sohn; Sophia P M Sok; Giancarlo Solaini; Thierry Soldati; Scott A Soleimanpour; Rosa M Soler; Alexei Solovchenko; Jason A Somarelli; Avinash Sonawane; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Kunhua Song; Zhiyin Song; Leandro R Soria; Maurizio Sorice; Alexander A Soukas; Sandra-Fausia Soukup; Diana Sousa; Nadia Sousa; Paul A Spagnuolo; Stephen A Spector; M M Srinivas Bharath; Daret St Clair; Venturina Stagni; Leopoldo Staiano; Clint A Stalnecker; Metodi V Stankov; Peter B Stathopulos; Katja Stefan; Sven Marcel Stefan; Leonidas Stefanis; Joan S Steffan; Alexander Steinkasserer; Harald Stenmark; Jared Sterneckert; Craig Stevens; Veronika Stoka; Stephan Storch; Björn Stork; Flavie Strappazzon; Anne Marie Strohecker; Dwayne G Stupack; Huanxing Su; Ling-Yan Su; Longxiang Su; Ana M Suarez-Fontes; Carlos S Subauste; Selvakumar Subbian; Paula V Subirada; Ganapasam Sudhandiran; Carolyn M Sue; Xinbing Sui; Corey Summers; Guangchao Sun; Jun Sun; Kang Sun; Meng-Xiang Sun; Qiming Sun; Yi Sun; Zhongjie Sun; Karen K S Sunahara; Eva Sundberg; Katalin Susztak; Peter Sutovsky; Hidekazu Suzuki; Gary Sweeney; J David Symons; Stephen Cho Wing Sze; Nathaniel J Szewczyk; Anna Tabęcka-Łonczynska; Claudio Tabolacci; Frank Tacke; Heinrich Taegtmeyer; Marco Tafani; Mitsuo Tagaya; Haoran Tai; Stephen W G Tait; Yoshinori Takahashi; Szabolcs Takats; Priti Talwar; Chit Tam; Shing Yau Tam; Davide Tampellini; Atsushi Tamura; Chong Teik Tan; Eng-King Tan; Ya-Qin Tan; Masaki Tanaka; Motomasa Tanaka; Daolin Tang; Jingfeng Tang; Tie-Shan Tang; Isei Tanida; Zhipeng Tao; Mohammed Taouis; Lars Tatenhorst; Nektarios Tavernarakis; Allen Taylor; Gregory A Taylor; Joan M Taylor; Elena Tchetina; Andrew R Tee; Irmgard Tegeder; David Teis; Natercia Teixeira; Fatima Teixeira-Clerc; Kumsal A Tekirdag; Tewin Tencomnao; Sandra Tenreiro; Alexei V Tepikin; Pilar S Testillano; Gianluca Tettamanti; Pierre-Louis Tharaux; Kathrin Thedieck; Arvind A Thekkinghat; Stefano Thellung; Josephine W Thinwa; V P Thirumalaikumar; Sufi Mary Thomas; Paul G Thomes; Andrew Thorburn; Lipi Thukral; Thomas Thum; Michael Thumm; Ling Tian; Ales Tichy; Andreas Till; Vincent Timmerman; Vladimir I Titorenko; Sokol V Todi; Krassimira Todorova; Janne M Toivonen; Luana Tomaipitinca; Dhanendra Tomar; Cristina Tomas-Zapico; Sergej Tomić; Benjamin Chun-Kit Tong; Chao Tong; Xin Tong; Sharon A Tooze; Maria L Torgersen; Satoru Torii; Liliana Torres-López; Alicia Torriglia; Christina G Towers; Roberto Towns; Shinya Toyokuni; Vladimir Trajkovic; Donatella Tramontano; Quynh-Giao Tran; Leonardo H Travassos; Charles B Trelford; Shirley Tremel; Ioannis P Trougakos; Betty P Tsao; Mario P Tschan; Hung-Fat Tse; Tak Fu Tse; Hitoshi Tsugawa; Andrey S Tsvetkov; David A Tumbarello; Yasin Tumtas; María J Tuñón; Sandra Turcotte; Boris Turk; Vito Turk; Bradley J Turner; Richard I Tuxworth; Jessica K Tyler; Elena V Tyutereva; Yasuo Uchiyama; Aslihan Ugun-Klusek; Holm H Uhlig; Marzena Ułamek-Kozioł; Ilya V Ulasov; Midori Umekawa; Christian Ungermann; Rei Unno; Sylvie Urbe; Elisabet Uribe-Carretero; Suayib Üstün; Vladimir N Uversky; Thomas Vaccari; Maria I Vaccaro; Björn F Vahsen; Helin Vakifahmetoglu-Norberg; Rut Valdor; Maria J Valente; Ayelén Valko; Richard B Vallee; Angela M Valverde; Greet Van den Berghe; Stijn van der Veen; Luc Van Kaer; Jorg van Loosdregt; Sjoerd J L van Wijk; Wim Vandenberghe; Ilse Vanhorebeek; Marcos A Vannier-Santos; Nicola Vannini; M Cristina Vanrell; Chiara Vantaggiato; Gabriele Varano; Isabel Varela-Nieto; Máté Varga; M Helena Vasconcelos; Somya Vats; Demetrios G Vavvas; Ignacio Vega-Naredo; Silvia Vega-Rubin-de-Celis; Guillermo Velasco; Ariadna P Velázquez; Tibor Vellai; Edo Vellenga; Francesca Velotti; Mireille Verdier; Panayotis Verginis; Isabelle Vergne; Paul Verkade; Manish Verma; Patrik Verstreken; Tim Vervliet; Jörg Vervoorts; Alexandre T Vessoni; Victor M Victor; Michel Vidal; Chiara Vidoni; Otilia V Vieira; Richard D Vierstra; Sonia Viganó; Helena Vihinen; Vinoy Vijayan; Miquel Vila; Marçal Vilar; José M Villalba; Antonio Villalobo; Beatriz Villarejo-Zori; Francesc Villarroya; Joan Villarroya; Olivier Vincent; Cecile Vindis; Christophe Viret; Maria Teresa Viscomi; Dora Visnjic; Ilio Vitale; David J Vocadlo; Olga V Voitsekhovskaja; Cinzia Volonté; Mattia Volta; Marta Vomero; Clarissa Von Haefen; Marc A Vooijs; Wolfgang Voos; Ljubica Vucicevic; Richard Wade-Martins; Satoshi Waguri; Kenrick A Waite; Shuji Wakatsuki; David W Walker; Mark J Walker; Simon A Walker; Jochen Walter; Francisco G Wandosell; Bo Wang; Chao-Yung Wang; Chen Wang; Chenran Wang; Chenwei Wang; Cun-Yu Wang; Dong Wang; Fangyang Wang; Feng Wang; Fengming Wang; Guansong Wang; Han Wang; Hao Wang; Hexiang Wang; Hong-Gang Wang; Jianrong Wang; Jigang Wang; Jiou Wang; Jundong Wang; Kui Wang; Lianrong Wang; Liming Wang; Maggie Haitian Wang; Meiqing Wang; Nanbu Wang; Pengwei Wang; Peipei Wang; Ping Wang; Ping Wang; Qing Jun Wang; Qing Wang; Qing Kenneth Wang; Qiong A Wang; Wen-Tao Wang; Wuyang Wang; Xinnan Wang; Xuejun Wang; Yan Wang; Yanchang Wang; Yanzhuang Wang; Yen-Yun Wang; Yihua Wang; Yipeng Wang; Yu Wang; Yuqi Wang; Zhe Wang; Zhenyu Wang; Zhouguang Wang; Gary Warnes; Verena Warnsmann; Hirotaka Watada; Eizo Watanabe; Maxinne Watchon; Anna Wawrzyńska; Timothy E Weaver; Grzegorz Wegrzyn; Ann M Wehman; Huafeng Wei; Lei Wei; Taotao Wei; Yongjie Wei; Oliver H Weiergräber; Conrad C Weihl; Günther Weindl; Ralf Weiskirchen; Alan Wells; Runxia H Wen; Xin Wen; Antonia Werner; Beatrice Weykopf; Sally P Wheatley; J Lindsay Whitton; Alexander J Whitworth; Katarzyna Wiktorska; Manon E Wildenberg; Tom Wileman; Simon Wilkinson; Dieter Willbold; Brett Williams; Robin S B Williams; Roger L Williams; Peter R Williamson; Richard A Wilson; Beate Winner; Nathaniel J Winsor; Steven S Witkin; Harald Wodrich; Ute Woehlbier; Thomas Wollert; Esther Wong; Jack Ho Wong; Richard W Wong; Vincent Kam Wai Wong; W Wei-Lynn Wong; An-Guo Wu; Chengbiao Wu; Jian Wu; Junfang Wu; Kenneth K Wu; Min Wu; Shan-Ying Wu; Shengzhou Wu; Shu-Yan Wu; Shufang Wu; William K K Wu; Xiaohong Wu; Xiaoqing Wu; Yao-Wen Wu; Yihua Wu; Ramnik J Xavier; Hongguang Xia; Lixin Xia; Zhengyuan Xia; Ge Xiang; Jin Xiang; Mingliang Xiang; Wei Xiang; Bin Xiao; Guozhi Xiao; Hengyi Xiao; Hong-Tao Xiao; Jian Xiao; Lan Xiao; Shi Xiao; Yin Xiao; Baoming Xie; Chuan-Ming Xie; Min Xie; Yuxiang Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Congfeng Xu; En Xu; Haoxing Xu; Jing Xu; JinRong Xu; Liang Xu; Wen Wen Xu; Xiulong Xu; Yu Xue; Sokhna M S Yakhine-Diop; Masamitsu Yamaguchi; Osamu Yamaguchi; Ai Yamamoto; Shunhei Yamashina; Shengmin Yan; Shian-Jang Yan; Zhen Yan; Yasuo Yanagi; Chuanbin Yang; Dun-Sheng Yang; Huan Yang; Huang-Tian Yang; Hui Yang; Jin-Ming Yang; Jing Yang; Jingyu Yang; Ling Yang; Liu Yang; Ming Yang; Pei-Ming Yang; Qian Yang; Seungwon Yang; Shu Yang; Shun-Fa Yang; Wannian Yang; Wei Yuan Yang; Xiaoyong Yang; Xuesong Yang; Yi Yang; Ying Yang; Honghong Yao; Shenggen Yao; Xiaoqiang Yao; Yong-Gang Yao; Yong-Ming Yao; Takahiro Yasui; Meysam Yazdankhah; Paul M Yen; Cong Yi; Xiao-Ming Yin; Yanhai Yin; Zhangyuan Yin; Ziyi Yin; Meidan Ying; Zheng Ying; Calvin K Yip; Stephanie Pei Tung Yiu; Young H Yoo; Kiyotsugu Yoshida; Saori R Yoshii; Tamotsu Yoshimori; Bahman Yousefi; Boxuan Yu; Haiyang Yu; Jun Yu; Jun Yu; Li Yu; Ming-Lung Yu; Seong-Woon Yu; Victor C Yu; W Haung Yu; Zhengping Yu; Zhou Yu; Junying Yuan; Ling-Qing Yuan; Shilin Yuan; Shyng-Shiou F Yuan; Yanggang Yuan; Zengqiang Yuan; Jianbo Yue; Zhenyu Yue; Jeanho Yun; Raymond L Yung; David N Zacks; Gabriele Zaffagnini; Vanessa O Zambelli; Isabella Zanella; Qun S Zang; Sara Zanivan; Silvia Zappavigna; Pilar Zaragoza; Konstantinos S Zarbalis; Amir Zarebkohan; Amira Zarrouk; Scott O Zeitlin; Jialiu Zeng; Ju-Deng Zeng; Eva Žerovnik; Lixuan Zhan; Bin Zhang; Donna D Zhang; Hanlin Zhang; Hong Zhang; Hong Zhang; Honghe Zhang; Huafeng Zhang; Huaye Zhang; Hui Zhang; Hui-Ling Zhang; Jianbin Zhang; Jianhua Zhang; Jing-Pu Zhang; Kalin Y B Zhang; Leshuai W Zhang; Lin Zhang; Lisheng Zhang; Lu Zhang; Luoying Zhang; Menghuan Zhang; Peng Zhang; Sheng Zhang; Wei Zhang; Xiangnan Zhang; Xiao-Wei Zhang; Xiaolei Zhang; Xiaoyan Zhang; Xin Zhang; Xinxin Zhang; Xu Dong Zhang; Yang Zhang; Yanjin Zhang; Yi Zhang; Ying-Dong Zhang; Yingmei Zhang; Yuan-Yuan Zhang; Yuchen Zhang; Zhe Zhang; Zhengguang Zhang; Zhibing Zhang; Zhihai Zhang; Zhiyong Zhang; Zili Zhang; Haobin Zhao; Lei Zhao; Shuang Zhao; Tongbiao Zhao; Xiao-Fan Zhao; Ying Zhao; Yongchao Zhao; Yongliang Zhao; Yuting Zhao; Guoping Zheng; Kai Zheng; Ling Zheng; Shizhong Zheng; Xi-Long Zheng; Yi Zheng; Zu-Guo Zheng; Boris Zhivotovsky; Qing Zhong; Ao Zhou; Ben Zhou; Cefan Zhou; Gang Zhou; Hao Zhou; Hong Zhou; Hongbo Zhou; Jie Zhou; Jing Zhou; Jing Zhou; Jiyong Zhou; Kailiang Zhou; Rongjia Zhou; Xu-Jie Zhou; Yanshuang Zhou; Yinghong Zhou; Yubin Zhou; Zheng-Yu Zhou; Zhou Zhou; Binglin Zhu; Changlian Zhu; Guo-Qing Zhu; Haining Zhu; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Yanping Zhu; Yushan Zhu; Haixia Zhuang; Xiaohong Zhuang; Katarzyna Zientara-Rytter; Christine M Zimmermann; Elena Ziviani; Teresa Zoladek; Wei-Xing Zong; Dmitry B Zorov; Antonio Zorzano; Weiping Zou; Zhen Zou; Zhengzhi Zou; Steven Zuryn; Werner Zwerschke; Beate Brand-Saberi; X Charlie Dong; Chandra Shekar Kenchappa; Zuguo Li; Yong Lin; Shigeru Oshima; Yueguang Rong; Judith C Sluimer; Christina L Stallings; Chun-Kit Tong
Journal:  Autophagy       Date:  2021-02-08       Impact factor: 13.391

8.  Deficits in Mitochondrial Spare Respiratory Capacity Contribute to the Neuropsychological Changes of Alzheimer's Disease.

Authors:  Simon M Bell; Matteo De Marco; Katy Barnes; Pamela J Shaw; Laura Ferraiuolo; Daniel J Blackburn; Heather Mortiboys; Annalena Venneri
Journal:  J Pers Med       Date:  2020-04-29

Review 9.  When nature's robots go rogue: exploring protein homeostasis dysfunction and the implications for understanding human aging disease pathologies.

Authors:  Julie A Reisz; Alexander S Barrett; Travis Nemkov; Kirk C Hansen; Angelo D'Alessandro
Journal:  Expert Rev Proteomics       Date:  2018-03-21       Impact factor: 3.940

Review 10.  Analyzing Olfactory Neuron Precursors Non-Invasively Isolated through NADH FLIM as a Potential Tool to Study Oxidative Stress in Alzheimer's Disease.

Authors:  Laura Gómez-Virgilio; Alejandro Luarte; Daniela P Ponce; Bárbara A Bruna; María I Behrens
Journal:  Int J Mol Sci       Date:  2021-06-12       Impact factor: 5.923

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.