Literature DB >> 29188230

Primers and copper responsive promoter design and data of real-time RT-PCR assay in filamentous fungus Trichoderma reesei.

Wei Wang1, Yumeng Chen1, Dong-Zhi Wei1.   

Abstract

This data article contains data related to the research article entitled "Copper-mediated on-off control of gene expression in filamentous fungus Trichoderma reesei" (Wang et al., 2017) [1]. Four kinds of copper responsive promoters were designed. Quantitative PCR (qPCR) was performed to determine relative mRNA levels of red fluorescent protein gene (rfp) extracted from cells grown under different concentrations of CuSO4. Three deletion vectors were constructed by using a copper-mediated self-excision cassette instead of a xylose-mediated self-excision cassette (Zhang et al., 2016) [2] to knock out xyn1, one of the two major specific endo-β-1,4-xylanases (Rauscher et al., 2006) [3], xyr1, the key transcriptional activator of cellulolytic and xylanolytic genes (Lichius et al., 2015) [4], and ace3, a factor essential for cellulase production (Häkkinen et al., 2014) [5]. This data article reports the primers, vector construction, and qPCR assay.

Entities:  

Keywords:  Copper responsive promoter; Filamentous fungus; Gene expression; Plasmid construction; Quantitative real-time PCR; Trichoderma reesei

Year:  2017        PMID: 29188230      PMCID: PMC5694953          DOI: 10.1016/j.dib.2017.11.018

Source DB:  PubMed          Journal:  Data Brief        ISSN: 2352-3409


Specifications Table Value of the data The modified copper responsive promoter Ptcu1c from T. reesei was used for the copper-dependent on-off control of DNA transcription and protein expression. The relative levels of rfp transcripts increased ~500-fold in the absence or presence of copper. The copper-mediated self-excision cassette was more widely used than a xylose-mediated self-excision cassette in some T. reesei disruptants for the screening of candidate regulators for cellulase and hemicellulase production.

Data

Four copper responsive promoters were designed. Quantitative real-time PCR (qRT-PCR) was performed to determine relative mRNA levels of rfp extracted from cells grown under different concentrations of CuSO4. By using the copper-mediated self-excision cassette, three deletion plasmids were constructed to knockout xyn1, xyr1, and ace3.

Experimental design, materials and methods

Modified copper responsive promoters

Sequences of native P (1715 bp) of Trichoderma reesei were downloaded from the genome sequence of T. reesei QM6a (http://genome.jgi-psf.org/Trire2/Trire2.home.html). Three truncated promoter forms, P (1249 bp), P (1085 bp), and P (535 bp), were randomly selected by us. The primers were designed using Primer Premier 6.0. The overlap sequences, “TTAATTAAGTTAACTCTAGA” and “CACGTGATGACCCGACGTC” were added to the 5′ ends of forward and reverse primers, respectively. Four kinds of copper responsive promoters were cloned by primers (Table 1).
Table 1

Detailed information on copper responsive promoter primers.

NameSequences (5′-3′)Relevant gene
Pcu1-fTTAATTAAGTTAACTCTAGAGCGGAATCCTACATTCCCAGATPcu1
Pcu1-rGACGTCGGGTCATcacgtgGGCCATTGTCGTATCAACCAGGTCGTA
Pcu1a-fTTAATTAAGTTAACTCTAGAGCATTACAGACAGAGGCGTGAGPcu1a
Pcu1a-rGACGTCGGGTCATcacgtgGGCCATTGTCGTATCAACCAGGTCGTA
Pcu1b-fTTAATTAAGTTAACTCTAGAAGGCTGACTAGAACCACAACTTGPcu1b
Pcu1b-rGACGTCGGGTCATcacgtgGGCCATTGTCGTATCAACCAGGTCGTA
Pcu1c-fTTAATTAAGTTAACTCTAGAGCAGCCAGATAAGTTCAATACCPcu1c
Pcu1c-rGACGTCGGGTCATcacgtgGGCCATTGTCGTATCAACCAGGTCGTA
Detailed information on copper responsive promoter primers.

Expression levels of rfp in T. reesei transformants

About 100 mg of T. reesei mycelium was harvested, and grown under different concentrations of CuSO4 for 36 h. Total RNA was extracted using a FastRNA Pro Red Kit (MPbio, Irvine, CA, USA), according to the manufacturer's instructions. Reverse transcription was performed with 1000 ng of total RNA, using the TransScript All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (TransGen, Beijing, China), according to the manufacturer's instructions. For RT-qPCR, the TransStart TipTop Green qPCR SuperMix (TransGen) was used with 200 nM of forward and reverse primers (Table 2) and 1 μL of 10-fold diluted cDNA in a final volume of 20 μL. For gene transcription analysis, SYBR green assays, using primers with the reference gene sar1, were performed as described in the previous publication [6]. The primers of rfp were designed using GenScript Real-time PCR (TaqMan) Primer Design (https://www.genscript.com/tools/real-time-pcr-tagman-primer-design-tool). Thermocycling was performed in an ABI StepOne Plus thermocycler (Applied Biosystems, Foster City, CA, USA).
Table 2

Primers used in quantitative real-time PCR (qRT-PCR).

NameSequences (5′-3′)Relevant gene
q-sar1-fTGGATCGTCAACTGGTTCTACGAqRT-PCR
q-sar1-rGCATGTGTAGCAACGTGGTCTTT
q-rfp-fGCTTCAAGGTGCGCATGGAG
q-rfp-rCGGTGTTGTGGCCCTCGTAG
Primers used in quantitative real-time PCR (qRT-PCR). Quantitative real-time PCR (qRT-PCR) was performed using Ptcu1c-rfp [1] to determine relative rfp mRNA levels extracted from cells grown under different concentrations of CuSO4 (Fig. 1). The relative levels of rfp transcripts increased ~500-fold in the absence or presence of high levels of copper, indicating that the on-off control functions by affecting target RNA levels.
Fig. 1

Expression levels of rfp in the absence and presence of high levels of copper. The mRNA level of an addition of 0.5 μM copper was set as 2. Error bars indicate mean±SD (n=3 samples) from the same experiment.

Expression levels of rfp in the absence and presence of high levels of copper. The mRNA level of an addition of 0.5 μM copper was set as 2. Error bars indicate mean±SD (n=3 samples) from the same experiment.

Deletion plasmid construction

The 500–1000 bp length of 5′-ends and 3′-ends of the sequences of xyn1 [3], xyr1 [4], and ace3 [5] were PCR-amplified from T. reesei Qm9414 or RUT C30 genomic DNA using the appropriate primers (Table 3). The primers were designed using Primer Premier 6.0. The resulting fragments were sequentially fused to the PacI/XbaI and SwaI sites of LML4.0 [2] using the Seamless Cloning Kit (TransGen Biotech, Beijing, China) to generate the vectors Dxyn1, Dxyr1, and Dace3 (see Fig. 1 in Ref. [1]). All plasmids were confirmed via DNA sequencing.
Table 3

Primers used in deletion plasmids construction.

NameSequences (5′-3′)Relevant gene
XYN15-FGATTACGAATTCTTAATTAACCAGCATCTGTCTAGTTGTGGAGATATGxyn1
XYN15-RTTAAGTTAACTCTAGACCTTGAAGTCGATACTATGCAGTTGAG
XYN13-FACTAGTGAGCTCATTTGTTCTGTTGATGTTGACTTGGAG
XYN13-RAGTGCCAAGCTTATTTGACTGAAGGCGATGTTCTCTG
XYR15-FGATTACGAATTCTTAATTAAACGAGTATCTCCGAAATTCCCTTTGGxyr1
XYR15-RTTAAGTTAACTCTAGAGCGCTGTGTGCGATGTGAAG
XYR13-FACTAGTGAGCTCATTTGGAGGCCACTCAATCGTATGACG
XYR13-RAGTGCCAAGCTTATTTGAACCTCTTACTCACATTCACTTGACTTG
ACE35-FGATTACGAATTCTTAATTAATCTCTGTTGTCATTGCTCCTCCTace3
ACE35-RTTAAGTTAACTCTAGAGGCTGGTCGCTCTTCTTCCT
ACE33-FACTAGTGAGCTCATTTGCCATCATCCATCGCAACCA
ACE33-RAGTGCCAAGCTTATTTCCATAGGTAGCCAGTTCGTATCC
Primers used in deletion plasmids construction.
Subject areaBiology
More specific subject areaMolecular biology, vector construction, Quantitative real time PCR
Type of dataTable, figure
How data was acquiredSequencing data were acquired through NCBI. In silico analysis of gene using online Real-time PCR (TaqMan) Primer Design (GenScript, China) and primer design software version 6.0 (Premier Biosoft, USA).
Data formatRaw, analyzed
Experimental factorsGene sequences were retrieved from GenBank database; Plasmid were constructed; rfp expression were analyzed by qRT-PCR
Experimental featuresFour kinds of copper responsive promoters were designed. qRT-PCR was performed to determine relative red mRNA levels of rfp extracted from cells grown under different concentrations of CuSO4. Three deletion cassettes were constructed to knockout xyn1, xyr1, and ace3, respectively.
Data source locationShanghai, China
Data accessibilityData is provided with this article
  6 in total

1.  An accurate normalization strategy for RT-qPCR in Hypocrea jecorina (Trichoderma reesei).

Authors:  Matthias G Steiger; Robert L Mach; Astrid R Mach-Aigner
Journal:  J Biotechnol       Date:  2010-01-01       Impact factor: 3.307

2.  Copper-mediated on-off control of gene expression in filamentous fungus Trichoderma reesei.

Authors:  Wei Wang; Yumeng Chen; Dong-Zhi Wei
Journal:  J Microbiol Methods       Date:  2017-10-18       Impact factor: 2.363

3.  Transcriptional regulation of xyn1, encoding xylanase I, in Hypocrea jecorina.

Authors:  Roman Rauscher; Elisabeth Würleitner; Christian Wacenovsky; Nina Aro; Astrid R Stricker; Susanne Zeilinger; Christian P Kubicek; Merja Penttilä; Robert L Mach
Journal:  Eukaryot Cell       Date:  2006-03

4.  Genome sequencing of the Trichoderma reesei QM9136 mutant identifies a truncation of the transcriptional regulator XYR1 as the cause for its cellulase-negative phenotype.

Authors:  Alexander Lichius; Frédérique Bidard; Franziska Buchholz; Stéphane Le Crom; Joel Martin; Wendy Schackwitz; Tina Austerlitz; Igor V Grigoriev; Scott E Baker; Antoine Margeot; Bernhard Seiboth; Christian P Kubicek
Journal:  BMC Genomics       Date:  2015-04-20       Impact factor: 3.969

5.  Light-inducible genetic engineering and control of non-homologous end-joining in industrial eukaryotic microorganisms: LML 3.0 and OFN 1.0.

Authors:  Lei Zhang; Xihua Zhao; Guoxiu Zhang; Jiajia Zhang; Xuedong Wang; Suping Zhang; Wei Wang; Dongzhi Wei
Journal:  Sci Rep       Date:  2016-02-09       Impact factor: 4.379

6.  Screening of candidate regulators for cellulase and hemicellulase production in Trichoderma reesei and identification of a factor essential for cellulase production.

Authors:  Mari Häkkinen; Mari J Valkonen; Ann Westerholm-Parvinen; Nina Aro; Mikko Arvas; Marika Vitikainen; Merja Penttilä; Markku Saloheimo; Tiina M Pakula
Journal:  Biotechnol Biofuels       Date:  2014-01-28       Impact factor: 6.040

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.