Polymerase chain reaction detection of genes responsible for multiple antibiotic resistance Staphylococcus aureus isolated from food of animal origin in Egypt.

AIM: The aim of our study was polymerase chain reaction (PCR) detection of the genes responsible for the multiple antibiotic resistance S. aureus isolated from food of animal origin in Egypt.
MATERIALS AND METHODS: A total of 125 samples were randomly collected from milk, meat, and their products from Giza and Beni-Suef Governorates markets. The S. aureus isolates were subjected to antimicrobial sensitivity tests using four antibacterial disks (Oxoid), and then the polymerase chain reaction (PCR) was performed for detection of antibiotic resistance genes.
RESULTS: Out of 125 samples, 19 S. aureus isolates were detected. All detected isolates were multiple drug resistance (MDR). The penicillin-, erythromycin-, kanamycin-, and tetracycline-resistant isolates were examined by PCR for resistance genes blaZ, (msrA, ermB, and ermC), aac(6')aph (2"), and tetK. The isolates harbored these resistance genes with percentage of 100% (100%, 0%, and 100%), 62.5%, and 100%, respectively.
CONCLUSION: Contaminated foods of animal origin may represent a source of MDR S. aureus that can be a major threat to public health.

Introduction

The development of multiple antibiotic-resistant bacteria due to misuse of antibiotics in animals and poultry production is well authenticated for pathogenic bacteria [1,2]. Contaminated food of animal origins with antibiotic-resistant bacteria can be a great threat to public health, and the antibiotic resistance determinants can be transferred from antibiotic-resistant bacteria to other bacteria affecting human [3,4]. Identical elements of antibiotic-resistant genes found in bacteria that affect both animals and humans have shown the role of raw foods in the dissemination of these resistance genes through the food chains [5,6] or through occupational contact with livestock [7].

The multiple antibiotic-resistant bacteria were commonly isolated from food of animal origin such as raw milk and unpasteurized dairy products [2,8] and meat products [9], the resistance genes can be transferred from antibiotic-resistant bacteria to the intestinal flora of humans through food products, and the commensally flora can be a reservoir of resistant genes for pathogenic bacteria [10]. The high prevalence of multidrug-resistant Staphylococcus aureus was discovered from food of animal origin in Europe, Canada, and United States in multiple studies [11,12], which represents a huge problem in public health [13,14].

The aim of our study was polymerase chain reaction (PCR) detection of the genes responsible for the multiple antibiotic resistance S. aureus isolated from food of animal origin in Egypt.

Materials and Methods

Ethical approval

No animals were involved in the study at any stage.

Samples

A total of 125 samples were collected from meat, milk, and their products from Giza and Beni-Suef Governorates markets (Table-1), and all samples were aseptically collected and examined for detection of S. aureus.

Table-1

Samples collected and their numbers from sale markets.

Product	Milk	Yoghurt	Kareish	Minced meat	Burger	Luncheon	Total
Numbers	28	18	19	20	20	20	125

Identification and characterization of S. aureus

One loopful from prepared incubated samples was plated onto nutrient agar (Difco) and mannitol salt agar (Difco), incubated for 18-24 h at 37°C and examined for bacterial growth. The suspected colonies were identified morphologically and biochemically [15].

Antimicrobial sensitivity test for identified strains

The antimicrobial sensitivity tests were done by disk diffusion technique [16] using 4 antibacterial disks (kanamycin, penicillin, erythromycin, and tetracycline) - Oxoid - the degree of sensitivity was interpreted according to Koneman et al., and CLSI [17,18].

PCR detection of the resistance genes

PCR was performed for detection of resistance genes in biotechnology center in the animal health institute according to Sambrook and Russel [19]. The primers were synthesized by Metabion Company, Germany, as mentioned in Table-2.

Table-2

Oligonucleotide primers sequences of resistance genes.

Antibiotic resistance	Target gene	Primer sequence (5’-3’)	Length of amplified product (bp)	References
Penicillin	blaZ	ACTTCAACACCTGCTGCTTTC	173	[20]
		TGACCACTTTTATCAGCAACC
Tetracycline	tet(K)	GTAGCGACAATAGGTAATAGT	360
		GTAGTGACAATAAACCTCCTA
Aminoglycoside	aac(6’)aph (2”)	GAAGTACGCAGAAGAGA	491
		ACATGGCAAGCTCTAGGA
Erythromycin	msr(A)	GCAAATGGTGTAGGTAAGACAACT	400	[21]
		ATCATGTGATGTAAACAAAAT
	erm(C)	ATCTTTGAAATCGGCTCAGG	295
		CAAACCCGTATTCCACGATT
	erm(B)	CATTTAACGACGAAACTGGC	425
		GGAACATCTGTGGTATGGCG

Results

Results of recovery rate of S. aureus isolates

Out of 125 collected samples, 19 S. aureus isolates were detected (Table-3) [20,21].

Table-3

Prevalence of the isolated S. aureus.

Source of the samples	Total number of samples examined	Recovered S. aureus examined/total number of original samples
		n (%)
Milk	28	8 (28.5)
Yogurt	19	1 (5.2)
Kareish cheese	18	0 (0)
Total milk and milk products	65	9 (13.8)
Minced meat	20	5 (25)
Burger	20	2 (10)
Luncheon	20	3 (15)
Total meat and meat products	60	10 (16.6)
Total collected samples	125	19 (15.2)

S. aureus=Staphylococcus aureus

Results of antibacterial sensitivity

Results of antibiotic sensitivity test on 19 isolates of S. aureus recovered from raw milk, meat, and their products, 14 isolates exhibited resistance against penicillin (73.6%), 11 isolates were resistant against tetracycline (57.8%), while 5 isolates exhibited resistance to erythromycin (26.3%), and 8 isolates were resistant to kanamycin (42.1%) (Table-4).

Table-4

Results of antibiotic sensitivity tests.

Antibacterial agent	Milk and milk products (total n=9)			Meat and meat products (total n=10)
	Sensitive	Intermediate	Resistant	Sensitive	Intermediate	Resistant
	n (%)	n (%)	n (%)	n (%)	n (%)	n (%)
Penicillin groups
Penicillin	2 (22.2)	0 (-)	7 (77.7)	3 (30)	0 (-)	7 (70)
Tetracycline group
Tetracycline	2 (22.2)	0 (-)	7 (77.7)	3 (30)	3 (30)	4 (40)
Aminoglycoside group
Kanamycin	2 (22.2)	2 (22.2)	5 (55.5)	4 (40)	3 (30)	3 (30)
Macrolide group
Erythromycin	6 (66.6)	1 (11)	2 (22.2)	5 (50)	2 (20)	3 (30)

Results of PCR for amplification of blaz gene at 173 bp fragment

Fourteen isolates exhibited resistance against penicillin, out of them; eight isolates were randomly selected for genotypic detection of blaz gene. Amplification of blaz gene at amplicon size of 173 bp was detected in all the tested isolates (8) with a percentage of 100% (Figure-1).

Figure-1

Lane: 1-8 positive amplification of blaz gene at 173 bp. Neg=Negative control, pos=Positive control, M=Marker.

Results of PCR for amplification of tet K gene at 360 bp fragment performed with its specific primer

Eleven isolates exhibited resistance against tetracycline, out of them; eight isolates were selected randomly for genotypic detection of tetK gene.

Amplification of tetK gene at amplicon size of 360 bp was detected in all the tested isolates with a percentage of 100% (Figure-2).

Figure-2

Lane 1-8: Positive amplification of tet K gene at 360 bp. Neg=Negative control, pos=Positive control, M=Marker.

Results of PCR for amplification of ermB (425 bp), msrA (400 bp), and ermC (295 bp) for erythromycin resistance isolates

Five isolates were resistant to erythromycin. They were examined by PCR for detection of ermB, msrA, and ermC genes. They exhibited prevalence of 0%, 100%, and 100% for ermB, msrA, and ermC genes, respectively (Figures-3-5).

Figure-5

Lane 1-5: Positive amplification of ermC gene at 295 bp. Neg=Negative control, pos=Positive control, M=Marker.

Lane 1, 2, 3, 4, 5: Negative amplification of ermB gene at 425 bp. Neg=Negative control, Pos=Positive control, M=Marker.

Lane 1-5: Positive amplification of msrA gene at 400 bp. Neg=Negative control, pos=Positive control, M=Marker.

Results of PCR for amplification of 491 bp fragment for aac(6’) aph (2”) gene (aminoglycoside)

Antibiotic susceptibility against aminoglycoside (kanamycin) using disk diffusion method revealed that eight isolates were resistant to kanamycin. They were examined by PCR for detection of aac(6’) aph(2”) gene, and the result revealed that the aac(6’) aph(2”) was detected in five (62.5%) out of eight isolates (Figure-6).

Figure-6

Lane 4, 5, 6, 7, 8 positive amplification of aac(6’) aph (2”) at 491 bp. Lane 1, 2, 3: Negative amplification of aac (6’) aph (2”). Neg=Negative control, pos=Positive control, M=Marker.

Discussion

The livestock products could be a source of exposure to multidrug-resistant S. aureus strains as a result of hazardous misuse of antibiotics in animal treatment and unhygienic livestock practices [2]. Food of animal origin is an ideal culture medium for growth of many organisms [22]. They are considered as a shelter of different types of microorganisms through processing, handling, preparation, and storage as well as distribution [23]. They are considered as major sources of foodborne diseases and have been linked to serious outbreaks of food poisoning worldwide.

The result showed in Table-3 reported that S. aureus isolated from raw milk and milk products (Kareish cheese and yoghurt), and from meat and meat products (burger and luncheon) were 13.8% and 16.6%, respectively. A higher recovery rate was obtained by El-Jakee et al. [24], they isolated S. aureus from cow milk (22.7%) and buffalo milk (16%), and on the other hand, El-Jakee et al. [25] revealed that raw milk contaminated with S. aureus with an incidence of 56%. While Jamali et al. [26] reported S. aureus with a percentage of 15.7% and 12.4% from dairy products and raw milk, respectively, Imani et al. [27] found 4% of milk and 32% of dairy products contaminated with S. aureus, similar results were obtained by Song et al. [28], who isolated S. aureus from raw milk with a percentage of 20.2%. Higher results of S. aureus contamination were reported in raw milk by Gwida and El-Gohary [29]. They recorded 56.66% of S. aureus present in market milk. The prevalence of S. aureus in Kareish cheese in our results is lower than the result reported by Hosny et al. [30], who isolated S. aureus with a percentage of 17% from milk shops and street vend but reported the same result from brand cheese. The presence of S. aureus in milk was variable in different regions, and these variations may be due to season, number of animals on the farm, farm size, hygiene status, variation in sampling, farm management practices, geographical location, and differences in detection methods and variation in types of samples evaluated. El-Sayed et al. [31] revealed that in Egypt the difference in white soft cheese due to acidity as Domiati or Kareish acid coagulation, enzyme coagulation, keeping temperatures, different salt concentrations, and ripening in brine solutions are factors affecting the microbiological quality of these varieties.

The incidence of S. aureus in meat products in our study agrees with the findings of the study by Fox et al. [32], who tested 124 raw meat samples for methicillin-resistant S. aureus (MRSA) including pig (n=63), poultry (n=50), and turkey (n=11) collected from England between March and July 2015. MRSA was isolated from 9 (73%) samples (4 poultry, 3 pig, and 2 turkeys) from different butchers and supermarkets. While Pesavento et al. [33] isolated S. aureus from raw meat 23.86%. Another study by Ge et al. [34] detected S. aureus from retail meats of turkey, pork, beef, and chickens. While Ali et al. [35] isolated S. aureus from meat samples with a percentage of 7%. Hassanin [36] isolated S. aureus from burger and luncheons agreed with our results with a percentage of 25% and 47.5%, respectively, but differ in minced meat (65%). S. aureus was isolated from meat products with a percentage of 30% by Abdaslam et al. [37]. While Li et al. [38] were recorded 27.9% of S. aureus isolates from food sample. Another study recovered S. aureus in 27 from 165 retail meat samples with a percentage of 16.4% [39]. On the other hand, Song et al. [28] isolated S. aureus 21.3% from frozen food and 28.1% from raw meat samples.

Transmission of antibiotic-resistant S. aureus strains can be done by contaminated foods with resistant bacteria [40]. Some researchers reported a primary relationship between the prevalence of antibiotic-resistant bacteria and the misusing of antibiotics for therapeutic purposes in animals [41].

The result of our S. aureus sensitivity test (Table-4) revealed that 14 out of 19 identified S. aureus isolates were resistant to penicillin (73.6%), while 11 isolates exhibited resistance against tetracycline (57.8%), 5 isolates were resistant to erythromycin (26.3%), and 8 isolates were resistant to kanamycin (42.1%). All the isolates were multidrug resistance (MDR) because they were resistant for more than one antibiotic class. The same results were found by Ammar et al. [42], and they observed MDR S. aureus (MDRSA) among 85% of isolates recovered from examined milk and meat product samples. Approximately 10.4% from S. aureus detected in retail meats in 1-year survey (2010-2011) collected from eight U.S. states were MDRSA Ge et al. [34]. While Jamali et al. [26] stated that 36.3%, 46.6%, and 12.8% of isolates were resistant to one, two, and more than two antimicrobial agents, respectively, and found that S. aureus resistant to tetracycline with a percentage of 56.1%, chloramphenicol (3.7%), and gentamicin (2.1%) but low incidence in case of erythromycin, kanamycin, streptomycin, penicillin G, and oxacillin. Our study agreed with many reports indicating a high percentage of multidrug-resistant S. aureus isolates from food of animal origin [32,43-45]. The same results obtained by Argudín et al. [46], and they found that S. aureus resistant to oxacillin (95%) and trimethoprim-sulfamethoxazole (4%) but differed in erythromycin (70%), tetracycline (100%), kanamycin (29%), and gentamicin (14%) and also reported that 4%, 30%, 21%, and 33% of S. aureus isolates were resistant to more than four, three, and five classes of antibiotics, respectively. Tan et al. [47] disagreed with our results, and they stated that 94.59% of the strains were resistant only to one of the antibiotics or did not resistant to all of the tested antibiotics, while only 5.41% of S. aureus strains were multidrug resistant, while Teramoto et al. [48] found that S. aureus isolates from conventional retail meat were resistant to both erythromycin 50.0% and tetracycline 58.3%.

PCR-based molecular methods are preferred for determination of antibiotic-resistant genes. Recently, many studies have demonstrated the extremely high capacity of molecular methods such as PCR and pulsed-field gel electrophoresis; these methods were increasingly used for their specific, rapid, reliable, and accurate detection of bacteria and genes of interest [49]. Nowadays, the detection of antibiotic-resistant genes was accomplished by PCR methods directed to the linA, tetK, msrA, msrB, ermA, ermC, aacA-D, and tetM gens [50]. In this work, PCR primers that can be used to survey clinically relevant antibiotic resistance genes frequently encountered in S. aureus.

The results revealed that all tested isolates of S. aureus which were resistant to penicillin carried blaZ genes, the erythromycin-resistant isolates carried ermB, msrA, and ermC with a percentage of 0%, 100%, and 100%, respectively, and aminoglycoside gene aac(6’) aph (2”) (kanamycin resistance gene) present in a percentage of 62.5% in the resistant isolates while the tetracycline-resistant isolates carried tetK gene with a percentage of 100%. Our findings agreed with McCallum et al. and Argudín et al. [46,51], they reported that tetK gene was present in a percentage of 91% of tetracycline resistant, 70% of erythromycin-resistant isolates carried resistance genes (encoded by ermC, ermA, and ermB, alone or in combination), and aac(6’)aph (2”) gene found in kanamycin-resistant gene, while penicillin-resistant isolates carried blaZ gene 94%. While Jamali et al. [26] found that blaZ (97.4%) and tetK (41.8%) present in penicillin- and tetracycline-resistant isolates, respectively, and msrA and ermC genes (erythromycin resistance gene) present in high prevalence as our results but with different prevalence of ermB gene. The high prevalence of the blaZ and tet M resistance genes in this study is in agreement with the results reported by Gao et al. [52]. The same findings were obtained by Li et al. [38], on msrA, ermC, tetK, and blaZ genes with different results for ermB. Duran et al. [20] reported erythromycin resistance genes (ermA, ermB, ermC, and msrA), one of them at least was present in erythromycin-resistant isolates, tetM or tetK or both resistance genes isolates were found in tetracycline-resistant isolates, aac(6’)aph(2”) presents in gentamicin susceptible S. aureus isolates, and major of staphylococci tested possessed the blaZ gene (89.9%). Argudín et al. [46] reported that all strains resistant to ampicillin–penicillin carried the blaZ gene, and they detected the genes responsible for erythromycin resistance together with inducible resistance to clindamycin were ermA and ermC while resistance to erythromycin only was associated with the presence of either msrB or msrB msrA. A high prevalence of ermB gene than ermC in food of animal origin was detected by Martineau et al. [53].

Conclusion

Foods of animal origin may represent a source of MDR S. aureus that can be a major threat to public health infection for humans.

Authors’ Contributions

FRE and AAS have planned the research work; also they participate laboratory work with HSHS, EAK, and AAK. All authors.