Literature DB >> 29176857

Prevalence of fimA genotypes of Porphyromonas gingivalis in adolescent orthodontic patients.

Shuang Pan1,2, Yi Liu3, Yi Si4, Qiang Zhang5, Lin Wang6, Jianwei Liu2, Chunling Wang1, Shuiqing Xiao4,5.   

Abstract

BACKGROUND: The placement of fixed orthodontic appliances may alter the composition of oral microbiota and has the potential risk of periodontal complication. Porphyromonas gingivalis fimbriae play a critical role in colonization of P. gingivalis in subgingival regions. In this study, we investigated the association between the prevalence of P. gingivalis-specific fimA genotypes and periodontal health status in adolescent orthodontic patients, to identify the pathogencity of P. gingivalis during orthodontic therapy.
METHODS: Sixty-one adolescent orthodontic patients were enrolled in the case group, while the control group consisted of 56 periodontally healthy adolescents. At baseline (T0), clinical parameter (gingival index) was tested, and subgingival plaque samples were obtained from the lower incisors. The incidences of P. gingivalis and fimA genotypes were detected by polymerase chain reaction. All parameters were reassessed after 1 month (T1), 2 months (T2), 3 months (T3), and 6 months (T4) in the case group and then compared with those of the controls.
RESULTS: Both microbiological and clinical parameters from orthodontic patients started to increase after placement of fixed appliances. Maximum values were reached at 3 months after placement and followed by their decreases at six months. However, the microbiological and clinical parameters in the case group were significantly higher than those of the control group. The GI of fimA II, IV-positive samples was significantly higher than that of negative samples.
CONCLUSION: P. gingivalis carrying fimA II or IV was closely related to orthodontic gingivitis. In addition, proper oral hygiene control could lead to little increase in dental plaque accumulation, and exert a beneficial effect to periodontal tissues.

Entities:  

Mesh:

Substances:

Year:  2017        PMID: 29176857      PMCID: PMC5703466          DOI: 10.1371/journal.pone.0188420

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Fixed orthodontic therapy is the most effective method in contemporary orthodontics, however, it may cause periodontal complication due to hampering oral hygiene and altering the nature of dental plaque [1]. The overall incidence of gingivitis associated with orthodontic therapy was 56.8% in adolescents and 34.4%in adult in China, respectively [2]. It has been confirmed that anaerobic microbiota in subgingival plaque are the primary agents in the initiation and progression of periodontal diseases [1]. Previous studies by our team and other researchers demonstrated that there were positive associations between periodontal diseases and several pathogens, including A. actinomycetemcomitans, P. gingivalis, P. intermedia, and T. forsythia [1, 3–6]. P. gingivalis is considered as a putative etiological agent in different types of periodontal diseases, whose virulence attributes to its various surface components, such as lipopolysaccharide, capsule, gingipain, fimbria and so on [6-9]. Among them, the major fimbrial subunit, fimbrillin, is thought to play critical roles in the colonization of P. gingivalis in periodontal tissues, as it promotes bacterial adhesion to and invasion to subgingival regions [10-15]. The P. gingivalis fimA gene, which encodes fimbrillin, is a single copy on the bacterial chromosome and no homologous sequences were detected in other gram-negative oral anaerobe [16]. FimA has been classified into six variants (types I–V, Ib) according to clonal variations of its nucleotide sequences [17-19]. Accumulating evidences suggested that P. gingivalis strains with different fimA genotypes displayed distinct virulence features [20, 21]. According to the diversity of pathogenicity, there are two groups in P. gingivalis stains, disease related and non-disease related, and the variance of genetic heterogeneity was the base of the differential of pathogenicity in microorganisms [22, 23]. Analysis of the different fimA genotypes and their clonal distribution may provide insight into the epidemiology of periodontal diseases. It is demonstrated that fixed appliances could alter the equilibrium of the microorganism ecosystem, and increase the colonization of pathogenic bacteria which is responsible for periodontal diseases [1, 24, 25]. Our previous research showed that the prevalence of P. gingivalis detected at two months after orthodontic therapy was as much as 31.11%higher than baseline and the count of P. gingivalis assessed immediately after removing orthodontic appliances was obviously higher than that of healthy group [1, 26]. However, there was no report on the variation in distribution of fimA genotypes during the orthodontic therapy. In this case, we assessed the prevalence of P. gingivalis and fimA genotypes in subgingival plaque samples among different time points after placing orthodontic appliances, to identify the pathogencity of P. gingivalis with different fimA genotypes during orthodontic therapy.

Materials and methods

Ethics statement

The human subject protocol was approved by the Ethics Committee of Jinan Stomatological Hospital and School of Stomatology, Shandong University, and written informed consents were provided by the patients of each participant.

Subjects

Subjects of both case and control groups were consecutively recruited from Department of Orthodontics, Jinan Stomatological Hospital during June 2015- October 2015 with same procedure and criteria as described previously [1]. In short, 107periodontally healthy adolescents who referred to our hospital for orthodontic treatment were enrolled in this study and randomly assigned to be the case group and control group. Among them, sixty-one subjects (22 males and 39 females, mean age 13.80±1.61 years, ranging from 11 to 17 years, S1 Table) were classified into the case group and 56 subjects (16 males and 40 females, mean age 14.24±1.30 years, ranging from 12 to 17 years) were grouped as the controls. Both groups matched for age and sex. All participants met the following criteria: (1) a healthy gingival condition defined as a periodontal probing depth of less than 4mm and a gingival index less than 1, (2) no smoking, (3) no known systemic disease, (4) no alveolar bone loss visible on X-ray, (5) absence of fixed restorations or removal partial dentures, (6) no use of antibiotics within 3 months before the study, (7) no periodontal therapy within the previous 6 months. [1]. All subjects in the case group were treated with fixed buccal metal appliances (Victory, 3M Unitek, Calif) on incisors, premolars, and molars. The arch wires were ligated with elastomeric ligature. The brackets were placed on both jaws when the first clinical periodontal examination was done. The oral hygiene instructions (tooth-bushing Bass skill) and correct method of using tooth brush were provided for all case subjects before placing brackets (S1 Appendix).

Bacteria strains

The reference strains of P. gingivalis (ATCC33277), F. nucleatum (ATCC25586) and A. actinomycetemcomitans (ATCC29522) were obtained from The State Key Laboratory of Oral Diseases, Sichuan University (Chengdu, China).

Clinical examination and gingival index

Before sample collection, the dentist evaluated Gingival index (GI) of both groups at the teeth of 31, 32, 41 and 42 with same procedure as described previously [1]. The value of GI for each subject was the mean measurement of the four teeth. In the case group, measurement were made at five time points: Baseline T0 = before appliances placement, T1 = one month after bonding, T2 = two months after bonding, T3 = three months after bonding, and T4 = six months after bonding; while in the control group, the GI values were only measured at baseline (T0) and compared with those of the case group. Periodontal examination and sample collection were carried out by the same dentist.

Microbial sampling and DNA extraction

Sampling procedure was described before [1]. In brief, subgingival microbial samples were collected at the same sites after measuring the GI. Samples were obtained from 10:00 to 12:00 a.m. and at least two hours after eating, drinking, or taking oral hygiene measures, and then careful removal of supragingival plaque and saliva, the sites were isolated with sterile cotton rolls, and gently air dried. A sterile filter paper strip (ISO 30) was softly inserted into the bottom of periodontal pockets for 30 seconds until a minimum of resistance. Four paper points from each subject were immediately placed into a sterile microcentrifuge tube containing 0.5 ml of PBS [1, 27, 28]. The tubes were stored at -20°C until analyzed. The bacterial DNA was extracted by the boiling method [29]. Briefly, a 10 μl aliquot of each stored sample was added to 10μl of 2 ×lysis buffer (2 mM EDTA, 1%X-100). The mixture was boiled for 10 minutes and then placed on ice. The supernatant was used as the template for PCR amplification.

Specificity of the 16S rRNA-based PCR

Specificity of the 16S rRNA-based PCR was evaluated by using specific primers of 16SrRNA gene and the reference strains, including P. gingivalis (ATCC33277), F. nucleatum (ATCC25586), and A. actinomycetemcomitans (ATCC29522). The amplified products from clinical samples were randomly chosen for sequencing.

The 16S rRNA-based PCR and fimA genotypes specific PCR

The 16S rRNA-based PCR was used to determine the prevalence of P. gingivalis in subgingival biofilm. The specific primers of fimA genotypes designed previously [18, 30] were used for fimA typing and detection from positive samples of P. gingivalis (Table 1). PCR amplification was carried out in a Tetrad Thermal Cycler (MJ Research, South San Francisco, USA) according to our previous description [6, 28] and run in a 25μlreaction mixture, including 4.5μl 10×PCR buffer (100 mM Tris-HCl, 500 mM KCl, and 15 mM MgCl2), 0.25 mM of each deoxynucleoside triphosphate (dNTP), 10μM of each primers, 5μl of template DNA, and 1.5 units of Taq DNA polymerase (Tiangen Biotech, Beijing), and sterile distilled water. Each sample was amplified for 5 min at 94°Cand 30 cycles, with each cycle consisting of denaturation at 94°C for 30 sec, annealing at 58°C for 30 sec, extension at 72°C for 1 min, and final extension for 10 min. The amplified products were then electrophoresed on 1.5% agarose gel in Tris-acetate buffer (40 mM Tris acetate, 1 mM EDTA, pH8.0). The products were visualized with ethidium bromide by UV transillumination. (dx.doi.org/10.17504/protocols.io.jskcncw)
Table 1

The primers of P. gingivalis and fimA.

PrimersSequence(5'-3')Annealing temp(°C)Sizes(bp)
Pg FAGGCAGCTTGCCATACTGCG57404
Pg RACTGTTAGCAACTACCGATGT
FimA I FCTGTGTGTTTATGGCAAACTTC58392
FimA I RAACCCCGCTCCCTGTATTCCGA
FimA Ib FCAGCAGAGCCCAAAAACAATCG54271
FimA Ib RTGTCAGATAATTAGCGTCTGC
FimA II FACAACTATACTTATGACAATGG56257
FimA II RAACCCCGCTCCCTGTATTCCGA
FimA III FATTACACCTACACAGGTGAGGC58247
FimA III RAACCCCGCTCCCTATATTCCGA
FimA IV FCTATTCAGGTGCTATTACCCAA58251
FimA IV RAACCCCGCTCCCTGTATTCCGA
FimA V FAACAACAGTCTCCTTGACAGTG50462
FimA V RTATTGGGGGTCGAACGTTACTGTC
The products of six fimA genotypes were randomly sequenced on 3730 sequencer (Applied Biosystems, Foster City, CA, USA) to confirm the validity of the specific fimA PCR in P. gingivalis positive samples. The alignment of the resulting sequences was carried out with BLAST (http://www.ncbi.nlm.nih.gov/BLAST) The primers for amplification of 16S rRNA gene and fimA gene were listed in Table 1.

Statistical analysis

The data were analyzed by using the SPSS statistical software (version 20.0, SPSS, Chicago, IL). The Mann-Whitney U test and the Wilcoxon signed rank test were used to detect significant intergroup and intragroup differences regarding GI. Chi-squared test was used to compare detection rates of P. gingivalis and fimA genotypes between two groups. The McNemar test was utilized to compare the prevalence of P. gingivalis and fimA genotypes in case group. The Mann-Whitney U test was used to determine the correlation between prevalence of fimA genotypes and GI in orthodontic patients. The significance for all statistical tests was predetermined at P<0.05.

Results

Detection and confirmation of 16S rRNA-based PCR for P. gingivalis

The reference stains were first amplified by the16S rRNA-based PCR to evaluate its specificity. The positive product appeared only from P. gingivalis (ATCC33277), not from F. nucleatum (ATCC25586) and A. actinomycetemcomitans (ATCC29522). At baseline (T0), the frequency of P. gingivalis in from 117 subgingival samples of the two groups was twenty-nine (24.79%), of which thirteen (23.21%) from the control group and sixteen (26.23%) from the case group. From T0 to T3, the detection rate of P. gingivalis increased significantly in the case group: 25 (42.62%) at T1, 31 (50.82%) at T2 and 51 (83.61%) at T3. At T4, the detection of P. gingivalis decreased to 26 (42.62%). The detection rate of P. gingivalis at different time points after wearing appliances was significantly higher than that of T0 in the case group and control group: T1 (P<0.05), T2 (P<0.01), T3 (P<0.01) and T4 (P<0.05) (Table 2).
Table 2

The prevalence of P. gingivalis and fimA genotypes in two groups.

control groupcase group
T0T0T1T2T3T4
P. gingivalis13 (23.21)16 (26.23)25 (42.62)*31 (50.82)**††51 (83.61)**††26 (42.62)*
I6 (10.71)7 (11.48)7 (11.48)7 (11.48)11 (18.03)9 (14.75)
Ib3 (5.36)3 (4.92)4 (6.56)3 (4.92)5 (8.20)2 (3.28)
II2 (3.57)2 (3.28)4 (6.56)5 (8.20)9 (14.75)*8 (13.11)
III4 (7.14)2 (3.28)3 (4.92)4 (6.56)7 (11.48)7 (11.48)
IV2 (3.57)2 (3.28)3 (4.92)7 (11.48)15 (24.59)**††10 (16.39)*
V5 (8.93)6 (9.84)6 (9.84)14 (22.95)22 (36.07)**13 (21.31)
untypeable3 (5.36)5 (8.20)5 (8.20)8 (13.11)8 (13.11)4 (6.56)

Chi-squared test was used to compare detection rates of P. gingivalis and fimA genotypes between two groups.

* P<0.05,

** P<0.01.

The McNamara test was utilized to compare the prevalence of P. gingivalis and fimA genotypes in case groups.

† P<0.05,

†† P<0.01.

Chi-squared test was used to compare detection rates of P. gingivalis and fimA genotypes between two groups. * P<0.05, ** P<0.01. The McNamara test was utilized to compare the prevalence of P. gingivalis and fimA genotypes in case groups. † P<0.05, †† P<0.01. Ten P. gingivalis positive samples were randomly selected for sequencing in Invitrogen Company (Invitrogen, Shanghai) to confirm the validity of the 16S rRNA-based PCR in clinical subgingival biofilm samples.

Detection and confirmation of 16S rRNA-based PCR for fimA genotypes

The distribution of fimA genotypes among P. gingivalis-positive samples was subsequently analyzed (Table 2). The distribution of fimA genotypes in the case group showed no significant change over time from T0 to T2, and there was no difference between two groups (P>0.05). At T3, the detection rate was 14.75% for fimA type II (P<0.05), 24.5% for fimA type IV (P<0.01), and 36.07% for fimA type V (P<0.01), which was found at higher level than that of the controls (3.57% for fimA type II and IV, 8.93% for type V) and T0 in the case group (3.28% for fimA type II and IV, 9.84% for type V). At T4, the detection rate of fimA type II and V decreased to 13.11% and 21.31%, and there was no significant difference in the detection of fimA type I, II, III and V between two groups. Only fimA type IV (16.39%) was detected higher than that of T0 in both groups (P<0.05).

Association of fimA genotypes and GI

The Mann-Whitney U test was used to determine the correlation between prevalence of fimA genotypes and GI in case group. As P. gingivalis-positive and fimA-positive samples at T3 were the largest than those of other time points. We used the data of T3 to assess the correlation of fimA genotypes and GI (shown in Table 3), regarding GI, there was no significant difference between fimA I/ III/ V/ Ib-positive samples and negative samples (P>0.05). However, the GI of fimA II, IV-positive samples was significantly higher than that of negative samples (P<0.01).
Table 3

The correlation of fimA genotypes and GI.

GI (n %)P
012
fimA Inegative14 (28.0)28 (56.0)8 (16.0)0.13
positive5 (45.5)6 (54.5)0 (0.0)
fimA IInegative19 (36.5)30 (57.7)3 (5.8)<0.001
positive0 (0.0)4 (44.4)5 (55.6)
fimA IIInegative17 (31.5)29 (53.7)8 (14.8)0.713
positive2 (28.6)5 (71.4)0 (0.0)
fimA IVnegative19 (41.3)22 (47.8)5 (10.9)0.006
positive0 (0.0)12 (80.0)3 (20.0)
fimA Vnegative13 (33.3)22 (56.4)4 (10.3)0.438
positive6 (27.3)12 (54.5)4 (18.2)
fimA Ibnegative18(32.1%)31(55.4%)7(12.5%)0.239
positive1(20%)3(50%)1(20%)

The Mann-Whitney U test was used to determine the correlation between prevalence of fimA genotypes and GI in case group.

The Mann-Whitney U test was used to determine the correlation between prevalence of fimA genotypes and GI in case group.

Evaluation of clinical parameter

It was showed that the value of GI (Table 4) in case group increased after placing appliances and reached to the maximum at T3, then decreased at T4. The GI at T4 was found higher than that of baseline in two groups (P<0.01), but obviously lower than that at T3(P<0.01).
Table 4

GI from the orthodontic patients and peridontally healthy subjects.

control groupcase group
T0T0T1T2T3T4
GI 0566136291924
GI 10025303425
GI 2000282

Discussion

Saxe et al. and Lindhe et al. indicated that gingivitis might represent a pre-phase in adults [31, 32]. Morinushi et al [33] investigated the association between gingivitis and colonization of P.gingivalis in children of different ages demonstrated that the children carrying detectable levels of P. gingivalis had significantly higher inflammation scores than those with negative P. gingivalis. Furthermore, they demonstrated that P. gingivalis was related to the progression of gingivitis and the onset of the periodontitis in adolescents (12 years and older). There were few documents examining the colonization by P. gingivalis in a long term utilization of fixed orthodontic appliances (extending to six months) in adolescents. A previous research showed various periodontal pathogens increased significantly after 6 months of fixed appliance treatment, but returned to pretreatment levels by 12 months of orthodontic treatment [25]. Ristic et al. found the detection rate of P. gingivalis increased from baseline to three months after bonding, then decreased at six months, which varied with the change of GI [34]. In this case, not only the incidence of P. gingivalis, but also fimA II, IV and V continuously increased after appliances placement, and reached the maximum at T3, and then followed by a decrease at T4, which was consistent with the change of GI. This could be explained by improvement of oral hygiene and reestablishment of host-microorganisms balance. It was demonstrated that periodontal diseases resulted from a rupture of the dynamic balance between the pathogens and host defense system [1, 34]. Scientific investigations indicated that the presence of fixed orthodontic appliances would hamper effective oral hygiene and result in an ecological environment favorable to accumulate gram-negative anaerobic bacteria in subgingival regions, especially for adolescents [34, 35]. For this reason, the host–microorganisms balance is broken, which leads to periodontal diseases. Guo [35] investigated the differences of the impact of orthodontic appliances on periodontal tissues between adults and children and found that the frequency of P. gingivalis presented stable trends among adults during the first three months, but increased significantly among children in the first three months. This article illustrated that the effect of fixed orthodontic appliance on periodontal tissues was more apparent in children than in adults. It seems that 3 months following placing orthodontic appliances, most adolescent patients raised awareness of oral hygiene and mastered tooth-brushing skills. Accordingly, the rebalance of host and microorganisms started to establish. This resulted in a reduction of periodontal pathogens, which was consistent with better periodontal status. It should also be addressed that proper hygiene controls during the therapy contributed to little increase in plaque accumulation and the rebalance of host-microorganisms, consequently [34]. It was reported that P. gingivalis was detected not only at a high frequency in patients with periodontitis, but also at a low frequency in periodontally healthy individuals without obvious gingival inflammation [36, 37]. Therefore, specific virulent genotypes of the pathogens might be a cause of periodontal diseases [20]. Accumulating evidences suggested that P. gingivalis harboring Type II and IV (Pg-II, IV) fimbriae were disease-related isolates, while Pg-I and III were non-disease-related. Some researchers evaluated fimA genotypes in animal trials, demonstrating that fimA genotype II, Ib, and IV could cause stronger infections and inflammatory changes compared to strains with fimA genotype I and III [22, 38, 39]. Results of several clinical researches also believed that nucleotide genetic variation was likely related to virulence. In chronic periodontitis, P. gingivalis strains harboring fimA genotype II, IV, and Ib were obviously more common than isolates with other genotypes [18, 20, 22, 30, 40–42]. Also, P. gingivalis carrying type II fimbriae was found to be the predominant fimA genotype in patients with periodontitis in several epidemiological surveys, while fimA genotype IV was more prevalent in the gingivitis group [8, 42]. Additionally, the previous views that genotype II, IV, and Ib were related to virulence were supported by fimA genotyping of cultured clinical isolates of P. gingivalis sampled from patients with chronic periodontitis [20, 41]. On the contrary, strains with fimA genotype I were the most prevalent among P. gingivalis positive in periodontally healthy subjects, followed by genotype V [20, 30]. We detected the prevalence of fimA genotypes during the orthodontic therapy. At T3, consistent with the maximum GI, there was a statistically higher incidence of fimA II, IV and V than that at T0 and periodontally healthy individuals, demonstrating that they present stronger virulence of P. gingivalis. Subsequently, fimA II and V returned to be normal at T4, while the incidence of fimA IV was significantly higher than that at T0 and periodontally healthy individuals, meanwhile the periodontal clinical parameter was improved, implying the virulence of P. gingivalis tended to be weakened. We inferred that this might also due to reestablishment of host–microorganisms balance and improvement of oral hygiene. According to previous reports, fimA V was detected in 0~29.7% of healthy subjects and 0~17.4% of periodontitis patients. In this study, we found fimA V appeared in 8.93% of healthy subjects, similar to data obtained from other groups, and in 36.07% of patients at T3, which was higher than data from previous reports. Moreover, the incidence of fimA V at T3 was statistically higher than that at T0 and healthy subjects. In order to further explore whether fimA V was associated with orthodontic gingivitis, we analyzed the correlation of GI and incidence of fimA V. The data showed that the GI levels of fimA II or IV positive groups were significantly higher than that of negative groups, while there was no difference in the GI levels between fimA V positive and negative groups, demonstrating that only fimA II and IV were associated with orthodontic gingivitis. However, it is unclear why Pg-fimA V significant increase during fixed orthodontic therapy. Longitudinal studies with larger sample size of orthodontic patients are needed to disclose it.

Conclusion

The incidence of P. gingivalis, fimA II, IV and V increased after appliances placement and reached the maximum at the first three months, and followed by a decrease. P. gingivalis carrying fimA II or IV was associated with gingivitis during orthodontic therapy. In addition, appropriate oral hygiene could lead to decrease accumulation of dental plaque, and exert a beneficial effect on periodontal tissues.

Demographic characteristics of subjects in this study.

(DOCX) Click here for additional data file.

The oral hygiene protocol.

(DOCX) Click here for additional data file.
  42 in total

1.  Prevalence of specific genotypes of Porphyromonas gingivalis fimA and periodontal health status.

Authors:  A Amano; M Kuboniwa; I Nakagawa; S Akiyama; I Morisaki; S Hamada
Journal:  J Dent Res       Date:  2000-09       Impact factor: 6.116

2.  Progression of periodontal inflammation in adolescents is associated with increased number of Porphyromonas gingivalis, Prevotella intermedia, Tannerella forsythensis, and Fusobacterium nucleatum.

Authors:  Ning-Yan Yang; Quan Zhang; Jin-Lu Li; Sheng-Hui Yang; Qing Shi
Journal:  Int J Paediatr Dent       Date:  2013-09-12       Impact factor: 3.455

3.  Clinical and microbiological effects of fixed orthodontic appliances on periodontal tissues in adolescents.

Authors:  M Ristic; M Vlahovic Svabic; M Sasic; O Zelic
Journal:  Orthod Craniofac Res       Date:  2007-11       Impact factor: 1.826

4.  Microbial profiles of patients seeking treatment for periodontitis. Influence of origin, smoking and age?

Authors:  Fabien Décaillet; Catherine Giannopoulou; Norbert Cionca; Adnan Almaghlouth; Andrea Mombelli
Journal:  Schweiz Monatsschr Zahnmed       Date:  2012

5.  Prevalence of Aggregatibacter actinomycetemcomitans in Sudanese patients with aggressive periodontitis: a case-control study.

Authors:  A Elamin; J M Albandar; K Poulsen; R W Ali; V Bakken
Journal:  J Periodontal Res       Date:  2011-02-17       Impact factor: 4.419

6.  Identification of the putative specific pathogenic genes of Porphyromonas gingivalis with type II fimbriae.

Authors:  Li Gao; Yi Xu; Shu Meng; Yafei Wu; Haiyun Huang; Ruiying Su; Lei Zhao
Journal:  DNA Cell Biol       Date:  2012-01-18       Impact factor: 3.311

7.  Prevalence of fimA genotypes of Porphyromonas gingivalis and periodontal health status in Chinese adults.

Authors:  L Zhao; Y-F Wu; S Meng; H Yang; Y-L OuYang; X-D Zhou
Journal:  J Periodontal Res       Date:  2007-12       Impact factor: 4.419

8.  Real-time PCR quantification of six periodontal pathogens in saliva samples from healthy young adults.

Authors:  Xiaodong Zhou; Xiaoli Liu; Jing Li; Raydolfo M Aprecio; Wu Zhang; Yiming Li
Journal:  Clin Oral Investig       Date:  2014-09-13       Impact factor: 3.573

9.  fimA genotypes and multilocus sequence types of Porphyromonas gingivalis from patients with periodontitis.

Authors:  Morten Enersen; Ingar Olsen; Øyvind Kvalheim; Dominique A Caugant
Journal:  J Clin Microbiol       Date:  2007-10-31       Impact factor: 5.948

10.  Consequences of orthodontic treatment in malocclusion patients: clinical and microbial effects in adults and children.

Authors:  Li Guo; Ying Feng; Hong-Gang Guo; Bo-Wen Liu; Yang Zhang
Journal:  BMC Oral Health       Date:  2016-10-28       Impact factor: 2.757

View more
  2 in total

Review 1.  Taxonomic Analysis of Oral Microbiome during Orthodontic Treatment.

Authors:  Alessandra Campobasso; Eleonora Lo Muzio; Giovanni Battista; Domenico Ciavarella; Vito Crincoli; Lorenzo Lo Muzio
Journal:  Int J Dent       Date:  2021-10-28

2.  Anti-Adherence and Antimicrobial Activities of Silver Nanoparticles against Serotypes C and K of Streptococcus mutans on Orthodontic Appliances.

Authors:  Rosa Amalia Nafarrate-Valdez; Rita Elizabeth Martínez-Martínez; Erasto Armando Zaragoza-Contreras; José Luis Áyala-Herrera; Rubén Abraham Domínguez-Pérez; Simón Yobanny Reyes-López; Alejandro Donohue-Cornejo; Juan Carlos Cuevas-González; Juan Pablo Loyola-Rodríguez; León Francisco Espinosa-Cristóbal
Journal:  Medicina (Kaunas)       Date:  2022-06-30       Impact factor: 2.948

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.