Literature DB >> 29170655

The TAL Effector AvrBs3 from Xanthomonas campestris pv. vesicatoria Contains Multiple Export Signals and Can Enter Plant Cells in the Absence of the Type III Secretion Translocon.

Felix Scheibner1, Sylvestre Marillonnet2, Daniela Büttner1.   

Abstract

Pathogenicity of the Gram-negative plant-pathogenic bacterium Xanthomonas campestris pv. vesicatoria depends on a type III secretion (T3S) system which translocates effector proteins into plant cells. Effector protein delivery is controlled by the T3S chaperone HpaB, which presumably escorts effector proteins to the secretion apparatus. One intensively studied effector is the transcription activator-like (TAL) effector AvrBs3, which binds to promoter sequences of plant target genes and activates plant gene expression. It was previously reported that type III-dependent delivery of AvrBs3 depends on the N-terminal protein region. The signals that control T3S and translocation of AvrBs3, however, have not yet been characterized. In the present study, we show that T3S and translocation of AvrBs3 depend on the N-terminal 10 and 50 amino acids, respectively. Furthermore, we provide experimental evidence that additional signals in the N-terminal 30 amino acids and the region between amino acids 64 and 152 promote translocation of AvrBs3 in the absence of HpaB. Unexpectedly, in vivo translocation assays revealed that AvrBs3 is delivered into plant cells even in the absence of HrpF, which is the predicted channel-forming component of the T3S translocon in the plant plasma membrane. The presence of HpaB- and HrpF-independent transport routes suggests that the delivery of AvrBs3 is initiated during early stages of the infection process, presumably before the activation of HpaB or the insertion of the translocon into the plant plasma membrane.

Entities:  

Keywords:  AvrBs3; Xanthomonas; chaperone; transcription activator-like effector; translocon; type III secretion

Year:  2017        PMID: 29170655      PMCID: PMC5684485          DOI: 10.3389/fmicb.2017.02180

Source DB:  PubMed          Journal:  Front Microbiol        ISSN: 1664-302X            Impact factor:   5.640


Introduction

Many Gram-negative bacterial pathogens translocate effector proteins into eukaryotic host cells to modulate host cellular pathways such as defense responses to their own benefit (Raymond et al., 2013; Ashida et al., 2015; Santos and Finlay, 2015; Büttner, 2016; Ensminger, 2016; Grabowski et al., 2017). Effector protein translocation often depends on the type III secretion (T3S) system, which is an essential pathogenicity factor of many bacterial species and is related to the bacterial flagellum (Büttner, 2012; Diepold and Armitage, 2015). At least eight components of T3S systems are conserved in different bacterial species and were designated Sct (secretion and cellular translocation) proteins in animal-pathogenic bacteria followed by a letter, which indicates the corresponding T3S system components from Yersinia species (Hueck, 1998; Deng et al., 2017). Sct proteins are mainly involved in the assembly of the membrane-spanning part of the secretion apparatus, which consists of ring structures in the inner and outer bacterial membrane and a predicted periplasmic inner rod (Büttner, 2012). The inner membrane rings associate with the export apparatus, which is assembled by five transmembrane proteins and presumably forms a transport channel for secreted proteins (Diepold et al., 2011; Büttner, 2012; Dietsche et al., 2016; Deng et al., 2017). Components of the export apparatus are connected with the cytoplasmic ATPase complex, which provides the energy for secretion and/or unfolds secreted proteins during transport (Büttner, 2012; Deng et al., 2017). The ATPase presumably interacts with members of the SctQ family, which assemble as cytoplasmic ring or pod-like structures and are potential docking sites for T3S substrates (Büttner, 2012; Deng et al., 2017; Hu et al., 2017). Extracellular components of translocation-associated T3S systems from animal-pathogenic bacteria include the T3S needle, which serves as a conduit for T3S substrates to the host-pathogen interface. T3S needles are 40–80 nm long and thus significantly shorter than the T3S pilus from plant-pathogenic bacteria, which reaches a length of up to 2 μm and spans the plant cell wall (Büttner, 2012). Needle and pilus are directly or indirectly connected to the T3S translocon, which inserts as a channel-like complex into the eukaryotic plasma membrane and mediates effector protein translocation (Mueller et al., 2008; Mattei et al., 2011; Galan et al., 2014). T3S translocons from animal-pathogenic bacteria often consist of two conserved hydrophobic translocators, which form the transmembrane channel, and a third hydrophilic translocator, which presumably provides an assembly platform for the translocon channel at the tip of the needle (Mattei et al., 2011). Notably, translocon-dependent protein delivery into eukaryotic cells does not appear to be restricted to proteins that travel inside the T3S system but was also reported for external proteins. Thus, the effector protein YopH from Yersinia spp. is delivered by the T3S translocon when present on the bacterial surface (Akopyan et al., 2011). Similarly, translocon-dependent delivery was reported for the type V-secreted autotransporter EspC from enteropathogenic Escherichia coli, which interacts with translocon proteins, suggesting that the T3S translocon also transports T3S-unrelated proteins (Vidal and Navarro-Garcia, 2008; Tejeda-Dominguez et al., 2017). The translocon is usually essential for type III-dependent effector protein delivery, however, several type III effector proteins from animal-pathogenic bacteria including SspH1 from Salmonella spp. and YopM from Yersinia spp. can also enter eukaryotic cells independently of the translocon, presumably via endocytosis or direct transport across the plasma membrane (Rüter et al., 2010; Scharnert et al., 2013; Lubos et al., 2014). A similar mechanism has not yet been reported for effector proteins from plant-pathogenic bacteria. In contrast to T3S translocons from animal-pathogenic bacteria, the predicted translocon from plant-pathogenic bacteria is less well conserved among different species and the mechanisms underlying effector protein translocation are not yet understood. In Xanthomonas campestris pv. vesicatoria (also designated Xanthomonas euvesicatoria), the secreted HrpF protein was identified as putative channel-forming translocon protein (Büttner et al., 2002). Mutant studies and in vivo translocation assays suggest that HrpF is essential for pathogenicity of X. campestris pv. vesicatoria and effector protein translocation (Büttner et al., 2002; Hotson et al., 2003; Jiang et al., 2009; Teper et al., 2016). Homologous proteins are present in many Xanthomonas species and Ralstonia solanacearum. Furthermore, HrpF shares limited sequence similarity with the putative translocon protein HrpK1 from Pseudomonas syringae (Kvitko et al., 2007). HrpK1 contributes to but is not essential for pathogenicity of P. syringae as well as for efficient effector protein delivery and HR induction on tobacco plants (Petnicki-Ocwieja et al., 2005; Kvitko et al., 2007). Accessory hydrophilic proteins, designated harpins, presumably contribute to effector protein translocation in P. syringae and were also identified in other bacterial species (Kvitko et al., 2007; Choi et al., 2013; Ji and Dong, 2015). X. campestris pv. vesicatoria, which causes bacterial spot disease in pepper and tomato plants, is one of the model systems for the analysis of T3S systems in plant-pathogenic bacteria (Jones et al., 2004; Potnis et al., 2015). The T3S system from X. campestris pv. vesicatoria is essential for pathogenicity and is encoded by the chromosomal hrp (hypersensitive response and pathogenicity) gene cluster (Büttner and Bonas, 2002). Eleven hrp gene products, referred to as Hrc (Hrp conserved), are conserved in animal- and/or plant-pathogenic bacteria and presumably constitute the core components of the secretion apparatus (Büttner and Bonas, 2002). Additional components are encoded by non-conserved hrp genes and include for instance the predicted inner rod proteins HrpB1 and HrpB2, which presumably form an assembly platform for the T3S pilus, the pilus protein HrpE and the translocon protein HrpF (Büttner et al., 2002; Weber et al., 2005; Hartmann et al., 2012; Hausner et al., 2013). An additional protein, which might contribute to effector delivery, is the secreted XopA protein, which is encoded in the flanking region of the hrp gene cluster (Noël et al., 2002). The hrp gene cluster also encodes Hpa (Hrp-associated) proteins which contribute to but are not essential for type III-dependent effector protein translocation. One example is the general T3S chaperone HpaB, which is essential for pathogenicity and promotes effector protein translocation (Büttner et al., 2004). HpaB presumably targets effectors to the ATPase HrcN of the T3S system and is involved in the recognition of translocation signals (Büttner et al., 2006; Lorenz and Büttner, 2009; Scheibner et al., 2017). The activity of HpaB is controlled by its secreted regulator HpaA, which interacts with and likely inhibits HpaB. Secretion of HpaA presumably liberates HpaB and thus activates effector protein secretion (Lorenz et al., 2008). The T3S system from X. campestris pv. vesicatoria translocates more than 30 effector proteins into plant cells (Büttner et al., 2006, 2007; Szczesny et al., 2010a; Schulze et al., 2012). In many cases, the precise biochemical functions and plant targets of effectors are still unknown (Büttner and Bonas, 2010). One of the best studied type III effectors from X. campestris pv. vesicatoria is AvrBs3, which is a member of the transcription activator-like (TAL) effector family and acts as a transcription factor in plant cells (Boch and Bonas, 2010). TAL effectors contain C-terminal nuclear localization signals (NLSs) and are imported into the plant cell nucleus (Boch and Bonas, 2010). The central region of TAL effectors consists of a variable number of amino acid repeats with a predominant length of 34 amino acids and mediates DNA binding (Boch and Bonas, 2010). The repeats are almost sequence-identical with the exception of two variable residues (RVDs, repeat variable diresidues) at amino acid positions 12 and 13 of each repeat (Boch and Bonas, 2010). The RVDs allow the base-specific binding of TAL effectors to sequences in the promoter regions of plant target genes (Boch et al., 2009; Moscou and Bogdanove, 2009; Deng et al., 2012; Mak et al., 2012). The subsequent modulation of plant gene expression by TAL effectors depends on their C-terminal acidic activation domain (AAD) (Boch and Bonas, 2010). Among the plant target genes is the Bs3 resistance gene, which is present in AvrBs3-responsive pepper plants and encodes a flavin monooxygenase. Bs3 initiates the induction of a hypersensitive response (HR), which is a local rapid cell death at the infection site and presumably restricts bacterial multiplication (Römer et al., 2009; Wu et al., 2014). Delivery of AvrBs3 by the T3S system depends on the N-terminal 152 amino acids which presumably contain the export signal (Szurek et al., 2002; Noël et al., 2003). We previously reported that the N-terminal 50 amino acids of AvrBs3 are sufficient for T3S (Büttner et al., 2004). Yet, the precise location of T3S and translocation signals in AvrBs3 has not been determined. Secretion and translocation signals are usually located in the N-terminal regions of T3S substrates and are not conserved on the amino acid level (Sory et al., 1995; Schesser et al., 1996; Rüssmann et al., 2002; Schechter et al., 2004; Arnold et al., 2009). However, they often contain specific amino acid compositions or patterns such as a high content of polar amino acids as was reported for effector proteins from the plant-pathogenic bacterium P. syringae (Guttman et al., 2002; Petnicki-Ocwieja et al., 2002; Greenberg and Vinatzer, 2003; Schechter et al., 2004, 2006; Arnold et al., 2009; Löwer and Schneider, 2009; Samudrala et al., 2009; Buchko et al., 2010). Evidence for an essential role of characteristic amino acids for T3S or translocation, however, is still missing (Schechter et al., 2012). In the present study, we localized T3S and translocation signals in the TAL effector AvrBs3. The results of in vitro T3S and in vivo translocation assays revealed that AvrBs3 contains separate signals, which control T3S and translocation in the presence or absence of the T3S chaperone HpaB. Furthermore, the analysis of AvrBs3 translocation by HR- and fluorescence based translocation assays showed that AvrBs3 enters plant cells in the absence of a functional translocon, suggesting that it is translocated during early stages of the infection process prior to the assembly of the translocon.

Materials and methods

Bacterial strains and growth conditions

Bacterial strains and plasmids used in this study are listed in Table 1. Escherichia coli strains were cultivated at 37°C in lysogeny broth (LB) medium and X. campestris pv. vesicatoria strains at 30°C in nutrient-yeast extract-glycerol (NYG) medium (Daniels et al., 1984) or minimal medium A (Ausubel et al., 1996) at pH 7.0 supplemented with 10 mM sucrose and 0.3% casamino acids.
Table 1

Bacterial strains and plasmids used in this study.

Strain/plasmidRelevant characteristicsaReferences or Sources
X. campestris pv. vesicatoria
85-10Pepper-race 2; wild type; RifrCanteros, 1990; Kousik and Ritchie, 1998
85-10ΔhpaBDerivative of strain 85-10 deleted in hpaBBüttner et al., 2004
85-10ΔhrpEDerivative of strain 85-10 deleted in hrpEWeber et al., 2005
85-10ΔhrpFDerivative of strain 85-10 deleted in hrpFBüttner et al., 2002
85-10ΔhrpFΔxopADerivative of strain 85-10 deleted in hrpF and xopAThis study
85-10ΔxpsDΔxcsDDerivative of strain 85-10 deleted in the secretin-encoding genes xpsD and xcsD of the Xcs- and Xps-T2S gene clustersSzczesny et al., 2010b
85-10ΔhrpFΔxpsDΔxcsDDerivative of strain 85-10 lacking hrpF and the secretin genes xcsD and xpsDThis study
85*85-10 derivative containing the hrpG* mutationWengelnik et al., 1999
85*ΔhpaBDerivative of strain 85* deleted in hpaBBüttner et al., 2004
85*ΔhrpFDerivative of strain 85* deleted in hrpFBüttner et al., 2002
85*ΔhpaBΔhrpFDerivative of strain 85* deleted in hpaB and hrpFBüttner et al., 2004
85*ΔhrcVΔhpaBDerivative of strain 85* deleted in hrcV and hpaBBüttner et al., 2004
85*ΔhrpFΔxopADerivative of strain 85* deleted in hrpF and xopAThis study
85*ΔhrpEDerivative of strain 85* deleted in hrpEWeber et al., 2005
85*ΔhrcNDerivative of strain 85* deleted in hrcNLorenz and Büttner, 2009
82-8Pepper-race 1; wild type; RifrCanteros, 1990; Kousik and Ritchie, 1998
82-8ΔhrpFDerivative of strain 82-8 deleted in hrpFThis study
82-8ΔhrpFΔxopADerivative of strain 82-8 deleted in hrpF and xopAThis study
82-8ΔhrcVDerivative of strain 82-8 deleted in hrcVKindly provided by U. Bonas
82*82-8 derivative containing the hrpG* mutationWengelnik et al., 1999
82*ΔhrpFDerivative of strain 82* deleted in hrpFBüttner et al., 2002
82*ΔhrcNDerivative of strain 82* deleted in hrcNWengelnik et al., 1999
82*ΔhpaBDerivative of strain 82* deleted in hpaBBüttner et al., 2004
A. tumefaciens
GV2260Contains Ti plasmid pGV2260, Rifr, AprDeblaere et al., 1985
E. coli
DH5λpirFrecA hsdR17(rk-,mk+) Φ80dlacZ DM15 [λpir]Ménard et al., 1993
OneShot®TOP10FmcrA Δ(mrr-hsdRMS-mcrBC) ϕ80lacZΔM15 ΔlacX74 recA1 araΔ139 Δ(ara-leu)7697 galU galK rpsL endA1 nupG (StrR)Invitrogen
Plasmids
pRK2013ColE1 replicon, TraRK+ Mob+; KmrFigurski and Helinski, 1979
pUC57ΔBsaIDerivative of pUC57 with mutated BsaI siteMorbitzer et al., 2011
pBBR1MCS-5Broad-host-range vector; lac promoter; GmrKovach et al., 1995
pBRMGolden Gate-compatible derivative of pBBR1MCS-5Szczesny et al., 2010b
pBRM-PDerivative of pBRM lacking the lac promoterSzczesny et al., 2010b
pBR356Derivative of pBBR1MCS-5 containing avrBs3Δ2 downstream of the lac promoter and the lacZα fragment, which is flanked by BsaI sitesScheibner et al., 2016
pBRMavrBs3Derivative of pBRM encoding AvrBs3Kindly provided by U. Bonas
pBRMavrBs31−10-356Derivative of pBR356 encoding AvrBs31−10-AvrBs3Δ2This study
pBRMavrBs31−20-356Derivative of pBR356 encoding AvrBs31−20-AvrBs3Δ2This study
pBRMavrBs31−30-356Derivative of pBR356 encoding AvrBs31−30-AvrBs3Δ2This study
pBRMavrBs31−40-356Derivative of pBR356 encoding AvrBs31−40-AvrBs3Δ2This study
pBRMavrBs31−50-356Derivative of pBR356 encoding AvrBs31−50-AvrBs3Δ2This study
pBRM-PxopJ1−155-356Derivative of pBRM-P encoding XopJ1−155-AvrBs3Δ2This study
pBRM-PxopJ1−155-avrBs3ΔN63Derivative of pBRM-P encoding XopJ1−155-AvrBs3ΔN63This study
pBRMavrBs31−10-avrBs3ΔN63Derivative of pBR356 encoding AvrBs31−10-AvrBs3ΔN63This study
pBRMavrBs31−30-avrBs3ΔN63Derivative of pBR356 encoding AvrBs31−30-AvrBs3ΔN63This study
pBRMavrBs3ΔN63Derivative of pBRM encoding AvrBs3ΔN63 deleted in amino acids 2 - 63This study
pGGA3Golden Gate-compatible binary vector; contains backbone of pBGWFS7 and the 35S promoter, allows the expression of genes in fusion with a C-terminal FLAG epitope-encoding sequence, SmrKindly provided by U. Bonas; Karimi et al., 2005
pGGA3avrBs3Derivative of pGGA3 encoding AvrBs3This study
pGGA3avrBs31−10-356Derivative of pGGA3 containing avrBs31−10-avrBs3Δ2This study
pGGA3avrBs31−20-356Derivative of pGGA3 containing avrBs31−20-avrBs3Δ2This study
pICH77739Derivative of pBIN19, RK2 ori, contains lacZa flanked by BpiI sites; KmrWeber et al., 2011a
pICH77739_dTALE-2Derivative of pICH77739 encoding dTALE-2Scheibner et al., 2016
pICH77739_dTALE-2ΔNDerivative of pICH77739 encoding dTALE-2ΔN which is deleted in amino acids 2–64Scheibner et al., 2016
pICH77739_AvrBs31−30-dTALE-2ΔNDerivative of pICH77739 encoding AvrBs31−30-dTALE-2ΔNThis study
pICH77739_AvrBs31−50-dTALE-2ΔNDerivative of pICH77739 encoding AvrBs31−50-dTALE-2ΔNThis study
pOK1Suicide vector; sacB sacQ mobRK2 oriR6K; SmrHuguet et al., 1998
pOKΔhrpF2-kb fragment containing the flanking regions of hrpF in pOK1Büttner et al., 2002
pOxopADerivative of pOK1, contains the flanking regions of xopANoël et al., 2002

Ap, ampicillin; Km, kanamycin; Rif, rifampicin; Sm, spectinomycin; Str, streptomycin; Tc, tetracycline; r, resistant.

Bacterial strains and plasmids used in this study. Ap, ampicillin; Km, kanamycin; Rif, rifampicin; Sm, spectinomycin; Str, streptomycin; Tc, tetracycline; r, resistant.

Plant material and plant inoculations

X. campestris pv. vesicatoria strains were inoculated into leaves of the near-isogenic pepper cultivars Early Cal Wonder (ECW), ECW-10R and ECW-30R, and Bs3- or gfp-transgenic Nicotiana benthamiana plants at concentrations of 4 × 108 colony-forming units (CFU) ml−1 in 1 mM MgCl2 if not stated otherwise (Minsavage et al., 1990; Bonas et al., 1991; Kousik and Ritchie, 1998; Scheibner et al., 2016). Agrobacterium tumefaciens strains were infiltrated in 1 mM MgCl2 at a density of 8 × 108 CFU ml−1. Infected pepper plants were incubated for 16 h of light at 28°C and 65% humidity, and 8 h of darkness at 22°C and 65% humidity. N. benthamiana plants were incubated for 16 h of light at 20°C and 75% humidity, and 8 h of darkness at 18°C and 70% humidity. The appearance of plant reactions was scored over a period of one to 12 dpi. For the better visualization of the HR, leaves were destained in 70% ethanol. Experiments were repeated at least twice; representative plant reactions are shown.

Generation of expression constructs

For the generation of expression constructs encoding AvrBs3Δ2 fusion proteins under control of the lac promoter, avrBs3 gene fragments were amplified by PCR from X. campestris pv. vesicatoria and cloned into the BsaI sites of plasmid pBR356, which contains the avrBs3Δ2 reporter gene (Scheibner et al., 2016). For the generation of constructs encoding AvrBs3Δ63 or AvrBs3Δ63 fusion proteins, modules encoding N-terminal, central and C-terminal regions of AvrBs3Δ63 and the respective fusion partners were cloned into the BsaI sites of plasmid pBRM. The stop codon of avrBs3 was included in these constructs. xopJ-avrBs3Δ2 and xopJ-avrBs3Δ63 were expressed under control of the native xopJ promoter in plasmid pBRM-P. For this, fragments containing the first 155 codons of xopJ and 720 bp of the upstream region including the xopJ promoter (Noël et al., 2003) were ligated with fragments encoding the N-terminal, central and C-terminal regions of AvrBs3Δ63. For the generation of binary constructs for A. tumefaciens-mediated transient gene expression, avrBs3 and avrBs3 were amplified by PCR and ligated with modules encoding N-terminal, central and C-terminal regions of AvrBs3Δ2 into the BsaI sites of the binary vector pGGA3 downstream of the 35S promoter. Similarly, modules encoding N-terminal, central and C-terminal regions of AvrBs3 were cloned into pGGA3. The module encoding the C-terminal region of AvrBs3 lacked the native stop codon and was therefore expressed in fusion with a FLAG epitope-encoding sequence provided by vector pGGA3. Expression constructs encoding dTALE-2 and derivatives thereof were generated by Golden-Gate assembly of individual DNA modules encoding N-terminal, central and C-terminal regions of dTALE-2, dTALE-2ΔN as well as N-terminal regions of the respective fusion partners. All primers used in this study are listed in Table 2. Plasmids were introduced into X. campestris pv. vesicatoria by electroporation or by conjugation using pRK2013 as a helper plasmid in triparental matings (Figurski and Helinski, 1979).
Table 2

Primers used in this study.

PrimerSequence (5′-3′)a
avrBs3 EXPRESSION CONSTRUCTS
avrBs3 Bsa forTTT GGTCTC T TATG GATCCCATTCGTTC
avrBs3 Bsa 10 forTATGGATCCCATTCGTTCGCGCACACCAAGT
avrBs3 Bsa 10 revGATCACTTGGTGTGCGCGAACGAATGGGATC
avrBs3 Bsa 20 revTTT GGTCTC T GATC TTGGGGTCCGGGCAGAAG
avrBs3 Bsa 30 revTTT GGTCTC T GATC ACGATCTGCAGTC
avrBs3 Bsa 50 revTTT GGTCTC T GATC GGACATCGTCCGCCGAGC
xopJ prom720 forTTT GGTCTC T ATTC CTGTATCTGTGCATCGTATTG
xopJ Bsa 155 revTTT GGTCTC T CACC TGACTGGCGATCAGAGATAGC
dTALE-2 EXPRESSION CONSTRUCTS
avrBs3 AATG Bpi forTTT GAAGAC AA AATG GATCCCATTCGTTC
avrBs3 CTGA Bpi 30 revTTT GAAGAC AA CTGA ACGATCTGCAGTCGGCTG
avrBs3 CTGA Bpi 50 revTTT GAAGAC AA CTGA GGACATCGTCCGCCGAGC
RT-PCR PRIMER
RT-Bs3-FGTAACTTCTTGGTTAATGGAGAGTGAATTG
RT-Bs3-RTGATTCTTGTGCTACATTTGTTCTTTCC
Elo-F/AsoAGTCAACTACCACTGGTCAC
Elo-R/AsoGTGCAGTAGTACTTAGTGGTC

Overhangs generated by BsaI or BpiI digestion are written in italics.

Primers used in this study. Overhangs generated by BsaI or BpiI digestion are written in italics.

Generation of X. campestris pv. vesicatoria deletion mutants

For the generation of X. campestris pv. vesicatoria deletion mutants (see Table 1), derivatives of the suicide vector pOK1, which contained the flanking regions of the deleted genes, were transferred to X. campestris pv. vesicatoria recipient strains by triparental conjugation. Double crossovers resulted in deletion mutants which were selected as described previously (Huguet et al., 1998).

Analysis of protein extracts and in Vitro secretion assays

For protein analysis, bacteria were cultivated over-night in liquid NYG medium and cells were harvested by centrifugation. Equal amounts of proteins adjusted according to the optical densities of the cultures were analyzed by immunoblotting, using AvrBs3- or HrpF-specific antibodies. For the analysis of in vitro T3S, bacteria were incubated in MA medium at pH 5.3 for 1.5 h in the presence of thiamine and bovine serum albumin as described previously (Rossier et al., 1999). Secreted proteins were separated from bacterial cells by filtration and precipitated by trichloroacetic acid. Equal amounts of bacterial total cell extracts and culture supernatants (adjusted according to the optical densities of the cultures) were analyzed by SDS-PAGE and immunoblotting using antibodies specific for AvrBs3, the translocon protein HrpF, the inner membrane ring protein HrcJ and the predicted periplasmic inner rod protein HrpB1, respectively (Knoop et al., 1991; Rossier et al., 2000; Büttner et al., 2002). Horseradish peroxidase-labeled anti-rabbit antibodies (GE Healthcare) were used as secondary antibodies. Experiments were repeated twice.

RNA analysis

For transcript analysis via semiquantitative reverse-transcription PCR (RT-PCR), strain 85* and derivatives thereof ectopically expressing avrBs3 were inoculated at concentrations of 4 × 108 CFU ml−1 and derivatives of strain 82-8 at concentrations of 8 × 108 CFU ml−1 into leaves of ECW-30R pepper plants or Bs3-transgenic N. benthamiana plants. 16 leaf discs (2 mm diameter) were harvested 8 h (for derivatives of strain 85*) or 24 h (for derivatives of strain 82-8) post infiltration, pooled and immediately frozen in liquid nitrogen. RNA was isolated with the QIAGEN RNeasy Plant Mini Kit, and samples were treated with DNase I (Roche) for 30 min. cDNA was synthesized from 2 μg of total RNA with the RevertAid H Minus First Strand cDNA synthesis kit (Thermo Scientific) using random hexamer primers. Four microlitres of a 1:50 diluted cDNA solution were used as template in an RT-PCR with up to 40 cycles of denaturation, annealing and elongation. The constitutively expressed gene Elongation factor 1α (EF1α) was amplified as control (Römer et al., 2007). To exclude contaminations by genomic DNA, all reactions were also performed in the absence of reverse transcriptase. The experiments were repeated at least twice with similar results.

Results

The N-terminal 10 amino acids of AvrBs3 contain a T3S signal

To localize the T3S signal in AvrBs3, we generated fusion proteins consisting of the first 10, 20, or 30 amino acids, respectively, of AvrBs3 and AvrBs3Δ2, which is an N-terminal deletion derivative of AvrBs3. AvrBs3Δ2 lacks amino acids 2–152 and thus the T3S and translocation signal. However, AvrBs3Δ2 contains the effector domain and induces the HR in AvrBs3-responsive plants when delivered as fusion partner of a functional translocation signal (Szurek et al., 2002; Noël et al., 2003; Drehkopf et al., 2017). AvrBs3Δ2 fusion proteins were analyzed in X. campestris pv. vesicatoria strain 85*, which is a derivative of the wild-type strain 85-10 and contains HrpG*, a constitutively active version of the hrp gene regulator HrpG (Rossier et al., 1999; Wengelnik et al., 1999). When bacteria were cultivated in secretion medium, AvrBs31−10-, AvrBs31−20- and AvrBs31−30-AvrBs3Δ2 fusion proteins were detected in the culture supernatants (Figure 1A). Similar results were obtained for strain 85*ΔhpaB, which lacks the T3S chaperone HpaB (Figure 1A; Büttner et al., 2004). As controls, we analyzed the inner membrane-associated protein HrcJ and the predicted periplasmic inner rod protein HrpB1. Both proteins were only detected in cell extracts of strains 85* and 85*ΔhpaB, suggesting that no cell lysis had occurred (Figure 1A). We conclude from these data that the N-terminal 10–30 amino acids of AvrBs3 target AvrBs3Δ2 for secretion, even in the absence of the T3S chaperone HpaB. This is in contrast to the full-length AvrBs3 protein, which depends on HpaB for efficient secretion (Büttner et al., 2004).
Figure 1

Localization of T3S and translocation signals in AvrBs3. (A) The N-terminal 10 amino acids of AvrBs3 target AvrBs3Δ2 for secretion in wild-type and hpaB deletion mutant strains. X. campestris pv. vesicatoria strains 85* and 85*ΔhpaB (ΔhpaB) ectopically expressing avrBs3Δ2 fusions as indicated were incubated in secretion medium. Total cell extracts (TE) and culture supernatants (SN) were analyzed by immunoblotting, using AvrBs3-specific antibodies. All AvrBs3Δ2 fusions were reproducibly secreted by both strains, the relative secretion levels, however, varied in different experiments. As control, the blots were reprobed with antibodies against the inner membrane protein HrcJ and the periplasmic predicted inner rod protein HrpB1. (B) The N-terminal 50 amino acids of AvrBs3 contain the translocation signal. Strain 85* ectopically expressing avrBs3 or avrBs3Δ2 fusions as indicated was infiltrated into leaves of AvrBs3-responsive ECW-30R and AvrBs1-responsive ECW-10R pepper plants. For the better visualization of the HR, leaves were destained in ethanol 3 dpi. Dashed lines indicate the infiltrated areas. Equal amounts of cell extracts were analyzed by immunoblotting using an AvrBs3-specific antiserum. (C) Translocation of AvrBs31−50-AvrBs3Δ2 depends on the T3S system. Strains 85*, 85*ΔhpaB (ΔhpaB) and the T3S-deficient strain 85*ΔhrcV (ΔhrcV) ectopically expressing avrBs31−50-avrBs3Δ2 were infiltrated into leaves of AvrBs3-responsive ECW-30R and AvrBs1-responsive ECW-10R pepper plants. Plant reactions and protein synthesis were analyzed as described in (B).

Localization of T3S and translocation signals in AvrBs3. (A) The N-terminal 10 amino acids of AvrBs3 target AvrBs3Δ2 for secretion in wild-type and hpaB deletion mutant strains. X. campestris pv. vesicatoria strains 85* and 85*ΔhpaBhpaB) ectopically expressing avrBs3Δ2 fusions as indicated were incubated in secretion medium. Total cell extracts (TE) and culture supernatants (SN) were analyzed by immunoblotting, using AvrBs3-specific antibodies. All AvrBs3Δ2 fusions were reproducibly secreted by both strains, the relative secretion levels, however, varied in different experiments. As control, the blots were reprobed with antibodies against the inner membrane protein HrcJ and the periplasmic predicted inner rod protein HrpB1. (B) The N-terminal 50 amino acids of AvrBs3 contain the translocation signal. Strain 85* ectopically expressing avrBs3 or avrBs3Δ2 fusions as indicated was infiltrated into leaves of AvrBs3-responsive ECW-30R and AvrBs1-responsive ECW-10R pepper plants. For the better visualization of the HR, leaves were destained in ethanol 3 dpi. Dashed lines indicate the infiltrated areas. Equal amounts of cell extracts were analyzed by immunoblotting using an AvrBs3-specific antiserum. (C) Translocation of AvrBs31−50-AvrBs3Δ2 depends on the T3S system. Strains 85*, 85*ΔhpaBhpaB) and the T3S-deficient strain 85*ΔhrcV (ΔhrcV) ectopically expressing avrBs31−50-avrBs3Δ2 were infiltrated into leaves of AvrBs3-responsive ECW-30R and AvrBs1-responsive ECW-10R pepper plants. Plant reactions and protein synthesis were analyzed as described in (B).

The N-terminal 50 amino acids of AvrBs3 contain a translocation signal

For the analysis of translocation signals in AvrBs3, we performed in vivo translocation assays with AvrBs3Δ2 fusion proteins. For this, strain 85* ectopically expressing individual avrBs3Δ2 fusions was infiltrated into leaves of AvrBs3-responsive ECW-30R pepper plants. AvrBs31−50-AvrBs3Δ2 induced the HR in AvrBs3-responsive ECW-30R pepper plants when delivered by strain 85*, suggesting that the N-terminal 50 amino acids contain a functional translocation signal (Figure 1B). HR induction by AvrBs31−50-AvrBs3Δ2 was dependent on the T3S system because it was macroscopically not detectable when AvrBs31−50-AvrBs3Δ2 was analyzed in the T3S-deficient strain 85*ΔhrcV (Figure 1C). In contrast to AvrBs31−50-AvrBs3Δ2, AvrBs3Δ2 fusions containing the N-terminal 10, 20, 30, or 40 amino acids of AvrBs3 did not induce a visible HR when analyzed in strain 85*, suggesting that they were not or not efficiently translocated (Figure 1B). Immunoblot analysis of bacterial cell extracts revealed that all fusion proteins were stably synthesized (Figure 1B). As control, bacteria were infiltrated into leaves of ECW-10R pepper plants, which contain the resistance gene Bs1 and initiate the HR upon recognition of the effector protein AvrBs1 (Minsavage et al., 1990). All strains induced the AvrBs1-specific HR in leaves of ECW-10R plants, indicating that AvrBs1 was efficiently translocated. This suggests that the AvrBs3Δ2 fusion proteins did not interfere with the activity of the T3S system (Figure 1B).

The N-terminal 30 amino acids of AvrBs3 target the AvrBs3Δ2 reporter for translocation in the absence of the T3S chaperone HpaB

Next, we investigated the influence of the T3S chaperone HpaB on the translocation of AvrBs3Δ2 fusion proteins. Notably, AvrBs31−30-AvrBs3Δ2 was translocated by strain 85*ΔhpaB but did not induce a macroscopically visible HR in AvrBs3-responsive pepper plants when analyzed in strain 85* or the T3S-deficient strain 85*ΔhpaBΔhrcV (Figures 2A,B; see above). Similar data were obtained for the hrpG wild-type strain 85-10ΔhpaB, suggesting that the translocation of AvrBs31−30-AvrBs3Δ2 by hpaB deletion mutants was not caused by the overexpression of the T3S genes in the presence of HrpG* (Figure S1). Hence, the N-terminal 30 amino acids of AvrBs3 contain a translocation signal which is recognized in hpaB deletion mutants but is not sufficient for efficient translocation in the wild-type strain. This signal will hereafter be referred to as minimal translocation signal. Translocation in the absence of HpaB was also observed for AvrBs31−40-AvrBs3Δ2. In contrast, translocation of AvrBs31−50-AvrBs3Δ2 was significantly reduced in strain 85*ΔhpaB (Figure 2A) and not detectable in the hrpG wild-type strain 85-10ΔhpaB (Figure S1), suggesting that the N-terminal 50 amino acids of AvrBs3 depend on HpaB for efficient translocation.
Figure 2

Influence of HpaB on the translocation of AvrBs3 reporter fusions. (A) The N-terminal 30 amino acids of AvrBs3 target the AvrBs3Δ2 reporter for translocation in the absence of HpaB. Strain 85*ΔhpaB (ΔhpaB) ectopically expressing avrBs3 or avrBs3Δ2 fusions as indicated was infiltrated into leaves of AvrBs3-responsive ECW-30R pepper plants. For the better visualization of the HR, leaves were destained in ethanol 3 dpi. Dashed lines indicate the infiltrated areas. Equal amounts of cell extracts were analyzed by immunoblotting using an AvrBs3-specific antiserum. (B) Translocation of AvrBs31−30-AvrBs3Δ2 by hpaB mutants depends on the T3S system. Strains 85*, 85*ΔhpaB (ΔhpaB), and 85*ΔhpaBΔhrcV (ΔhpaBΔhrcV) ectopically expressing avrBs3-avrBs3Δ2 were infiltrated into leaves of AvrBs3-responsive ECW-30R and AvrBs1-responsive ECW-10R pepper plants. Plant reactions and protein synthesis were analyzed as described in (A). The HR in ECW-30R plants was specifically induced by AvrBs31−30-AvrBs3Δ2 and was not observed after infiltration of X. campestris pv. vesicatoria strains without expression constructs (Figure S1). (C) Transient expression of avrBs3Δ2 fusions induces the HR in AvrBs3-responsive pepper plants. A. tumefaciens without expression construct (−) or ectopically expressing avrBs3 or avrBs3Δ2 fusions as indicated was infiltrated at a density of 8 × 108 CFU ml−1 into leaves of AvrBs3-responsive pepper plants. Leaves were destained in ethanol 4 dpi. (D) AvrBs3 is translocated in the absence of the T3S chaperone HpaB. Strains 82* and 82*ΔhpaB (ΔhpaB) were infiltrated into leaves of AvrBs3-responsive ECW-30R and AvrBs1-responsive ECW-10R pepper plants. Plant reactions and protein synthesis were analyzed as described in (A).

Influence of HpaB on the translocation of AvrBs3 reporter fusions. (A) The N-terminal 30 amino acids of AvrBs3 target the AvrBs3Δ2 reporter for translocation in the absence of HpaB. Strain 85*ΔhpaBhpaB) ectopically expressing avrBs3 or avrBs3Δ2 fusions as indicated was infiltrated into leaves of AvrBs3-responsive ECW-30R pepper plants. For the better visualization of the HR, leaves were destained in ethanol 3 dpi. Dashed lines indicate the infiltrated areas. Equal amounts of cell extracts were analyzed by immunoblotting using an AvrBs3-specific antiserum. (B) Translocation of AvrBs31−30-AvrBs3Δ2 by hpaB mutants depends on the T3S system. Strains 85*, 85*ΔhpaBhpaB), and 85*ΔhpaBΔhrcV (ΔhpaBΔhrcV) ectopically expressing avrBs3-avrBs3Δ2 were infiltrated into leaves of AvrBs3-responsive ECW-30R and AvrBs1-responsive ECW-10R pepper plants. Plant reactions and protein synthesis were analyzed as described in (A). The HR in ECW-30R plants was specifically induced by AvrBs31−30-AvrBs3Δ2 and was not observed after infiltration of X. campestris pv. vesicatoria strains without expression constructs (Figure S1). (C) Transient expression of avrBs3Δ2 fusions induces the HR in AvrBs3-responsive pepper plants. A. tumefaciens without expression construct (−) or ectopically expressing avrBs3 or avrBs3Δ2 fusions as indicated was infiltrated at a density of 8 × 108 CFU ml−1 into leaves of AvrBs3-responsive pepper plants. Leaves were destained in ethanol 4 dpi. (D) AvrBs3 is translocated in the absence of the T3S chaperone HpaB. Strains 82* and 82*ΔhpaBhpaB) were infiltrated into leaves of AvrBs3-responsive ECW-30R and AvrBs1-responsive ECW-10R pepper plants. Plant reactions and protein synthesis were analyzed as described in (A). AvrBs3Δ2 fusion proteins containing the N-terminal 10 or 20 amino acids of AvrBs3 did not induce a visible HR when analyzed in strain 85*ΔhpaB (Figure 2A). To exclude that the N-terminal 10 or 20 amino acids of AvrBs3 interfere with the activity of the AvrBs3Δ2 reporter, both gene fusions were expressed under control of the 35S promoter in AvrBs3-responsive pepper plants after A. tumefaciens-mediated gene delivery. Transient expression of avrBs3- and avrBs3-avrBs3Δ2 led to the induction of the Bs3-specific HR, indicating that the AvrBs3Δ2 reporter was functional when present as a fusion partner of the N-terminal 10 or 20 amino acids of AvrBs3 (Figure 2C). Thus, the lack of HR induction by AvrBs31−10- and AvrBs31−20-AvrBs3Δ2 fusion proteins was presumably not caused by a misfolding of the reporter. Taken together, we conclude from these data that the N-terminal 50 amino acids of AvrBs3 contain a translocation signal whereas the N-terminal 30 amino acids promote translocation of AvrBs3 in the absence of HpaB. The N-terminal 10 or 20 amino acids did not target the AvrBs3Δ2 reporter for detectable translocation, however, it cannot be excluded that this region contains a translocation signal which is inactive in the context of the AvrBs3Δ2 fusion.

Amino acids 64–152 promote translocation of AvrBs3

In contrast to AvrBs31−50-AvrBs3Δ2, the full-length AvrBs3 protein induced the HR when analyzed in strains 85*ΔhpaB and 85-10ΔhpaB, suggesting that it was efficiently translocated in the absence of HpaB (Figure 2A; Figure S1). Similar findings were observed for strain 82*ΔhpaB, which is a derivative of strain 82-8 and naturally expresses avrBs3 (Figure 2D). This indicates that the HpaB-independent translocation of AvrBs3 was not caused by the overexpression of T3S genes or of avrBs3. We, therefore, wondered whether the differences in HR induction by AvrBs3 and AvrBs31−50-AvrBs3Δ2 were caused by differences in protein activities. Previous reporter assays revealed that the N-terminal deletion derivative AvrBs3Δ2 led to reduced activation of an AvrBs3-responsive promoter when compared with the full-length AvrBs3 protein (Schreiber et al., 2015). In contrast, transcription activation by an AvrBs3 derivative, which was deleted in the N-terminal 63 amino acids, was like wild type, suggesting that the region between amino acids 63 and 152 of AvrBs3 contributes to protein activity (Schreiber et al., 2015). To investigate whether different activities of AvrBs3 derivatives result in different HR intensities, we compared the HR induction by AvrBs3Δ2 and AvrBs3Δ63 fusion proteins. As fusion partner, which provides the T3S and translocation signal, we chose the N-terminal 155 amino acids of the effector protein XopJ (Noël et al., 2003). When strain 85* or 85-10 delivering XopJ1−155-AvrBs3Δ2 or XopJ1−155-AvrBs3Δ63 was infiltrated into leaves of AvrBs3-responsive pepper plants, no differences in the HR intensities were detected, even when bacteria were infiltrated at lower optical densities (Figure 3A). As both fusion proteins were stably synthesized at comparable levels (Figure 3A), we conclude that the previously observed reduced transcription activation activity of AvrBs3Δ2 did not lead to a macroscopically detectable reduction of the AvrBs3-induced HR. The efficient translocation of AvrBs3 by hpaB deletion mutants might, therefore, be caused by the presence of additional export signals which promote translocation in the absence of HpaB and are absent in AvrBs3Δ2 fusion proteins.
Figure 3

AvrBs3ΔN63 contains a signal that promotes translocation. (A) Translocation assays with AvrBs3Δ2 and AvrBs3ΔN63 fusion proteins. Strains 85-10 and 85* without expression construct (−) or ectopically expressing xopJ-avrBs3Δ2 or xopJ-avrBs3ΔN63 were infiltrated at densities of 108 and 107 CFU ml−1 into leaves of AvrBs3-responsive ECW-30R and AvrBs1-responsive ECW-10R pepper plants as indicated. Leaves were destained in ethanol 3 dpi. Dashed lines indicate the infiltrated areas. Equal amounts of cell extracts were analyzed by immunoblotting using an AvrBs3-specific antiserum. (B) AvrBs3ΔN63 does not induce a macroscopic HR when analyzed in strain 85*. Strain 85* without expression construct (−) or ectopically expressing avrBs3 or avrBs3ΔN63 as indicated was infiltrated into leaves of AvrBs3-responsive ECW-30R and AvrBs1-responsive ECW-10R pepper plants. Plant reactions and protein synthesis were analyzed as described in (A). (C) The N-terminal 10 amino acids of AvrBs3 target AvrBs3ΔN63 for translocation in wild-type and hpaB mutant strains. Strains 85* and 85*ΔhpaB (ΔhpaB) without expression construct or ectopically expressing avrBs3-avrBs3ΔN63 or avrBs3-avrBs3ΔN63 as indicated were infiltrated at a density of 108 CFU ml−1 into leaves of AvrBs3-responsive pepper plants. Leaves were destained in ethanol 2 dpi. Dashed lines indicate the infiltrated areas. Protein synthesis was analyzed as described in (A).

AvrBs3ΔN63 contains a signal that promotes translocation. (A) Translocation assays with AvrBs3Δ2 and AvrBs3ΔN63 fusion proteins. Strains 85-10 and 85* without expression construct (−) or ectopically expressing xopJ-avrBs3Δ2 or xopJ-avrBs3ΔN63 were infiltrated at densities of 108 and 107 CFU ml−1 into leaves of AvrBs3-responsive ECW-30R and AvrBs1-responsive ECW-10R pepper plants as indicated. Leaves were destained in ethanol 3 dpi. Dashed lines indicate the infiltrated areas. Equal amounts of cell extracts were analyzed by immunoblotting using an AvrBs3-specific antiserum. (B) AvrBs3ΔN63 does not induce a macroscopic HR when analyzed in strain 85*. Strain 85* without expression construct (−) or ectopically expressing avrBs3 or avrBs3ΔN63 as indicated was infiltrated into leaves of AvrBs3-responsive ECW-30R and AvrBs1-responsive ECW-10R pepper plants. Plant reactions and protein synthesis were analyzed as described in (A). (C) The N-terminal 10 amino acids of AvrBs3 target AvrBs3ΔN63 for translocation in wild-type and hpaB mutant strains. Strains 85* and 85*ΔhpaBhpaB) without expression construct or ectopically expressing avrBs3-avrBs3ΔN63 or avrBs3-avrBs3ΔN63 as indicated were infiltrated at a density of 108 CFU ml−1 into leaves of AvrBs3-responsive pepper plants. Leaves were destained in ethanol 2 dpi. Dashed lines indicate the infiltrated areas. Protein synthesis was analyzed as described in (A). To investigate the presence of additional export signals outside the N-terminal 50 amino acids of AvrBs3, we analyzed the translocation of fusion proteins between the N-terminal 10 or 30 amino acids of AvrBs3 and AvrBs3Δ63, which lacks the T3S and translocation signal (Schreiber et al., 2015; Scheibner et al., 2016; Figure 3B). Notably, AvrBs31−10- and AvrBs31−30-AvrBs3Δ63 induced the AvrBs3-specific HR when delivered by strains 85* and 85*ΔhpaB (Figure 3C). This is in contrast to the corresponding AvrBs3Δ2 fusions and suggests that the region between amino acids 64 and 152 of AvrBs3 contains a signal which promotes translocation even in the absence of HpaB.

AvrBs3 is delivered into plant cells in the absence of the translocon protein HrpF

It was previously reported that the translocation of effector proteins from Xanthomonas spp. depends on the translocon protein HrpF (Büttner et al., 2002; Szurek et al., 2002; Hotson et al., 2003; Thieme et al., 2007; Jiang et al., 2009; Teper et al., 2016). To confirm the contribution of HrpF to the translocation of AvrBs3, we performed translocation studies with hrpF deletion mutants. Unexpectedly, strain 85*ΔhrpF ectopically expressing avrBs3 induced a browning of the infected leaf tissue, which was visible after destaining of the leaves in ethanol 3 dpi (Figure 4A). A similar phenotype was observed with strain 85*ΔhrpFΔxopA, which additionally lacks the secreted XopA protein (Figure 4A; Noël et al., 2002). XopA contributes to pathogenicity and is homologous to harpins, which are proposed to be involved in effector protein translocation (Noël et al., 2002; Kim et al., 2004). No browning of the leaf tissue was visible when avrBs3 was ectopically expressed in strains 85*ΔhrpE and 85*ΔhrcN, which are deleted in the pilus gene hrpE and the ATPase gene hrcN, respectively (Figure 4A).
Figure 4

AvrBs3 enters plant cells in the absence of a functional translocon. (A) HrpF-independent entry of AvrBs3 into pepper cells. Strains 85*, 85*ΔhrpE (ΔhrpE), 85*ΔhrpF (ΔhrpF), 85*ΔhrpFΔxopA (ΔhrpFΔxopA), and 85*ΔhrcN (ΔhrcN) without expression construct (−) or ectopically expressing avrBs3 as indicated were infiltrated into leaves of AvrBs3-responsive ECW-30R and AvrBs1-responsive ECW-10R pepper plants. Leaves were photographed and destained in ethanol 3 dpi. Dashed lines indicate the infiltrated areas. For the analysis of protein synthesis, equal amounts of cell extracts were analyzed by immunoblotting using AvrBs3- or HrpF-specific antibodies. (B) HrpF-independent delivery of AvrBs3 induces the expression of Bs3 in AvrBs3-responsive pepper plants. Strains 85*, 85*ΔhrpF (ΔhrpF), and 85*ΔhrcN (ΔhrcN) ectopically expressing avrBs3 were infiltrated into leaves of AvrBs3-responsive pepper plants. Eight hours post inoculation, RNA was isolated from infected leaf material and transcribed into cDNA. Fragments corresponding to the Bs3 transcript and the constitutively expressed gene EF1α were amplified for 23–41 PCR cycles as indicated and amplicons were analyzed by agarose gel electrophoresis.

AvrBs3 enters plant cells in the absence of a functional translocon. (A) HrpF-independent entry of AvrBs3 into pepper cells. Strains 85*, 85*ΔhrpE (ΔhrpE), 85*ΔhrpF (ΔhrpF), 85*ΔhrpFΔxopA (ΔhrpFΔxopA), and 85*ΔhrcN (ΔhrcN) without expression construct (−) or ectopically expressing avrBs3 as indicated were infiltrated into leaves of AvrBs3-responsive ECW-30R and AvrBs1-responsive ECW-10R pepper plants. Leaves were photographed and destained in ethanol 3 dpi. Dashed lines indicate the infiltrated areas. For the analysis of protein synthesis, equal amounts of cell extracts were analyzed by immunoblotting using AvrBs3- or HrpF-specific antibodies. (B) HrpF-independent delivery of AvrBs3 induces the expression of Bs3 in AvrBs3-responsive pepper plants. Strains 85*, 85*ΔhrpF (ΔhrpF), and 85*ΔhrcN (ΔhrcN) ectopically expressing avrBs3 were infiltrated into leaves of AvrBs3-responsive pepper plants. Eight hours post inoculation, RNA was isolated from infected leaf material and transcribed into cDNA. Fragments corresponding to the Bs3 transcript and the constitutively expressed gene EF1α were amplified for 23–41 PCR cycles as indicated and amplicons were analyzed by agarose gel electrophoresis. To investigate whether the browning of the infected leaf tissue could have resulted from the induction of the R gene Bs3, we performed RT-PCR studies. The Bs3 transcript was amplified from leaf tissue infected with strain 85* ectopically expressing avrBs3 but not from tissue infected with the corresponding hrcN deletion mutant (Figure 4B). Reduced amounts of the Bs3 transcript were detected in leaf material infected with the hrpF deletion mutant, suggesting that AvrBs3 entered the plant cells in the absence of the translocon protein HrpF and induced the expression of Bs3, albeit in reduced amounts (Figure 4B). We assume that the HrpF-independent entry of AvrBs3 into plant cells was not sufficient for the induction of a macroscopically visible HR reaction in Bs3 pepper plants but resulted in a browning of the infected leaf tissue. The phenotypes were not caused by the overexpression of avrBs3 or the T3S genes, because browning of the leaf tissue was also observed after inoculation of Bs3 pepper plants with the hrpF deletion mutant strain 82-8ΔhrpF, which contains the hrpG wild-type gene and naturally expresses avrBs3 (Figure S2). In agreement with these observations, the Bs3 transcript was detectable in leaf material infected with strain 82-8ΔhrpF but not with the T3S-deficient strain 82-8ΔhrcV (Figure S2).

Translocon-independent entry of a TAL effector into cells of the non-host plant N. benthamiana

To investigate whether the translocon-independent entry of AvrBs3 into plant cells also occurs in non-host plants, we performed infection assays with Bs3-transgenic N. benthamiana plants. As reported previously, strain 85* induced a non-host HR on N. benthamiana plants, which is visible as necrotic area (Figure 5A; Metz et al., 2005; Scheibner et al., 2016). No macroscopic HR was observed after infection with the hrpF deletion mutant strain 85*ΔhrpF, suggesting that the induction of the non-host HR in N. benthamiana depends on the T3S translocon (Figure 5A). Strain 85*ΔhrpF ectopically expressing avrBs3, however, induced the HR in Bs3-transgenic N. benthamiana plants, suggesting that AvrBs3 entered the plant cells in the absence of HrpF (Figure 5A). The reaction was dependent on the T3S system because AvrBs3 did not induce a visible HR when analyzed in strain 85*ΔhrcN, which lacks the T3S ATPase (Figure 5A).
Figure 5

AvrBs3 and dTALE-2 are delivered into N. benthamiana in the absence of a functional translocon. (A) HrpF-independent entry of AvrBs3 into plant cells induces the HR in Bs3 N. benthamiana plants. Strains 85*, 85*ΔhrpF (ΔhrpF) and 85*ΔhrcN (ΔhrcN) without expression construct (−) or ectopically expressing avrBs3 as indicated were infiltrated at a density of 8 × 108 CFU ml−1 into leaves of Bs3-transgenic N. benthamiana plants. Leaves were photographed 8 dpi. Dashed lines indicate the infiltrated areas. (B) Translocon-independent delivery of dTALE-2 into gfp-transgenic N. benthamiana plants. Strains 85*, 85*ΔhrpE (ΔhrpE), 85*ΔhrpF (ΔhrpF), and 85*ΔhrpFΔxopA (ΔhrpFΔxopA) without expression construct (−) or ectopically expressing dTALE-2 as indicated were infiltrated at a density of 5 × 108 CFU ml−1 into leaves of gfp-transgenic N. benthamiana plants. Fluorescence of infected leaf areas was photographed 6 dpi. Dashed lines indicate the infiltrated areas. Fluorescence is reduced in plant tissue infiltrated with strain 85* because of the induction of the non-host HR. For the analysis of protein synthesis, equal amounts of cell extracts were analyzed by immunoblotting using AvrBs3-specific antibodies. (C) Analysis of dTALE-2 in derivatives of strain 85-10. Strains 85-10, 85-10ΔhrpE (ΔhrpE), 85-10ΔhrpF (ΔhrpF) and 85-10ΔhrpFΔxopA (ΔhrpFΔxopA) without expression construct (−) or ectopically expressing dTALE-2 were infiltrated at a density of 5 × 108 CFU ml−1 into leaves of gfp-transgenic N. benthamiana plants. Fluorescence was photographed 13 dpi. Protein synthesis was analyzed as described in B. (D) HrpF-independent entry of dTALE-2 into plant cells is reduced in the absence of functional T2S systems. Strains 85-10, 85-10ΔhrpF (ΔhrpF) and 85-10ΔhrpFΔxpsDΔxcsD (ΔhrpFΔxpsDΔxcsD), which is deficient in the Xps- and Xcs-T2S systems, ectopically expressing dTALE-2 were infiltrated into leaves of gfp-transgenic N. benthamiana plants. Fluorescence was photographed 10 dpi.

AvrBs3 and dTALE-2 are delivered into N. benthamiana in the absence of a functional translocon. (A) HrpF-independent entry of AvrBs3 into plant cells induces the HR in Bs3 N. benthamiana plants. Strains 85*, 85*ΔhrpF (ΔhrpF) and 85*ΔhrcN (ΔhrcN) without expression construct (−) or ectopically expressing avrBs3 as indicated were infiltrated at a density of 8 × 108 CFU ml−1 into leaves of Bs3-transgenic N. benthamiana plants. Leaves were photographed 8 dpi. Dashed lines indicate the infiltrated areas. (B) Translocon-independent delivery of dTALE-2 into gfp-transgenic N. benthamiana plants. Strains 85*, 85*ΔhrpE (ΔhrpE), 85*ΔhrpF (ΔhrpF), and 85*ΔhrpFΔxopA (ΔhrpFΔxopA) without expression construct (−) or ectopically expressing dTALE-2 as indicated were infiltrated at a density of 5 × 108 CFU ml−1 into leaves of gfp-transgenic N. benthamiana plants. Fluorescence of infected leaf areas was photographed 6 dpi. Dashed lines indicate the infiltrated areas. Fluorescence is reduced in plant tissue infiltrated with strain 85* because of the induction of the non-host HR. For the analysis of protein synthesis, equal amounts of cell extracts were analyzed by immunoblotting using AvrBs3-specific antibodies. (C) Analysis of dTALE-2 in derivatives of strain 85-10. Strains 85-10, 85-10ΔhrpE (ΔhrpE), 85-10ΔhrpF (ΔhrpF) and 85-10ΔhrpFΔxopA (ΔhrpFΔxopA) without expression construct (−) or ectopically expressing dTALE-2 were infiltrated at a density of 5 × 108 CFU ml−1 into leaves of gfp-transgenic N. benthamiana plants. Fluorescence was photographed 13 dpi. Protein synthesis was analyzed as described in B. (D) HrpF-independent entry of dTALE-2 into plant cells is reduced in the absence of functional T2S systems. Strains 85-10, 85-10ΔhrpF (ΔhrpF) and 85-10ΔhrpFΔxpsDΔxcsD (ΔhrpFΔxpsDΔxcsD), which is deficient in the Xps- and Xcs-T2S systems, ectopically expressing dTALE-2 were infiltrated into leaves of gfp-transgenic N. benthamiana plants. Fluorescence was photographed 10 dpi. To confirm these results, we performed translocation assays with X. campestris pv. vesicatoria strains ectopically expressing dTALE-2 (designer TAL effector-2), which encodes an artificial derivative of AvrBs3 with modified RVDs (Weber et al., 2011b). To analyse the translocation of dTALE-2, bacteria were infiltrated into leaves of transgenic N. benthamiana plants, which encode the green fluorescent protein (GFP) under control of a dTALE-2-responsive promoter on a stably integrated viral vector construct (Werner et al., 2011; Scheibner et al., 2016). dTALE-2 induced GFP fluorescence when delivered by strain 85* (Figure 5B; Scheibner et al., 2016). Reduced fluorescence was observed when dTALE-2 was analyzed in strains 85*ΔhrpF and 85*ΔhrpFΔxopA whereas no fluorescence was detectable after infiltration of the T3S-deficient strain 85*ΔhrpE (Figure 5B). Similar data were obtained for derivatives of the wild-type strain 85-10, suggesting that the HrpF-independent entry of dTALE-2 into plant cells was not caused by the overexpression of the T3S genes (Figure 5C). Taken together, these data suggest that dTALE-2 can enter the plant cell in a translocon-independent manner. We also performed infection experiments with strain 85-10ΔhrpFΔxpsDΔxcsD, which lacks hrpF and functional T2S systems. Type II-secreted cell wall-degrading enzymes were proposed to facilitate T3S pilus assembly and thus presumably contribute to the HrpF-independent passage of AvrBs3 across the plant plasma membrane (Szczesny et al., 2010b). In agreement with this hypothesis, dTALE-2 induced reduced GFP fluorescence when analyzed in strain 85-10ΔhrpFΔxpsDΔxcsD (Figure 5D).

The translocation signal contributes to the HrpF-independent entry of AvrBs3 into plant cells

Next, we investigated the contribution of the translocation signal to the translocon-independent entry of AvrBs3 into plant cells. Infection experiments showed that the N-terminal deletion derivative dTALE-2ΔN did not induce detectable GFP fluorescence in gfp-transgenic N. benthamiana plants when analyzed in strains 85* and 85*ΔhrpF (Figure 6A). As dTALE-2ΔN is deleted in the T3S and translocation signal (Schreiber et al., 2015; Scheibner et al., 2016), the lack of GFP fluorescence suggests that the translocon-independent delivery of dTALE-2 depends on its passage through the T3S system. In contrast to dTALE-2ΔN, AvrBs31−50-dTALE-2ΔN induced GFP fluorescence when analyzed in strains 85*, 85*ΔhpaB and 85*ΔhrpF (Figure 6B). Notably, GFP fluorescence induced by strain 85* was reduced because of the induction of the non-host HR by strain 85* which leads to tissue necrosis (see above; Figure 5A). Our observations confirm the results obtained for the AvrBs31−50-AvrBs3Δ2 fusion (see above) and suggest that the N-terminal 50 amino acids of AvrBs3 contain a translocation signal, which can target dTALE-2 for translocon-independent translocation.
Figure 6

The N-terminal translocation signal is required for translocon-independent delivery of dTALE-2. (A) dTALE-2ΔN does not induce detectable GFP fluorescence when analyzed in strain 85*. Strains 85* and 85*ΔhrpF (ΔhrpF) ectopically expressing dTALE-2 or dTALE-2ΔN as indicated were infiltrated at a density of 8 × 108 CFU ml−1 into leaves of gfp-transgenic N. benthamiana plants. Fluorescence was photographed 7 dpi. Dashed lines indicate the infiltrated areas. For the analysis of protein synthesis, equal amounts of cell extracts were analyzed by immunoblotting using AvrBs3-specific antibodies. (B) Translocation assays with dTALE-2ΔN fusion proteins. Strains 85*, 85*ΔhpaB (ΔhpaB), 85*ΔhrpF (ΔhrpF), 85*ΔhrpFΔhpaB (ΔhrpFΔhpaB), and 85*ΔhrcN (ΔhrcN) ectopically expressing dTALE-2ΔN fusions as indicated were infiltrated at a density of 8 × 108 CFU ml−1 into leaves of gfp-transgenic N. benthamiana plants. Fluorescence was photographed 11 dpi. Dashed lines indicate the infiltrated areas. Fluorescence is reduced in plant tissue infiltrated with strain 85* because of the induction of the non-host HR. Protein synthesis was analyzed as described in (A).

The N-terminal translocation signal is required for translocon-independent delivery of dTALE-2. (A) dTALE-2ΔN does not induce detectable GFP fluorescence when analyzed in strain 85*. Strains 85* and 85*ΔhrpF (ΔhrpF) ectopically expressing dTALE-2 or dTALE-2ΔN as indicated were infiltrated at a density of 8 × 108 CFU ml−1 into leaves of gfp-transgenic N. benthamiana plants. Fluorescence was photographed 7 dpi. Dashed lines indicate the infiltrated areas. For the analysis of protein synthesis, equal amounts of cell extracts were analyzed by immunoblotting using AvrBs3-specific antibodies. (B) Translocation assays with dTALE-2ΔN fusion proteins. Strains 85*, 85*ΔhpaBhpaB), 85*ΔhrpF (ΔhrpF), 85*ΔhrpFΔhpaB (ΔhrpFΔhpaB), and 85*ΔhrcN (ΔhrcN) ectopically expressing dTALE-2ΔN fusions as indicated were infiltrated at a density of 8 × 108 CFU ml−1 into leaves of gfp-transgenic N. benthamiana plants. Fluorescence was photographed 11 dpi. Dashed lines indicate the infiltrated areas. Fluorescence is reduced in plant tissue infiltrated with strain 85* because of the induction of the non-host HR. Protein synthesis was analyzed as described in (A). Translocation assays with AvrBs31−30-dTALE-2ΔN revealed that the N-terminal 30 amino acids of AvrBs3 targeted dTALE-2ΔN for translocation in strain 85*ΔhpaB whereas no fluorescence was observed with the wild-type strain or the hrpF deletion mutant (Figure 6B). This confirms the finding that the N-terminal 30 amino acids of AvrBs3 contain a minimal translocation signal, which is recognized in the absence of HpaB. Reduced GFP fluorescence, however, was detected when AvrBs31−30-dTALE-2ΔN was analyzed in strain 85*ΔhrpFΔhpaB (Figure 6B). Thus, AvrBs31−30-dTALE-2ΔN can enter the plant cell in the absence of the translocon when delivered by the hpaB deletion mutant (Figure 6B). Taken together, these data suggest that the translocon-dependent and -independent delivery of AvrBs3 into plant cells depends on similar targeting signals.

Discussion

In the present study, we localized T3S and translocation signals in the N-terminal region of the TAL effector AvrBs3. The analysis of AvrBs3-reporter fusion proteins revealed that the N-terminal 10 amino acids of AvrBs3 are sufficient to target the reporter for T3S (Figure 1). This is in agreement with previous findings that amino acids 6–10 of T3S substrates often contain essential features of T3S signals as was also shown for the effector proteins XopE2 and XopJ from X. campestris pv. vesicatoria (Wang et al., 2013; Scheibner et al., 2017). The N-terminal 30 amino acids of AvrBs3 contain a minimal translocation signal, which promotes translocation of the reporter in the absence of the T3S chaperone HpaB but not in the wild-type strain (Figures 1, 2). Minimal translocation signals were previously also identified in the N-terminal regions of the effectors XopE2 and XopJ (Scheibner et al., 2017). Translocation of AvrBs3 in the wild-type strain depends on a signal in the N-terminal 50 amino acids. Notably, however, in contrast to the minimal translocation signal, the N-terminal 50 amino acids did not efficiently target the AvrBs3Δ2 reporter for translocation in the absence of HpaB (Figure 2), suggesting that the function of the minimal translocation signal depends on the neighboring protein regions. In contrast to AvrBs31−50-AvrBs3Δ2, however, the full-length AvrBs3 protein was efficiently translocated by both wild-type and hpaB mutant strains (Figures 1, 2). AvrBs3 likely contains additional signals outside the N-terminal region, which promote translocation in the absence of HpaB. Thus, the comparative analysis of AvrBs3Δ2 and AvrBs3ΔN63 fusion proteins revealed that the region between amino acids 64 and 152 promotes translocation of AvrBs3 in both wild-type and hpaB deletion mutant strains (Figures 3, 7A), suggesting that AvrBs3 contains multiple signals that control secretion and translocation in the presence and absence of HpaB. HpaB-independent translocation was already previously observed for other effectors and is indicative of a hierarchy in effector protein delivery (Büttner et al., 2006; Schulze et al., 2012). Thus, in X. campestris pv. vesicatoria, HpaB-independent effectors might be translocated during the early stages of the plant-pathogen interaction, prior to the activation of HpaB (Figure 7B). Differences in the timing of effector protein delivery were previously reported for animal-pathogenic bacteria but have not yet been investigated in plant-pathogenic bacteria (Enninga et al., 2005; Schlumberger et al., 2005; Mills et al., 2008; Van Engelenburg and Palmer, 2008; Winnen et al., 2008). It is also still unknown whether the timing of effector protein translocation is controlled by the N-terminal export signals.
Figure 7

Overview on type III export signals in AvrBs3 and model of the T3S hierarchy in X. campestris pv. vesicatoria. (A) Overview on secretion and translocation signals in AvrBs3. N-terminal signals are indicated, numbers refer to amino acid positions. NLS, nuclear localization signal; AAD, acidic activation domain. (B) Predicted T3S hierarchy in X. campestris pv. vesicatoria. After formation of the membrane-spanning part of the secretion apparatus, the T3S pilus is assembled. HpaA presumably associates with the T3S chaperone HpaB and thus inactivates HpaB to prevent secretion of effector proteins prior to the insertion of the translocon. As suggested by data in the present study, AvrBs3 might already enter the plant cell in the absence of a functional translocon (indicated by a dashed arrow). A possible translocon-independent entry of other effectors into the plant cell (indicated by a question mark) remains to be investigated. A predicted switch in T3S substrate specificity after pilus formation leads to the secretion of translocon proteins and thus to the assembly of the T3S translocon in the plant plasma membrane. While HpaB is still inactive during this stage of the T3S process, HpaB-independent effectors including AvrBs3 and non-effectors such as XopA and HrpF are already translocated. However, when compared to the wild-type strain, hpaB mutants presumably translocate reduced amounts of effectors (indicated by a dashed arrow; Büttner et al., 2006; Schulze et al., 2012). After insertion of the translocon, a yet unknown signal triggers the translocation of HpaA. This leads to the liberation of HpaB and thus activates the translocation of HpaB-dependent effectors. AAD, acidic activation domain; IM, inner membrane; NLS, nuclear localization signal; OM, outer membrane; PM, plant plasma membrane.

Overview on type III export signals in AvrBs3 and model of the T3S hierarchy in X. campestris pv. vesicatoria. (A) Overview on secretion and translocation signals in AvrBs3. N-terminal signals are indicated, numbers refer to amino acid positions. NLS, nuclear localization signal; AAD, acidic activation domain. (B) Predicted T3S hierarchy in X. campestris pv. vesicatoria. After formation of the membrane-spanning part of the secretion apparatus, the T3S pilus is assembled. HpaA presumably associates with the T3S chaperone HpaB and thus inactivates HpaB to prevent secretion of effector proteins prior to the insertion of the translocon. As suggested by data in the present study, AvrBs3 might already enter the plant cell in the absence of a functional translocon (indicated by a dashed arrow). A possible translocon-independent entry of other effectors into the plant cell (indicated by a question mark) remains to be investigated. A predicted switch in T3S substrate specificity after pilus formation leads to the secretion of translocon proteins and thus to the assembly of the T3S translocon in the plant plasma membrane. While HpaB is still inactive during this stage of the T3S process, HpaB-independent effectors including AvrBs3 and non-effectors such as XopA and HrpF are already translocated. However, when compared to the wild-type strain, hpaB mutants presumably translocate reduced amounts of effectors (indicated by a dashed arrow; Büttner et al., 2006; Schulze et al., 2012). After insertion of the translocon, a yet unknown signal triggers the translocation of HpaA. This leads to the liberation of HpaB and thus activates the translocation of HpaB-dependent effectors. AAD, acidic activation domain; IM, inner membrane; NLS, nuclear localization signal; OM, outer membrane; PM, plant plasma membrane. Comparative sequence analysis revealed that the N-terminal region of AvrBs3 does not share homology with corresponding regions of other effector proteins, indicating that T3S and translocation signals are not conserved in T3S substrates from X. campestris pv. vesicatoria. Similar findings were previously reported for T3S substrates from other plant- and animal-pathogenic bacteria (Schechter et al., 2004; Arnold et al., 2009; Löwer and Schneider, 2009; Samudrala et al., 2009; Buchko et al., 2010; McDermott et al., 2011). The analysis of the amino acid composition of AvrBs3 revealed that the N-terminal 50 amino acids of AvrBs3 contain slightly higher levels of arginine and aspartate residues than the remainder of the protein (Figure S3). Furthermore, the N-terminal 50 amino acids of AvrBs3 and the region between amino acids 64 and 152, which both promote translocation, contain increased amounts of proline residues (Figure S3). Notably, elevated proline levels are also present in the N-terminal regions of the effectors XopE2 and XopJ, which contain T3S and minimal translocation signals (Scheibner et al., 2017). The contribution of N-terminal proline, arginine and aspartate residues to the translocation of AvrBs3 remains to be investigated in future studies. The precise roles of N-terminal T3S and translocation signals as well as the molecular mechanisms underlying their recognition are still largely unknown in both plant- and animal-pathogenic bacteria. Potential docking sites for type III effectors in X. campestris pv. vesicatoria include the cytoplasmic putative C ring protein HrcQ and the cytoplasmic domain of the inner membrane protein HrcV, which both interact with T3S substrates in vitro (Lorenz et al., 2012; Hartmann and Büttner, 2013). In case of AvrBs3, however, the N-terminal protein region, which contains the T3S and translocation signal, is dispensable for the interaction with HrcQ and the cytoplasmic domain of HrcV (Lorenz et al., 2012; Hartmann and Büttner, 2013). Similar findings were observed for N-terminal deletion derivatives of XopE2 and XopJ, which interact with HrcQ (Scheibner et al., 2017). The specific recognition of the N-terminal export signal might, therefore, depend on additional components of the T3S system or might occur after the initial docking of T3S substrates to the secretion apparatus. Given the anticipated essential role of the translocon for type III-dependent protein translocation, it was assumed that the insertion of the translocon precedes effector protein translocation. In agreement with this hypothesis, previous studies suggested that the translocation of effector-reporter fusions as well as the in situ detection of AvrBs3 in plant nuclei is abolished in HrpF-deficient strains (Büttner et al., 2002; Szurek et al., 2002; Hotson et al., 2003; Thieme et al., 2007; Jiang et al., 2009; Teper et al., 2016). In the present study, however, we observed that AvrBs3 enters plant cells even in the absence of the translocon protein HrpF and the secreted XopA protein, which might contribute to effector protein translocation (Figure 4; Noël et al., 2002). Translocon-independent entry of AvrBs3 into plant cells was significantly reduced when compared to the translocation by the wild-type strain and only led to a browning of the infected leaf tissue in Bs3 pepper plants, suggesting a much weaker HR. This was accompanied by a detectable increase in the Bs3 transcript level (Figure 4) and has not yet been investigated for the wild-type AvrBs3 protein in previous studies. In Bs3-transgenic N. benthamiana plants, AvrBs3 induces a macroscopically visible Bs3-dependent HR even when delivered by hrpF deletion mutants (Figure 5). This was not observed in Bs3 pepper plants and might be caused by an increased activation of Bs3 expression, an increased HR induction or a more efficient translocon-independent entry of AvrBs3 in Bs3-transgenic N. benthamiana plants. HrpF-independent entry into plant cells was confirmed for dTALE-2 in gfp-transgenic N. benthamiana plants. No detectable fluorescence was observed with mutants lacking the T3S ATPase HrcN or the pilus protein HrpE, suggesting that the HrpF-independent delivery of AvrBs3 depends on the T3S system (Figure 5). Given that the transport of AvrBs3 through the T3S pilus is essential for its passage across the plant cell wall, we did not investigate a possible autonomous entry of recombinant AvrBs3 into plant cells. The mechanisms underlying the HrpF-independent passage of AvrBs3 into plant cells as well as its biological significance remain to be elucidated. Notably, translocon-independent transport into eukaryotic cells was previously reported for effector proteins from animal-pathogenic bacteria including SspH1 from Salmonella spp. and YopM from Yersinia spp. (Rüter et al., 2010; Scharnert et al., 2013; Lubos et al., 2014). Both proteins cross the host plasma membrane when added as recombinant proteins to cultured cells. Autonomously translocating effectors present a novel class of cell-penetrating peptides (CPPs), which are often used as vehicles for the transport of cargo molecules into target cells (Rüter and Schmidt, 2017). CPPs include basic/amphiphilic or hydrophobic peptides which consist of usually less than 30 amino acids and autonomously translocate across biological membranes, even when present as fusion partner of a large cargo protein (Takeuchi and Futaki, 2016; Radis-Baptista et al., 2017). CPPs are either directly transported across the membrane or are delivered by endocytosis (Scharnert et al., 2013; Radis-Baptista et al., 2017). Both transport pathways were observed for YopM from Yersinia spp. (Scharnert et al., 2013). Our preliminary infection experiments with X. campestris pv. vesicatoria translocon mutants in the presence of the endocytosis inhibitors bafilomycin A1, cytochalasin D, or wortmannin did not reveal a contribution of endocytosis to the delivery of AvrBs3. It, therefore, remains to be investigated whether AvrBs3 can directly cross biological membranes. The direct transport of CPPs across the membrane presumably involves the interaction of positively charged amino acids with negatively charged lipids of the membrane and was for instance reported for arginine-rich CPPs (Scharnert et al., 2013; Rüter and Schmidt, 2017). Interestingly, the N-terminal region of AvrBs3 is enriched in arginine residues (Figure S3), however, AvrBs3 does not contain sequence motifs with homology to typical CPP sequences or prolonged stretches of positively charged amino acids, which could mediate the interaction with membranes (Radis-Baptista et al., 2017). In future studies, we will investigate which protein regions of AvrBs3 are required for the translocon-independent entry into plant cells.

Author contributions

FS, DB, and SM conceived the study. FS performed secretion assays, infection studies, immunoblot analyses and RT-PCR experiments. DB performed infection assays and immunoblot analyses. All authors analyzed the data. DB and FS wrote the manuscript. All authors read and approved the final manuscript.

Conflict of interest statement

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
  101 in total

Review 1.  The type III secretion system tip complex and translocon.

Authors:  C A Mueller; P Broz; G R Cornelis
Journal:  Mol Microbiol       Date:  2008-04-08       Impact factor: 3.501

2.  Identification of novel Xanthomonas euvesicatoria type III effector proteins by a machine-learning approach.

Authors:  Doron Teper; David Burstein; Dor Salomon; Michael Gershovitz; Tal Pupko; Guido Sessa
Journal:  Mol Plant Pathol       Date:  2015-08-15       Impact factor: 5.663

3.  Analysis of new type III effectors from Xanthomonas uncovers XopB and XopS as suppressors of plant immunity.

Authors:  Sebastian Schulze; Sabine Kay; Daniela Büttner; Monique Egler; Lennart Eschen-Lippold; Gerd Hause; Antje Krüger; Justin Lee; Oliver Müller; Dierk Scheel; Robert Szczesny; Frank Thieme; Ulla Bonas
Journal:  New Phytol       Date:  2012-06-27       Impact factor: 10.151

Review 4.  Cell-Penetrating Bacterial Effector Proteins: Better Tools than Targets.

Authors:  Christian Rüter; M Alexander Schmidt
Journal:  Trends Biotechnol       Date:  2016-09-01       Impact factor: 19.536

5.  Genomewide identification of proteins secreted by the Hrp type III protein secretion system of Pseudomonas syringae pv. tomato DC3000.

Authors:  Tanja Petnicki-Ocwieja; David J Schneider; Vincent C Tam; Scott T Chancey; Libo Shan; Yashitola Jamir; Lisa M Schechter; Misty D Janes; C Robin Buell; Xiaoyan Tang; Alan Collmer; James R Alfano
Journal:  Proc Natl Acad Sci U S A       Date:  2002-05-28       Impact factor: 11.205

6.  Translocation of surface-localized effectors in type III secretion.

Authors:  Karen Akopyan; Tomas Edgren; Helen Wang-Edgren; Roland Rosqvist; Anna Fahlgren; Hans Wolf-Watz; Maria Fallman
Journal:  Proc Natl Acad Sci U S A       Date:  2011-01-10       Impact factor: 11.205

7.  New type III effectors from Xanthomonas campestris pv. vesicatoria trigger plant reactions dependent on a conserved N-myristoylation motif.

Authors:  Frank Thieme; Robert Szczesny; Alexander Urban; Oliver Kirchner; Gerd Hause; Ulla Bonas
Journal:  Mol Plant Microbe Interact       Date:  2007-10       Impact factor: 4.171

8.  Nonpolar mutagenesis of the ipa genes defines IpaB, IpaC, and IpaD as effectors of Shigella flexneri entry into epithelial cells.

Authors:  R Ménard; P J Sansonetti; C Parsot
Journal:  J Bacteriol       Date:  1993-09       Impact factor: 3.490

9.  Functional characterization of the type III secretion ATPase HrcN from the plant pathogen Xanthomonas campestris pv. vesicatoria.

Authors:  Christian Lorenz; Daniela Büttner
Journal:  J Bacteriol       Date:  2008-12-29       Impact factor: 3.490

10.  Xanthomonas type III effector XopD targets SUMO-conjugated proteins in planta.

Authors:  Andrew Hotson; Renee Chosed; Hongjun Shu; Kim Orth; Mary Beth Mudgett
Journal:  Mol Microbiol       Date:  2003-10       Impact factor: 3.501

View more
  11 in total

1.  Split-TALE: A TALE-Based Two-Component System for Synthetic Biology Applications in Planta.

Authors:  Tom Schreiber; Anja Prange; Tina Hoppe; Alain Tissier
Journal:  Plant Physiol       Date:  2019-01-14       Impact factor: 8.340

2.  Bacterial LPX motif-harboring virulence factors constitute a species-spanning family of cell-penetrating effectors.

Authors:  Stefanie Norkowski; Britta Körner; Lilo Greune; Anne-Sophie Stolle; Marie-Luise Lubos; Philip R Hardwidge; M Alexander Schmidt; Christian Rüter
Journal:  Cell Mol Life Sci       Date:  2017-12-28       Impact factor: 9.261

3.  Real-time monitoring of translocation of selected type-III effectors from Xanthomonas oryzae pv. oryzae into rice cells.

Authors:  Huijie Bian; Liyuan Zhang; Lei Chen; Wenzhan Wang; Hongtao Ji; Hansong Dong
Journal:  J Biosci       Date:  2019-09       Impact factor: 1.826

4.  Plant Aquaporins in Infection by and Immunity Against Pathogens - A Critical Review.

Authors:  Liyuan Zhang; Lei Chen; Hansong Dong
Journal:  Front Plant Sci       Date:  2019-05-28       Impact factor: 5.753

5.  Rice aquaporin PIP1;3 and harpin Hpa1 of bacterial blight pathogen cooperate in a type III effector translocation.

Authors:  Ping Li; Liyuan Zhang; Xuyan Mo; Hongtao Ji; Huijie Bian; Yiqun Hu; Taha Majid; Juying Long; Hao Pang; Yuan Tao; Jinbiao Ma; Hansong Dong
Journal:  J Exp Bot       Date:  2019-06-28       Impact factor: 6.992

6.  Show me your secret(ed) weapons: a multifaceted approach reveals a wide arsenal of type III-secreted effectors in the cucurbit pathogenic bacterium Acidovorax citrulli and novel effectors in the Acidovorax genus.

Authors:  Irene Jiménez-Guerrero; Francisco Pérez-Montaño; Gustavo Mateus Da Silva; Naama Wagner; Dafna Shkedy; Mei Zhao; Lorena Pizarro; Maya Bar; Ron Walcott; Guido Sessa; Tal Pupko; Saul Burdman
Journal:  Mol Plant Pathol       Date:  2019-10-23       Impact factor: 5.663

7.  The C-terminal domain of the type III secretion chaperone HpaB contributes to dissociation of chaperone-effector complex in Xanthomonas campestris pv. campestris.

Authors:  Yong-Liang Gan; Li-Yan Yang; Li-Chao Yang; Wan-Lian Li; Xue-Lian Liang; Wei Jiang; Guo-Feng Jiang; Xiao-Hong Hang; Mei Yang; Ji-Liang Tang; Bo-Le Jiang
Journal:  PLoS One       Date:  2021-01-28       Impact factor: 3.240

8.  Two DNA Methyltransferases for Site-Specific 6mA and 5mC DNA Modification in Xanthomonas euvesicatoria.

Authors:  Hye-Jee Park; Hoon Je Seong; Jongchan Lee; Lynn Heo; Woo Jun Sul; Sang-Wook Han
Journal:  Front Plant Sci       Date:  2021-03-24       Impact factor: 5.753

9.  Recognition of a translocation motif in the regulator HpaA from Xanthomonas euvesicatoria is controlled by the type III secretion chaperone HpaB.

Authors:  Sabine Drehkopf; Christian Otten; Daniela Büttner
Journal:  Front Plant Sci       Date:  2022-07-28       Impact factor: 6.627

10.  A centenary for bacterial spot of tomato and pepper.

Authors:  Ebrahim Osdaghi; Jeffrey B Jones; Anuj Sharma; Erica M Goss; Peter Abrahamian; Eric A Newberry; Neha Potnis; Renato Carvalho; Manoj Choudhary; Mathews L Paret; Sujan Timilsina; Gary E Vallad
Journal:  Mol Plant Pathol       Date:  2021-09-02       Impact factor: 5.663

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.