Literature DB >> 29148370

Phylogenetic Characterization of Crimean-Congo Hemorrhagic Fever Virus, Spain.

Eva Ramírez de Arellano, Lourdes Hernández, M José Goyanes, Marta Arsuaga, Ana Fernández Cruz, Anabel Negredo, María Paz Sánchez-Seco.   

Abstract

Two cases of Crimean-Congo hemorrhagic fever were reported in Spain during 2016. We obtained the virus from a patient sample and characterized its full genomic sequence. Phylogenetic analysis indicated that the virus corresponds to the African genotype III, which includes viruses previously found in West and South Africa.

Entities:  

Keywords:  Africa; Bunyaviridae hyalomma; CCFHV; Crimean Congo hemorrhagic fever; Spain; complete genome; nairovirus; phylogeny; ticks; vector-borne infections; viruses; zoonoses

Mesh:

Substances:

Year:  2017        PMID: 29148370      PMCID: PMC5708233          DOI: 10.3201/eid2312.171002

Source DB:  PubMed          Journal:  Emerg Infect Dis        ISSN: 1080-6040            Impact factor:   6.883


Crimean-Congo hemorrhagic fever (CCHF) is a severe disease transmitted to humans mainly by ticks, primarily of Hyalomma spp. This zoonotic disease is caused by CCHF virus (CCHFV), a nairovirus in the family Bunyaviridae, which was detected first in Crimea in 1944 and 25 years later in the Democratic Republic of the Congo. Since the beginning of the 21st century, CCHFV has been spreading from disease-endemic areas to new regions previously considered free of the disease, particularly in areas where Hyalomma spp. ticks are present. In nature, CCHFV usually circulates between asymptomatic animals and ticks in an enzootic cycle. CCHFV has a negative-sense and tripartite RNA genome (small [S], medium [M], and large [L] segments) with high genetic diversity. The sequences of the S segment, which is the most conserved at the nucleotide level, could be distributed in 6 lineages (–). Each genetic lineage has been linked to geographic regions in Africa, the Middle East, Asia, and Europe, where Hyalomma spp. ticks are present (). Genotypes I, II, and III have been described in Africa; genotype IV in Asia; and genotypes V and VI in Europe. However, strains have moved between geographic regions; migrating birds, unregulated wildlife trade, livestock import and export, and a global movement of humans could have dispersed the virus or CCHFV-infected ticks (). In western Europe, the presence of the virus had only been detected indirectly by means of serologic methods in the serum of 2 people from southern Portugal (). However, genotype III CCHFV was detected in ticks from deer captured in western Spain in 2010 and ticks from birds migrating from Morocco in 2013 (,). No cases among humans in Spain had been reported until 2016, when 2 autochthonous cases were diagnosed (). Here, we report the complete genomic sequence of the virus from 1 of these case-patients and show the phylogenetic relationships among the 3 segments.

The Study

We previously detected CCHFV in serum samples from the 2 patients in Spain with autochthonous CCHV (); the index case-patient died. For this study, we obtained viral RNA (3.6 × 107 copies/mL) from the secondary case-patient in a sample taken 4 days after onset of symptoms by using the QIAamp viral RNA Mini kit (QIAGEN, Hilden, Germany). We then amplified the virus in a single-step reverse-transcription PCR by using the SuperScript III One-Step RT-PCR system with the Platinum Taq High Fidelity DNA Polymerase kit (Invitrogen Life Technologies, Barcelona, Spain) with overlapping primers throughout the complete genome (Table). PCR conditions were amplification at 52.5°C for 30 min, 94°C for 2 min, and then 40 cycles at 94°C for 15 s, 48°C –55°C for 30 s, and 68°C for 1 min/kb, with a final extension cycle at 68°C for 5 min. We designed primers for each segment in most conserved regions after aligning available CCHFV sequences from all genotypes retrieved from GenBank (Table). We directly sequenced purified amplicons by using additional internal primers (data not shown). We assembled and analyzed the consensus sequence of each segment by using SeqMan Pro from the Lasergene Suite 12 (DNASTAR Inc., Madison, WI, USA). To get complete finished genomes, we used a hybrid-capture method as described by Blackley et al. () by using probes designed against the CCHFV sequences obtained from amplicon sequencing.
Table

RT-PCR primers used for generation of amplicons used for sequencing CCHFV full genome from strains isolated from patient samples in Spain, 2016*

Primer pair
5′ → 3′ sequence
5′ → 3′ position relative to reference strain AB1-2009
Amplified segment, kb
Temperature, °C†
CRCON+1RWAAYGGRCTTRTGGAYACYTTCAC123–147 S, 1.450.5
CRCON1R-S
TCTCAAAGATAYCGTTGCCGCAC
1,651–1,673


CRCON1F-MTCTCAAAGAAAATACTTGCGGC1–22 M, 2.348
CRCON4R-MGCATYTCAGCATCTATTGCATT2,326–22,347
CRCONF4F-MTTGTAGAYCAAAGACTRGGCAG1,775–1,796M, 2.148
CRCON6R-M
GCCYGCTTCAATCAAGCTACA
3,829-3,849


CRCON6F-MTCAATTGAGGCACCATGGGG3,280–3,299M, 2.150
CRCON8R-M
TCTCAAAGATATAGTGGCGGCA
5,348–5,369


CRCON1F-LTCTCAAAGATATCAATCCCCCC1–22L, 2.248
CRCON3R-L
AGTGTCGAAAATGTRCAAATCTC
2,202--2224


CRCON3F-LCCTGAAAGTGACCTCACCCGC1,562–1,582L, 3.155
CRCON6R-L
TTGGCATGCTTGCAGGGCTTAG
4,656–4,677


CRCON7F-LTGCTTGCAGGGCTTAGTAGGCT4,661–4,682L, 2.350.5
CRCON9R-L
TCATGCATGCAACCACTGAAAT
6,948-6,969


CCHF-L2FGAAGAGCTATATGACATAAGGC6,137–6,158L, 1.648
CCHF-L1R
TTGGCACTATCTTTCATTTGAC
7,752–7,773


CRCON10F-LGGTAGTTCAGATGATTACGCAAA7,616–7,638L, 1.448
CRCON10R-L
CCTGTTAATTGTTTGCCACAA
9,019–9,039


CRCON7200FATGCAACAGGTTCTGAAAAATG7,199–7,220L, 3.548
CRCON11R-L
ATGCTCCTAGTGATGCCATAATG
10,743–10,765


CRCON12F-LTCTTTTGAAGGTGAAGCATCTTG10,585–10,607L, 1.648
CCHF-L2R
TCTCAAAGAAATCGTTCCCCCCAC
12,149–12,172


*F, forward; L, large segment; M, medium segment; R, reverse; RT-PCR, reverse transcription PCR; S, small segment.
†Melting temperature used.
To characterize the complete CCHFV genome, we performed a phylogenetic analysis of the full S, M, and L segments (Figure). The 3 segments were aligned by using ClustalW in MEGA 5.2 (http://www.megasoftware.net) and representative available CCHFV sequences from GenBank of all genotypes. We generated a phylogenetic tree by using neighbor-joining algorithms and analyzed 1,000 replicates for bootstrap testing. GenBank accession numbers for sequences used in this study are MF287636 for the S fragment, MF287637 for the M fragment, and MF287638 for the L fragment.
Figure

Phylogenetic analysis of Crimean-Congo hemorrhagic fever virus from patient in Spain, 2016, compared with reference sequences. A) Small segment (1,450 bp); B) medium segment (4,497 bp); C) large segment (11,829 bp). Trees were generated with the neighbor-joining method with Kimura 2-parameter distances by using MEGA version 5.1 (http://www.megasoftware.net). Bootstrap confidence limits were calculated on the basis of 1,000 replicates; numbers on branches indicate bootstrap results. Triangles indicate newly sequenced strain from Spain described in this article; other sequences are named by GenBank accession number, strain, geographic origin, and sampling year. Genotypes at right are named according to Carrol et al. (); brackets indicate equivalent group nomenclature according to Chamberlain et al. (). Roman numerals indicate geographic locations: I, West Africa (Africa 1); II, Central Africa (Africa 2); III, South and West Africa (Africa 3); IV, Middle East/Asia, divided into 2 groups, Asia 1 and Asia 2 (); V, Europe/Turkey (Europe 1); VI, Greece (Europe 2). Scale bars indicate nucleotide substitutions per site.

Phylogenetic analysis of Crimean-Congo hemorrhagic fever virus from patient in Spain, 2016, compared with reference sequences. A) Small segment (1,450 bp); B) medium segment (4,497 bp); C) large segment (11,829 bp). Trees were generated with the neighbor-joining method with Kimura 2-parameter distances by using MEGA version 5.1 (http://www.megasoftware.net). Bootstrap confidence limits were calculated on the basis of 1,000 replicates; numbers on branches indicate bootstrap results. Triangles indicate newly sequenced strain from Spain described in this article; other sequences are named by GenBank accession number, strain, geographic origin, and sampling year. Genotypes at right are named according to Carrol et al. (); brackets indicate equivalent group nomenclature according to Chamberlain et al. (). Roman numerals indicate geographic locations: I, West Africa (Africa 1); II, Central Africa (Africa 2); III, South and West Africa (Africa 3); IV, Middle East/Asia, divided into 2 groups, Asia 1 and Asia 2 (); V, Europe/Turkey (Europe 1); VI, Greece (Europe 2). Scale bars indicate nucleotide substitutions per site. The nucleotide sequence of the different CCHFV segments from the infected patient we analyzed in this study showed 99% identity with the Sudan AB1–2009 CCHFV strain () in S, M, and L segments (GenBank accession nos. HQ378179.1, HQ378187.1, and HQ378183.1, respectively) (Figure) and were grouped within genotype III (Africa 3). CCHFV found in ticks from Spain in 2010 and from birds from Morocco in 2011 also clustered in this group (,). In addition, no reassortant segment has been found in the analysis of the full genome, even though reassortant strains have been described in this genotype ().

Conclusions

The results of the sequence analysis we describe corroborate our previous results (), obtained by analyzing a small fragment in the S segment, showing that CCHFV from genotype III (Africa III) is circulating in southwestern Europe. CCHFV circulating in Spain caused 2 autochthonous cases that resulted in the death of the index case-patient and a serious illness in the second case-patient, providing evidence of its pathogenicity. The risk for infection in Spain is considered low, but human infection caused by the bite of an infected tick has occurred 6 years after the virus was discovered in ticks (). Because the virus is circulating in Spain, additional studies will be required to establish the distribution of the virus in this country.
  13 in total

Review 1.  The epidemiology of tick-borne Crimean-Congo hemorrhagic fever in Asia, Europe, and Africa.

Authors:  H Hoogstraal
Journal:  J Med Entomol       Date:  1979-05-22       Impact factor: 2.278

2.  Co-evolutionary patterns of variation in small and large RNA segments of Crimean-Congo hemorrhagic fever virus.

Authors:  John Chamberlain; Nicola Cook; Graham Lloyd; Valerie Mioulet; Howard Tolley; Roger Hewson
Journal:  J Gen Virol       Date:  2005-12       Impact factor: 3.891

3.  Crimean-Congo hemorrhagic fever virus genomics and global diversity.

Authors:  Varough M Deyde; Marina L Khristova; Pierre E Rollin; Thomas G Ksiazek; Stuart T Nichol
Journal:  J Virol       Date:  2006-09       Impact factor: 5.103

4.  Evolution of Crimean-Congo Hemorrhagic Fever virus.

Authors:  Vassiliki Anagnostou; Anna Papa
Journal:  Infect Genet Evol       Date:  2009-06-26       Impact factor: 3.342

5.  Autochthonous Crimean-Congo Hemorrhagic Fever in Spain.

Authors:  Anabel Negredo; Fernando de la Calle-Prieto; Eduardo Palencia-Herrejón; Marta Mora-Rillo; Jenaro Astray-Mochales; María P Sánchez-Seco; Esther Bermejo Lopez; Javier Menárguez; Ana Fernández-Cruz; Beatriz Sánchez-Artola; Elena Keough-Delgado; Eva Ramírez de Arellano; Fátima Lasala; Jakob Milla; Jose L Fraile; Maria Ordobás Gavín; Amalia Martinez de la Gándara; Lorenzo López Perez; Domingo Diaz-Diaz; M Aurora López-García; Pilar Delgado-Jimenez; Alejandro Martín-Quirós; Elena Trigo; Juan C Figueira; Jesús Manzanares; Elena Rodriguez-Baena; Luis Garcia-Comas; Olaia Rodríguez-Fraga; Nicolás García-Arenzana; Maria V Fernández-Díaz; Victor M Cornejo; Petra Emmerich; Jonas Schmidt-Chanasit; Jose R Arribas
Journal:  N Engl J Med       Date:  2017-07-13       Impact factor: 91.245

Review 6.  Crimean-Congo hemorrhagic fever: history, epidemiology, pathogenesis, clinical syndrome and genetic diversity.

Authors:  Dennis A Bente; Naomi L Forrester; Douglas M Watts; Alexander J McAuley; Chris A Whitehouse; Mike Bray
Journal:  Antiviral Res       Date:  2013-07-29       Impact factor: 5.970

7.  Antibodies to Congo-Crimean haemorrhagic fever, Dhori, Thogoto and Bhanja viruses in southern Portugal.

Authors:  A R Filipe; C H Calisher; J Lazuick
Journal:  Acta Virol       Date:  1985-07       Impact factor: 1.162

8.  Crimean-Congo hemorrhagic fever virus in ticks, Southwestern Europe, 2010.

Authors:  Agustín Estrada-Peña; Ana M Palomar; Paula Santibáñez; Nely Sánchez; Miguel A Habela; Aránzazu Portillo; Lourdes Romero; José A Oteo
Journal:  Emerg Infect Dis       Date:  2012-01       Impact factor: 6.883

9.  Reduced evolutionary rate in reemerged Ebola virus transmission chains.

Authors:  David J Blackley; Michael R Wiley; Jason T Ladner; Mosoka Fallah; Terrence Lo; Merle L Gilbert; Christopher Gregory; Jonathan D'ambrozio; Stewart Coulter; Suzanne Mate; Zephaniah Balogun; Jeffrey Kugelman; William Nwachukwu; Karla Prieto; Adolphus Yeiah; Fred Amegashie; Brian Kearney; Meagan Wisniewski; John Saindon; Gary Schroth; Lawrence Fakoli; Joseph W Diclaro; Jens H Kuhn; Lisa E Hensley; Peter B Jahrling; Ute Ströher; Stuart T Nichol; Moses Massaquoi; Francis Kateh; Peter Clement; Alex Gasasira; Fatorma Bolay; Stephan S Monroe; Andrew Rambaut; Mariano Sanchez-Lockhart; A Scott Laney; Tolbert Nyenswah; Athalia Christie; Gustavo Palacios
Journal:  Sci Adv       Date:  2016-04-29       Impact factor: 14.136

10.  Molecular epidemiology of Crimean-Congo haemorrhagic fever virus in India.

Authors:  P Singh; M Chhabra; P Sharma; R Jaiswal; G Singh; V Mittal; A Rai; S Venkatesh
Journal:  Epidemiol Infect       Date:  2016-08-15       Impact factor: 4.434

View more
  10 in total

1.  Hazara Nairovirus Requires COPI Components in both Arf1-Dependent and Arf1-Independent Stages of Its Replication Cycle.

Authors:  J Fuller; B Álvarez-Rodríguez; E J A A Todd; J Mankouri; R Hewson; J N Barr
Journal:  J Virol       Date:  2020-08-17       Impact factor: 5.103

2.  Survey of Crimean-Congo Hemorrhagic Fever Enzootic Focus, Spain, 2011-2015.

Authors:  Ana Negredo; Miguel Ángel Habela; Eva Ramírez de Arellano; Francisco Diez; Fátima Lasala; Pablo López; Ana Sarriá; Nuria Labiod; Rafael Calero-Bernal; Miguel Arenas; Antonio Tenorio; Agustín Estrada-Peña; Maria Paz Sánchez-Seco
Journal:  Emerg Infect Dis       Date:  2019-06       Impact factor: 6.883

3.  Crimean-Congo Hemorrhagic Fever Virus Genome in Tick from Migratory Bird, Italy.

Authors:  Elisa Mancuso; Luciano Toma; Andrea Polci; Silvio G d'Alessio; Marco Di Luca; Massimiliano Orsini; Marco Di Domenico; Maurilia Marcacci; Giuseppe Mancini; Fernando Spina; Maria Goffredo; Federica Monaco
Journal:  Emerg Infect Dis       Date:  2019-07       Impact factor: 6.883

4.  Co-Delivery Effect of CD24 on the Immunogenicity and Lethal Challenge Protection of a DNA Vector Expressing Nucleocapsid Protein of Crimean Congo Hemorrhagic Fever Virus.

Authors:  Touraj Aligholipour Farzani; Alireza Hanifehnezhad; Katalin Földes; Koray Ergünay; Erkan Yilmaz; Hiba Hashim Mohamed Ali; Aykut Ozkul
Journal:  Viruses       Date:  2019-01-17       Impact factor: 5.048

5.  Detection of Crimean Congo haemorrhagic fever virus in North-eastern Senegal, Bokidiawé 2019.

Authors:  Idrissa Dieng; Mamadou Aliou Barry; Moussa Moise Diagne; Boly Diop; Mamadou Ndiaye; Martin Faye; Marie Henriette Dior Ndione; Mame Malick Dieng; Abdoulaye Bousso; Gamou Fall; Cheikh Loucoubar; Amadou Alpha Sall; Oumar Faye; Ousmane Faye
Journal:  Emerg Microbes Infect       Date:  2020-12       Impact factor: 7.163

Review 6.  Crimean-Congo Hemorrhagic Fever Virus (CCHFV): A Silent but Widespread Threat.

Authors:  Paul A Kuehnert; Christopher P Stefan; Catherine V Badger; Keersten M Ricks
Journal:  Curr Trop Med Rep       Date:  2021-03-16

7.  Fatal Case of Crimean-Congo Hemorrhagic Fever Caused by Reassortant Virus, Spain, 2018.

Authors:  Anabel Negredo; Rafael Sánchez-Arroyo; Francisco Díez-Fuertes; Fernando de Ory; Marco Antonio Budiño; Ana Vázquez; Ángeles Garcinuño; Lourdes Hernández; César de la Hoz González; Almudena Gutiérrez-Arroyo; Carmen Grande; Paz Sánchez-Seco
Journal:  Emerg Infect Dis       Date:  2021-04       Impact factor: 6.883

8.  Widespread Detection of Multiple Strains of Crimean-Congo Hemorrhagic Fever Virus in Ticks, Spain.

Authors:  María Paz Sánchez-Seco; María José Sierra; Agustín Estrada-Peña; Félix Valcárcel; Ricardo Molina; Eva Ramírez de Arellano; Angeles Sonia Olmeda; Lucía García San Miguel; Maribel Jiménez; Luis J Romero; Anabel Negredo
Journal:  Emerg Infect Dis       Date:  2021-02       Impact factor: 6.883

9.  Evidence of Prolonged Crimean-Congo Hemorrhagic Fever Virus Endemicity by Retrospective Serosurvey, Eastern Spain.

Authors:  Laura Carrera-Faja; Jesús Cardells; Lola Pailler-García; Víctor Lizana; Gemma Alfaro-Deval; Johan Espunyes; Sebastian Napp; Oscar Cabezón
Journal:  Emerg Infect Dis       Date:  2022-05       Impact factor: 6.883

Review 10.  Epidemiological Aspects of Crimean-Congo Hemorrhagic Fever in Western Europe: What about the Future?

Authors:  Aránzazu Portillo; Ana M Palomar; Paula Santibáñez; José A Oteo
Journal:  Microorganisms       Date:  2021-03-21
  10 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.