Literature DB >> 29144234

LRP1 integrates murine macrophage cholesterol homeostasis and inflammatory responses in atherosclerosis.

Xunde Xian1, Yinyuan Ding1,2, Marco Dieckmann1, Li Zhou1, Florian Plattner3,4, Mingxia Liu5, John S Parks5, Robert E Hammer6, Philippe Boucher7, Shirling Tsai8,9, Joachim Herz1,4,10,11.   

Abstract

Low-density lipoprotein receptor-related protein 1 (LRP1) is a multifunctional cell surface receptor with diverse physiological roles, ranging from cellular uptake of lipoproteins and other cargo by endocytosis to sensor of the extracellular environment and integrator of a wide range of signaling mechanisms. As a chylomicron remnant receptor, LRP1 controls systemic lipid metabolism in concert with the LDL receptor in the liver, whereas in smooth muscle cells (SMC) LRP1 functions as a co-receptor for TGFβ and PDGFRβ in reverse cholesterol transport and the maintenance of vascular wall integrity. Here we used a knockin mouse model to uncover a novel atheroprotective role for LRP1 in macrophages where tyrosine phosphorylation of an NPxY motif in its intracellular domain initiates a signaling cascade along an LRP1/SHC1/PI3K/AKT/PPARγ/LXR axis to regulate and integrate cellular cholesterol homeostasis through the expression of the major cholesterol exporter ABCA1 with apoptotic cell removal and inflammatory responses.

Entities:  

Keywords:  ABCA1; LRP1; atherosclerosis; cell biology; human biology; macrophage; medicine; mouse; nuclear hormone receptor; phosphorylation

Mesh:

Substances:

Year:  2017        PMID: 29144234      PMCID: PMC5690284          DOI: 10.7554/eLife.29292

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.140


Introduction

Atherosclerosis is a chronic condition characterized by impairments in three major processes: systemic and cellular cholesterol homeostasis, inflammation, and apoptosis/efferocytosis (Libby et al., 2011). Essential roles for the multifunctional transmembrane protein LDL receptor-related-protein 1 (LRP1) have been reported for each of these three processes (Boucher et al., 2003; Boucher et al., 2002; El Asmar et al., 2016; Mantuano et al., 2016; Subramanian et al., 2014; Zhou et al., 2009a; Zurhove et al., 2008). Together with LDLR, LRP1 regulates the clearance of circulating cholesterol-rich remnant proteins by hepatocytes (Rohlmann et al., 1998). LRP1 is also a key regulator of intracellular cholesterol accumulation in macrophages and smooth muscle cells (SMCs) (Boucher et al., 2003; Lillis et al., 2015; Zhou et al., 2009a). In SMCs, LRP1 functions as a co-receptor with platelet-derived growth factor receptor (PDGFRβ), which in turn activates inflammatory and pro-thrombotic processes (Boucher et al., 2002; Loukinova et al., 2002). LRP1 itself has also been implicated in limiting cellular inflammatory responses (Mantuano et al., 2016; Zurhove et al., 2008), and the dual role of LRP1 in cholesterol homeostasis and inflammation (El Asmar et al., 2016; Woldt et al., 2011, 2012) was recently demonstrated in an adipocyte-specific LRP1-deficient mouse model (Konaniah et al., 2017). Finally, LRP1 is necessary for efficient efferocytosis in macrophages and dendritic cells (Subramanian et al., 2014; Yancey et al., 2010). LRP1 is ubiquitously expressed, but how it affects cellular signaling mechanisms can differ substantially in a cell-type dependent manner. In SMCs, LRP1 regulates ERK1/2 activation, which leads to increased cPLA2 phosphorylation and release of arachidonic acid (Graves et al., 1996; Lin et al., 1992), a suppressor of LXR-driven ATP-binding cassette transporter A1 (ABCA1) expression (DeBose-Boyd et al., 2001), thereby increasing SMC intracellular cholesterol accumulation (Zhou et al., 2009a). ABCA1, however, mediates not just reverse cholesterol export, it also regulates cellular inflammatory responses (Ito et al., 2015; Tang et al., 2009; Zhu et al., 2010). This suggests the presence of an LRP1/LXR/ABCA1 axis that controls and integrates cellular cholesterol export and inflammatory responses. One of the atheroprotective roles of LRP1 in the vascular wall is the regulation of the well-established mitogenic pathway mediated by platelet derived growth factor (PDGF), which promotes atherosclerosis (Ross, 1993). Mitogenic signaling is commonly associated with tyrosine phosphorylation, and stimulation of PDGFRβ with PDGF-BB induces tyrosine phosphorylation of LRP1 by Src-family tyrosine kinases at the distal cytoplasmic NPxY motif (Barnes et al., 2001; Boucher et al., 2002; Loukinova et al., 2002). This phosphorylation event can either promote or inhibit the association of the LRP1-ICD (intracellular domain) with several intracellular adaptor proteins, which in turn modulates down-stream signaling cascades (Gotthardt et al., 2000). However, the physiological significance of LRP1 NPxY phosphorylation has remained unclear. To investigate this role of LRP1 tyrosine phosphorylation in atherosclerosis, we developed a knock-in mouse model in which the tyrosine in the distal NPxY motif was replaced with phenylalanine (Lrp1), thereby disabling Lrp1 NPxY phosphorylation while leaving the interaction with phosphotyrosine-independent PTB-domain containing adaptor proteins intact (Gotthardt et al., 2000; Trommsdorff et al., 1998). We found that LRP1 NPxY phosphorylation induces a molecular switch of associated cytoplasmic adaptor proteins away from endocytosis-promoting DAB2 to the well-known signal-transducer SHC1. SHC1 is an evolutionarily conserved adaptor protein that mediates mitogenic signaling (Dieckmann et al., 2010; Pelicci et al., 1992; van der Geer, 2002; van der Geer and Pawson, 1995; van der Geer et al., 1995) and is required for LRP1-dependent signal transduction in SMC through activation of PI3K and phosphorylation of AKT (Gu et al., 2000; Radhakrishnan et al., 2008). Surprisingly, lack of LRP1 tyrosine phosphorylation was inconsequential in SMCs. By contrast, in macrophages, SHC1 binding to phosphorylated LRP1 activated PI3K/AKT and PPARγ/LXR driven ABCA1 expression, a major cellular cholesterol exporter, and one of many mechanisms that is impaired in atherogenesis. Consequently, disabling LRP1 tyrosine phosphorylation resulted in enhanced macrophage intracellular lipid accumulation and decreased clearance of apoptotic cells, thus resulting in accelerated atherosclerosis independent of plasma cholesterol levels.

Results

Generation and characterization of Lrp1 mice

To investigate the role of LRP1 tyrosine phosphorylation in atherogenesis, we generated a knock-in mouse that was incapable of tyrosine phosphorylation at the distal cytosolic NPxY motif at cytoplasmic amino acid position 63 (Lrp1) and then backcrossed it into an Ldlr-deficient background (Lrp1; Figure 1A). Western blot analysis of liver and aortic extracts from Lrp1 mice revealed no effect of the Y63F mutation on Lrp1 expression in the liver or the aorta (Figure 1B). Pull-down experiments in SMC stimulated with PDGF-BB confirmed decreased phosphorylation of the Lrp1 cytoplasmic domain in Lrp1 SMC when compared with wild type SMC (Figure 1C). The LRP1 cytoplasmic domain interacts with numerous intracellular adaptor and scaffold proteins (Gotthardt et al., 2000; Herz and Strickland, 2001; Stockinger et al., 2000). Using co-immunoprecipitation, we observed differential binding of intracellular adaptor proteins Dab2 (Disabled-2) and Shc1 (SHC-transforming protein 1) to Lrp1 depending on the phosphorylation state of the NPxY motif. After stimulation of wild type SMC with PDGF-BB, which induces phosphorylation of the distal NPxY motif in the Lrp1 cytoplasmic domain, Shc1 was bound to Lrp1, but Dab2 was not. In Lrp1 SMC, in which phosphorylation of the distal NPxY motif is prevented, Shc1 was no longer able to bind to Lrp1, while Dab2 could now be co-immunoprecipitated with Lrp1 (Figure 1C). Thus, binding of Shc1 to Lrp1 is regulated by tyrosine phosphorylation of the distal NPxY motif of Lrp1.
Figure 1.

Generation and characterization of Lrp1 knock-in mouse model.

(A) Schematic of the construct used to generate Lrp1 knock-in mice with a point mutation in the tyrosine phosphorylation site (Y63F) as indicated in red and asterisk. Open triangles indicate loxP sites. The neomycin-resistance (Neo) and thymidine kinase (TK) genes were used for selection of the targeted ES cells. Restriction sites: E, EcoRI; S,SpeI; B,BamHI; X,XhoI; P,PmeI; N,NotI; H,HindIII. (B) Western blot analysis of Lrp1 expression levels in aorta and liver from Lrp1 mice (n = 5) and Ldlr controls (n = 5) after 16 week of high cholesterol/high fat (HCHF) diet. (C) Impaired Lrp1 binding to Shc1 in primary smooth muscle cells (SMCs) from Lrp1 mice. Primary SMCs were explanted from the aorta of wild type, Lrp1, or smLrp1−/− mice. Cells were treated with 10 ng/ml PDGF-BB for 10 min. Representative immunoblots probed for LRP1 (upper) and total protein levels in input cell lysate (lower) from co-immunoprecipitation assays using antibodies against phospho-tyrosine (4G10) (left), Dab2 (middle) or Shc1 (right). p-Lrp1, tyrosine phosphorylated Lrp1. Calnexin and β-actin were used as loading controls.

Generation and characterization of Lrp1 knock-in mouse model.

(A) Schematic of the construct used to generate Lrp1 knock-in mice with a point mutation in the tyrosine phosphorylation site (Y63F) as indicated in red and asterisk. Open triangles indicate loxP sites. The neomycin-resistance (Neo) and thymidine kinase (TK) genes were used for selection of the targeted ES cells. Restriction sites: E, EcoRI; S,SpeI; B,BamHI; X,XhoI; P,PmeI; N,NotI; H,HindIII. (B) Western blot analysis of Lrp1 expression levels in aorta and liver from Lrp1 mice (n = 5) and Ldlr controls (n = 5) after 16 week of high cholesterol/high fat (HCHF) diet. (C) Impaired Lrp1 binding to Shc1 in primary smooth muscle cells (SMCs) from Lrp1 mice. Primary SMCs were explanted from the aorta of wild type, Lrp1, or smLrp1−/− mice. Cells were treated with 10 ng/ml PDGF-BB for 10 min. Representative immunoblots probed for LRP1 (upper) and total protein levels in input cell lysate (lower) from co-immunoprecipitation assays using antibodies against phospho-tyrosine (4G10) (left), Dab2 (middle) or Shc1 (right). p-Lrp1, tyrosine phosphorylated Lrp1. Calnexin and β-actin were used as loading controls. LDLR and LRP1 have functions in systemic lipoprotein metabolism. We therefore analyzed the effect of high cholesterol/high fat (HCHF) diet feeding on Lrp1 mice. Body weight, plasma cholesterol and triglyceride concentrations of Lrp1 mice on chow diet were essentially identical to age and sex-matched Ldlr controls (Figure 2A). However, after 16 weeks on HCHF diet, Lrp1 mice had significantly increased body weight, plasma cholesterol (2035 ± 99.53 mg/dl vs. 1672 ± 45.98 mg/dl, p<0.01) and triglyceride levels (257.4 ± 26.2 mg/dl vs. 161.8 ± 13.55 mg/dl, p<0.01) compared to Ldlr mice (Figure 2A). Western blot analysis revealed increased ApoB48 and ApoE in Lrp1 mice, whereas ApoB100 and ApoAI were decreased compared to Ldlr mice after HCHF diet feeding (Figure 2B). FPLC lipoprotein analysis demonstrated that elevated plasma cholesterol levels in Lrp1 mice fed with HCHF diet were attributed to increased VLDL-cholesterol with slightly reduced LDL- and HDL-cholesterol contents (Figure 2C). VLDL-triglyceride levels were also increased in Lrp1 mice (Figure 2C). Consistent with the results of total plasma apolipoprotein analysis, size-fractionated ApoB100 and ApoAI were significantly decreased, but ApoE was increased in Lrp1 mice (Figure 2D). Interestingly, ApoB48 remnant particles were shifted towards a larger size in Lrp1 mice compared to Ldlr mice on HCHF diet, possibly suggesting impaired clearance through SR-B1 (Rigotti et al., 1997). We conclude that the Lrp1 mutation not only promotes the accumulation of ApoB48 remnants, as also seen in the hepatic Lrp1 knockout (Rohlmann et al., 1998; Rohlmann et al., 1996), but also causes decreases in HDL and ApoA1, which could independently increase atherosclerosis reminiscent of the increased risk of premature atherosclerosis in individuals with Tangier’s disease (Tall and Wang, 2000).
Figure 2.

Lrp1 mutation elicits pro-atherogenic lipoprotein profiles on HCHF diet.

(A) Body weight, plasma cholesterol and triglyceride levels of Lrp1 (n = 16) and Ldlr (n = 14) mice after 16 weeks of chow diet (CD) or high cholesterol/high fat (HCHF) diet. (B) Representative immunoblots and quantitative analysis of plasma apolipoproteins in Lrp1 (n = 6) and Ldlr (n = 6) mice after 16 weeks of HCHF diet. (C) FPLC plasma lipid profiles. Cholesterol (left) and triglyceride (right) in fractionated plasma from mice on 16 week HCHF diet. (D) Representative immunoblots of ApoB (left), ApoE (middle) and ApoAI (right) in different fractions. All data are mean ±SEM. *p<0.05, **p<0.01, ***p<0.001.

Lrp1 mutation elicits pro-atherogenic lipoprotein profiles on HCHF diet.

(A) Body weight, plasma cholesterol and triglyceride levels of Lrp1 (n = 16) and Ldlr (n = 14) mice after 16 weeks of chow diet (CD) or high cholesterol/high fat (HCHF) diet. (B) Representative immunoblots and quantitative analysis of plasma apolipoproteins in Lrp1 (n = 6) and Ldlr (n = 6) mice after 16 weeks of HCHF diet. (C) FPLC plasma lipid profiles. Cholesterol (left) and triglyceride (right) in fractionated plasma from mice on 16 week HCHF diet. (D) Representative immunoblots of ApoB (left), ApoE (middle) and ApoAI (right) in different fractions. All data are mean ±SEM. *p<0.05, **p<0.01, ***p<0.001.

Accelerated atherosclerosis in Lrp1;Ldlr mice

The unexpected, though modest, change in plasma ApoA1 in addition to the accumulation of very large lipoprotein remnants led us to investigate atherosclerosis susceptibility in Lrp1 mice. Compared to Ldlr mice, Lrp1 mice showed a 1.7-fold and 2.7-fold increase of atherosclerotic lesion area throughout the entire aorta and in the aortic root, respectively (Figure 3A and B).
Figure 3.

Lrp1 mutation accelerates atherosclerotic development on a HCHF diet.

(A) Representative images of en face assessment of aortic atherosclerotic lesions stained with Oil red O (left) and quantitative analysis of aortic lesion area (right) in Lrp1 (n = 16) and Ldlr (n = 14) mice after 16 weeks of HCHF diet. (B) Analysis of atherosclerotic lesions in aortic roots with Oil red O staining in mice described above. Black arrows indicate atherosclerotic plaque (left, scale bar = 200 μM). Oil red O positive areas in aortic roots were quantified (right). Values are expressed as mean ±SEM. *p<0.05, **p<0.01, ***p<0.001.

Lrp1 mutation accelerates atherosclerotic development on a HCHF diet.

(A) Representative images of en face assessment of aortic atherosclerotic lesions stained with Oil red O (left) and quantitative analysis of aortic lesion area (right) in Lrp1 (n = 16) and Ldlr (n = 14) mice after 16 weeks of HCHF diet. (B) Analysis of atherosclerotic lesions in aortic roots with Oil red O staining in mice described above. Black arrows indicate atherosclerotic plaque (left, scale bar = 200 μM). Oil red O positive areas in aortic roots were quantified (right). Values are expressed as mean ±SEM. *p<0.05, **p<0.01, ***p<0.001.

Lrp1 does not alter SMC phenotype or function

Our previous studies demonstrated that smooth muscle Lrp1 deficiency leads to increased SMC proliferation and migration and retention of cholesterol, leading to profound aortic atherosclerosis. Unlike the SMC-targeted Lrp1 knockout mouse model (smLrp1), which displays prominent aortic wall thickening and increased numbers of SMC even under normolipidemic conditions, morphometric analysis of the thoracic aorta from Lrp1 and Ldlr mice revealed no difference in aortic wall thickness or numbers of SMC (Figure 4A). Furthermore, analysis of whole aorta homogenate (Figure 4B) and explanted primary aortic SMC (Figure 4C) from the Lrp1 and Ldlr mice showed no significant differences in the activation of known PDGF down-stream signal effectors. Finally, to test the functional properties of the explanted SMC, we used Transwell Migration and BrdU Proliferation assays to compare their migratory and proliferative response to PDGF-BB. No difference in migration or proliferation was observed between wild type and Lrp1 SMC (Figure 4D). We therefore concluded that the Lrp1 mutation does not increase atherosclerosis propensity through a change of SMC phenotype.
Figure 4.

Lrp1 mutation has no effect on atherogenic signaling pathways and morphological phenotype in SMCs.

(A) Left: representative images of H&E stained descending thoracic aortas (scale bar = 50 μm). Right: aortic wall thickness and cell number were quantified for the indicated genotypes. Data are expressed mean ±SEM; n = 3 per group and genotype. (B) HCHF diet in Lrp1 mice has no effect on PDGF and TGFβ-mediated signaling in the aorta. Proteins were extracted from whole aorta in Lrp1 and Ldlr mice fed with indicated diets. Expression of proteins involved in PDGF signaling pathways was determined by Western blot analysis. (C) Lrp1 mutation did not affect atherogenic signaling pathways mediated by PDGF in vitro. Primary SMCs from WT and Lrp1 mice were incubated with or without 10 ng/ml PDGF-BB for 10 min. Expression of proteins involved in PDGF signaling were determined by Western blot analysis. (D) Lrp1 mutation did not alter SMC functions in vitro. Primary cultured SMCs from WT and Lrp1 mice were incubated with or without 10 ng/ml PDGF-BB under indicated conditions, then cell migration (left) and proliferation (right) were determined. Values from three independent experiments are expressed as mean ±SEM. *p<0.05.

Lrp1 mutation has no effect on atherogenic signaling pathways and morphological phenotype in SMCs.

(A) Left: representative images of H&E stained descending thoracic aortas (scale bar = 50 μm). Right: aortic wall thickness and cell number were quantified for the indicated genotypes. Data are expressed mean ±SEM; n = 3 per group and genotype. (B) HCHF diet in Lrp1 mice has no effect on PDGF and TGFβ-mediated signaling in the aorta. Proteins were extracted from whole aorta in Lrp1 and Ldlr mice fed with indicated diets. Expression of proteins involved in PDGF signaling pathways was determined by Western blot analysis. (C) Lrp1 mutation did not affect atherogenic signaling pathways mediated by PDGF in vitro. Primary SMCs from WT and Lrp1 mice were incubated with or without 10 ng/ml PDGF-BB for 10 min. Expression of proteins involved in PDGF signaling were determined by Western blot analysis. (D) Lrp1 mutation did not alter SMC functions in vitro. Primary cultured SMCs from WT and Lrp1 mice were incubated with or without 10 ng/ml PDGF-BB under indicated conditions, then cell migration (left) and proliferation (right) were determined. Values from three independent experiments are expressed as mean ±SEM. *p<0.05.

Increased necrotic core size and macrophage content in Lrp1 atherosclerotic lesions

Aside from SMCs, macrophages are central to atherogenesis. Semi-quantitative, cross-sectional analysis of the composition of atherosclerotic lesions in the aortic sinus revealed a 57% increase in Mac-3–positive macrophages, but a comparable amount of α-actin–positive cells (corresponding to SMC) in Lrp1 mice, consistent with a pronounced infiltration of macrophages into the atherosclerotic plaque (Figure 5A). Further semi-quantitative analysis of H&E staining showed a 40% increase in necrotic core area in Lrp1 mice (Figure 5B). The increase in apoptosis was confirmed by TUNEL staining of atherosclerotic plaques in vivo (Figure 5C) and oxLDL loaded peritoneal macrophages in vitro (Figure 5D). Deficiency in MER proto-oncogene tyrosine kinase (MerTK) is associated with increased macrophage apoptosis and decreased efferocytosis, leading to increased necrotic cores in Apoe mice (Li et al., 2006; Scott et al., 2001; Thorp et al., 2008). We isolated peritoneal macrophages from Lrp1 and control mice and found a significant decrease in MerTK expression both at baseline and in response to treatment with oxLDL (Figure 5E). Therefore, increased necrotic core size and apoptosis in the Lrp1 mice may be attributed at least in part to MerTK dysfunction associated with the macrophage Lrp1 mutation, in addition to other efferocytosis-related functions that are controlled by LRP1 (Subramanian et al., 2014; Yancey et al., 2010). Based on these results, we suspected that the striking increase in atherosclerosis in Lrp1 mice is due to macrophages and not SMCs.
Figure 5.

Enhanced necrotic core in atherosclerotic lesions in Lrp1 mice.

(A) Left: Immunohistochemistry of aortic roots sections stained with Mac-3 (a and b, scale bar = 50 μM) and α-actin (c and d, scale bar = 50 μM). White arrows indicate positive immunofluorescent staining. Right: postive staining area was quantified. (B) Representative sections of H&E stained aortic roots from Ldlr (n = 13) and Lrp1 (n = 12) mice after 16 weeks of HCHF diet. Black arrows indicate the necrotic core (left, scale bar = 50 μM) and necrotic core area in the aortic roots was quantified (right). (C) Immunohistochemical analysis of apoptosis in atherosclerotic lesions in mice described above. Representative sections of TUNEL staining of the aortic roots from indicated mice (left: scale bar = 50 μM) and TUNEL-positive cells in the lesions were counted (right). (D) Immunohistochemical analysis of apoptosis in oxLDL-treated peritoneal macrophages in vitro. Representative images of TUNEL-stained macrophages with indicated genotypes (left: scale bar = 50 μM) and TUNEL-positive cells were counted (right). (E) Western blot analysis of MerTK in macrophages in the absence or presence of oxLDL. All data are mean ±SEM. *p<0.05, **p<0.01.

Enhanced necrotic core in atherosclerotic lesions in Lrp1 mice.

(A) Left: Immunohistochemistry of aortic roots sections stained with Mac-3 (a and b, scale bar = 50 μM) and α-actin (c and d, scale bar = 50 μM). White arrows indicate positive immunofluorescent staining. Right: postive staining area was quantified. (B) Representative sections of H&E stained aortic roots from Ldlr (n = 13) and Lrp1 (n = 12) mice after 16 weeks of HCHF diet. Black arrows indicate the necrotic core (left, scale bar = 50 μM) and necrotic core area in the aortic roots was quantified (right). (C) Immunohistochemical analysis of apoptosis in atherosclerotic lesions in mice described above. Representative sections of TUNEL staining of the aortic roots from indicated mice (left: scale bar = 50 μM) and TUNEL-positive cells in the lesions were counted (right). (D) Immunohistochemical analysis of apoptosis in oxLDL-treated peritoneal macrophages in vitro. Representative images of TUNEL-stained macrophages with indicated genotypes (left: scale bar = 50 μM) and TUNEL-positive cells were counted (right). (E) Western blot analysis of MerTK in macrophages in the absence or presence of oxLDL. All data are mean ±SEM. *p<0.05, **p<0.01.

Macrophages drive the atherosclerotic response in Lrp1;Ldlr mice

Because of the observed change of the lipoprotein profile in the Lrp1 mice, a trivial explanation for the increased atherosclerosis would be impaired chylomicron clearance and decreased HDL. To exclude the possibility that the atherosclerotic phenotype was secondary to changes in lipid metabolism and to explore the degree to which atherosclerosis was driven by Lrp1 tyrosine phosphorylation in macrophages, we performed bone marrow transplants where Ldlr or Lrp1 bone-marrow was transplanted into irradiated Ldlr mice. After 16 weeks of HCHF diet all irradiated mouse groups that underwent bone marrow transplant exhibited high plasma cholesterol levels (Figure 6A). However, there was no difference in plasma lipid and apolipoprotein levels between Ldlr → Ldlr and Lrp1 → Ldlr mice (Figure 6B, C and D). By comparing Figure 6C to Figure 2C, we demonstrated that bone marrow transplantation eliminated the difference in peripheral lipid profiles, thereby demonstrating that the Lrp1 mutation in macrophages is not responsible for the changes in the lipid profile. Furthermore, the correction of HDL and ApoA1 levels in the bone marrow transplant model suggested a role for Y63 phosphorylation in the liver. Increased catabolism of ApoA1 is a hallmark of the functional impairment of ABCA1 in Tangier’s disease (Tall and Wang, 2000) and in liver Abca1 deficient mice (Timmins et al., 2005). We therefore investigated the effect of the Lrp1 mutation in the liver. After a 16 week HCHF diet challenge, Western blot analysis showed decreased expression of Abca1 in the liver from Lrp1 mice (Figure 7A), but no change in Abca1 expression in the liver of Lrp1 → Ldlr mice (Figure 7B). Therefore, as in Tangier’s disease, the significant decrease in hepatic Abca1 likely accounts for the decreased plasma ApoA1 in the Lrp1 mouse. However, even though hepatic Abca1 expression (and therefore plasma ApoA1 levels) is normalized in the bone marrow transplantation model, Lrp1 → Ldlr still developed more atherosclerotic lesions when compared to Ldlr → Ldlr controls on HCHF diet (Figure 8). These results indicate that the relatively modest change in lipoprotein profiles (increased chylomicrons and decreased HDL) is insufficient to explain the striking increase in atherosclerosis generated by the Lrp1 mutation. Instead, a cell autonomous effect of Lrp1 tyrosine phosphorylation in macrophages is primarily responsible for increased atherosclerosis.
Figure 6.

Bone marrow transplantation (BMT) with Lrp1 bone marrow does not affect lipid profiles in Ldlr mice.

Diagram of bone marrow transplant is shown on the top. Bone marrows from Lrp1 mice and Ldlr control mice were transplanted into γ-irradiated-Ldlr−/− mice. After BMT, recipient mice were placed on the indicated diets for 16 weeks. (A) Body weight, plasma cholesterol and triglyceride levels of Ldlr→ Ldlr (n = 9) and Lrp1→Ldlr (n = 15) mice on CD or HCHF diet. (B) Representative immunoblots and quantitative analysis of plasma apolipoproteins in BMT mice on 16 week HCHF diet (n = 5, each group). (C) FPLC plasma lipid profiles. Cholesterol (left) and triglyceride (right) in fractionated pooled plasma from HCHF-fed mice (n = 8–10, each group). (D) Representative Western blots of ApoB (left), ApoE (middle) and ApoAI (right) in different fractions. All data are mean ±SEM.

Figure 7.

Lrp1 mutation downregulates hepatic Abca1 levels.

(A) Western blot analysis of Abca1 expression in the liver from Lrp1 and Ldlr mice fed with HCHF diet for 16 weeks (n = 5, each group). (B) Western blot analysis of Abca1 expression in the liver from 16 week HCHF-fed Lrp1 and Ldlr mice after BMT (n = 5, each group). All data are mean ±SEM. **p<0.01.

Figure 8.

Bone marrow-derived Lrp1 promotes atherosclerosis.

(A) Representative images of en face assessment of atherosclerotic lesions in 16 week HCHF-fed recipient mice with indicated bone marrow donor mice (left) and quantification of plaque areas (right). (B) Representative Oil red O-stained sections of aortic roots in each BMT group (left) and quantification of atheroma areas (right). Black arrows indicate atherosclerotic plaque lesions. All data are mean ±SEM. **p<0.01.

Bone marrow transplantation (BMT) with Lrp1 bone marrow does not affect lipid profiles in Ldlr mice.

Diagram of bone marrow transplant is shown on the top. Bone marrows from Lrp1 mice and Ldlr control mice were transplanted into γ-irradiated-Ldlr−/− mice. After BMT, recipient mice were placed on the indicated diets for 16 weeks. (A) Body weight, plasma cholesterol and triglyceride levels of Ldlr→ Ldlr (n = 9) and Lrp1→Ldlr (n = 15) mice on CD or HCHF diet. (B) Representative immunoblots and quantitative analysis of plasma apolipoproteins in BMT mice on 16 week HCHF diet (n = 5, each group). (C) FPLC plasma lipid profiles. Cholesterol (left) and triglyceride (right) in fractionated pooled plasma from HCHF-fed mice (n = 8–10, each group). (D) Representative Western blots of ApoB (left), ApoE (middle) and ApoAI (right) in different fractions. All data are mean ±SEM.

Lrp1 mutation downregulates hepatic Abca1 levels.

(A) Western blot analysis of Abca1 expression in the liver from Lrp1 and Ldlr mice fed with HCHF diet for 16 weeks (n = 5, each group). (B) Western blot analysis of Abca1 expression in the liver from 16 week HCHF-fed Lrp1 and Ldlr mice after BMT (n = 5, each group). All data are mean ±SEM. **p<0.01.

Bone marrow-derived Lrp1 promotes atherosclerosis.

(A) Representative images of en face assessment of atherosclerotic lesions in 16 week HCHF-fed recipient mice with indicated bone marrow donor mice (left) and quantification of plaque areas (right). (B) Representative Oil red O-stained sections of aortic roots in each BMT group (left) and quantification of atheroma areas (right). Black arrows indicate atherosclerotic plaque lesions. All data are mean ±SEM. **p<0.01.

Lrp1 promotes macrophage lipid accumulation in response to oxLDL

Histological analysis of the atherosclerotic plaque suggests a role for macrophage apoptosis as well as intracellular lipid accumulation. To examine whether the Lrp1 mutation impacts macrophage foam cell formation, we incubated peritoneal macrophages isolated from Ldlr and Lrp1 mice with oxLDL. Intracellular lipid accumulation was significantly higher in cultured Lrp1 macrophages compared to control cells as shown by Oil-Red O staining (Figure 9A). To understand the etiology for increased intracellular lipid accumulation, [3H]-labeled cholesterol efflux experiments in peritoneal macrophages from Ldlr and Lrp1 mice were performed. Compared to Ldlr, macrophages from Lrp1 mice had significantly reduced cholesterol efflux capacity to ApoAI, but not to HDL (Figure 9B). We next examined the expression profiles of lipid transporters involved in cholesterol transport (Figure 9C). In response to oxLDL, Cd36 was increased in Ldlr and Lrp1 macrophages. However, there was decreased expression of the reverse cholesterol transporter Abca1 both at baseline and in response to oxLDL in Lrp1 macrophages, consistent with the cholesterol efflux data. No difference in the expression levels of Abcg1 and Srb1 were observed in the two genotypes after oxLDL stimulation. As both ABCA1 and LRP1 are transmembrane proteins, we used surface biotinylation to investigate the distribution of these proteins. Analysis of surface and total expression of Abca1 and Lrp1 in oxLDL-stimulated macrophages revealed no difference in the ratio of surface/total Abca1 or Lrp1 between Lrp1 and Ldlr macrophages (Figure 9D), suggesting that translocation of Abca1 and Lrp1 to the cell membrane is functioning normally. Finally, cross-sectional analysis of the aortic root confirmed greatly decreased expression of Abca1 in atherosclerotic plaques from HCHF diet fed Lrp1 mice in vivo (Figure 10). Together, these results demonstrate that macrophage cholesterol efflux through Abca1 is selectively impaired by the Lrp1 mutation.
Figure 9.

Lrp1 impairs Abca1-mediated cholesterol efflux and increases lipid accumulation in macrophages.

Peritoneal macrophages isolated from Lrp1 and Ldlr mice were starved overnight and treated with or without oxLDL (100 μg/mL) for 24 hr. (A) Representative photomicrographs of lipid accumulation in macrophages stained with Oil red O (left, Ldlr; right, Lrp1, scale bar = 50 μm). Black arrows indicate Oil red O-stained positive cells. (B) Macrophages isolated from Ldlr and Lrp1 mice were labeled with [3H]-cholesterol in the presence of oxLDL for 24 hr. After equilibration in 0.2% BSA overnight, cells were incubated with either 20 μg/ml apoAI or 30 μg/ml HDL for 4 hr. (C) Western blot analysis of lipid transporters in macrophages treated with or without oxLDL (left) and immunoblot quantitation (right). (D) After treatment with or without oxLDL, surface Abca1 and Lrp1 at plasma membrane in macrophages were biotinylated. The ratio of surface to total protein levels was analyzed by Western blotting (left) and quantification shown (right). All data are mean ±SEM from 3 to 6 independent experiments. *p<0.05, **p<0.01, ***p<0.001.

Figure 10.

Abca1 expression is reduced in atherosclerotic lesions in Lrp1 mice.

(A) Cryo-sections of aortic roots from HCD-fed Ldlr and Lrp1 mice were double-stained with Abca1 (green) and Cd68 (red) antibodies. Nuclei were stained with DAPI (blue). (B) Abca1 immunoreactivity was determined by color and normalized to lesion size. Scale bar = 200 μM. White arrows indicate the areas of macrophages without Abca1 expression. Data are mean ±SEM from five mice for each genotype. **p<0.01.

Lrp1 impairs Abca1-mediated cholesterol efflux and increases lipid accumulation in macrophages.

Peritoneal macrophages isolated from Lrp1 and Ldlr mice were starved overnight and treated with or without oxLDL (100 μg/mL) for 24 hr. (A) Representative photomicrographs of lipid accumulation in macrophages stained with Oil red O (left, Ldlr; right, Lrp1, scale bar = 50 μm). Black arrows indicate Oil red O-stained positive cells. (B) Macrophages isolated from Ldlr and Lrp1 mice were labeled with [3H]-cholesterol in the presence of oxLDL for 24 hr. After equilibration in 0.2% BSA overnight, cells were incubated with either 20 μg/ml apoAI or 30 μg/ml HDL for 4 hr. (C) Western blot analysis of lipid transporters in macrophages treated with or without oxLDL (left) and immunoblot quantitation (right). (D) After treatment with or without oxLDL, surface Abca1 and Lrp1 at plasma membrane in macrophages were biotinylated. The ratio of surface to total protein levels was analyzed by Western blotting (left) and quantification shown (right). All data are mean ±SEM from 3 to 6 independent experiments. *p<0.05, **p<0.01, ***p<0.001.

Abca1 expression is reduced in atherosclerotic lesions in Lrp1 mice.

(A) Cryo-sections of aortic roots from HCD-fed Ldlr and Lrp1 mice were double-stained with Abca1 (green) and Cd68 (red) antibodies. Nuclei were stained with DAPI (blue). (B) Abca1 immunoreactivity was determined by color and normalized to lesion size. Scale bar = 200 μM. White arrows indicate the areas of macrophages without Abca1 expression. Data are mean ±SEM from five mice for each genotype. **p<0.01.

Role of PPARγ/LXR signaling in oxLDL-induced ABCA1 expression

We next explored transcriptional mechanisms that might be regulated by LRP1 tyrosine phosphorylation and impact ABCA1 expression. A major regulator of ABCA1 expression is LXR: both LXRα and LXRβ respond to oxidized sterols and regulate cholesterol transport (Janowski et al., 1996). In macrophages, activation of PPARγ induces LXRα transcriptional activation, thereby increasing ABCA1 expression (Chawla et al., 2001). We therefore asked whether LRP1 may regulate PPARγ/LXR. We have previously shown in SMC that LRP1 indirectly regulates LXR-mediated ABCA1 expression independent of LXR gene transcription (Zhou et al., 2009a). An additional precedent is provided by a recent study demonstrating that the LRP1 cytoplasmic domain itself can regulate gene expression by directly interacting with PPARγ (Mao et al., 2017). To investigate whether phosphorylation of LRP1 at Y63 affects the PPARγ/LXR pathway in oxLDL-induced ABCA1 expression, we tested the transcription levels of LXR-dependent gene regulation. The Lrp1 mutation diminished oxLDL-induced Abca1 gene transcription, but not Abca7 gene transcription, which by contrast is increased in macrophages lacking LRP1 completely (Yancey et al., 2010). Furthermore, the Lrp1 mutation had no effect on Nr1h3 (a.k.a. Lxrα), Nr2h2 (a.k.a. Lxrβ), or Pparg gene expression in macrophages in the presence or absence of oxLDL (Figure 11A), and there was no change in LXRα or PPARγ protein expression (data not shown). Using the PPARγ inhibitor T0070907, we confirmed that PPARγ activity was necessary for Abca1 expression in both Ldlr and Lrp1 macrophages (Figure 11B). To further investigate the role of PPARγ/LXR activation, isolated peritoneal macrophages were incubated with the PPARγ agonist Rosiglitazone (Figure 11C), the nonspecific LXR agonist T0901317 (Figure 11D), or LXR623 (a LXRβ full agonist and LXRα partial agonist) (Figure 11E). Neither LXR or PPARγ agonists, over a range of doses, were able to fully correct the blunted Abca1 levels in the Lrp1 mice (Figure 11C–E). Together these data demonstrate that the entire PPARγ/LXR/ABCA1 axis is severely impaired by the Lrp1 mutation in macrophages and suggest that a membrane proximal event that is dependent on Lrp1 tyrosine phosphorylation is required to activate Abca1 transcription through PPARγ and LXR.
Figure 11.

Lrp1 impairs Abca1 induction through inhibiting the PPARγ/LXR pathway.

(A) Real-time PCR analysis of Abca1, Abca7, Pparg, Nr1h3 and Nr2h2 expression in macrophages treated with or without ox-LDL. (B–E) Isolated peritoneal macrophages from Lrp1 and Ldlr were pre-incubated for 1 hr with (B) T0070907 (PPARγ antagonist, 10 μM), (C) Rosiglitizone (PPARγ agonist) at indicated concentrations in μM, (D) T0901317 (nonspecific LXR agonist) at indicated concentrations in μM, (E) LXR623 (LXRβ full agonist and LXRα partial agonist) at indicated concentrations in μM, followed by the treatment with or without oxLDL for an additional 24 hr. Abca1 expression was assessed by immunoblot analysis (left). Protein expression was quantified and analyzed (right). Data are mean ±SEM from three independent experiments. *p<0.05; **p<0.01.

Lrp1 impairs Abca1 induction through inhibiting the PPARγ/LXR pathway.

(A) Real-time PCR analysis of Abca1, Abca7, Pparg, Nr1h3 and Nr2h2 expression in macrophages treated with or without ox-LDL. (B–E) Isolated peritoneal macrophages from Lrp1 and Ldlr were pre-incubated for 1 hr with (B) T0070907 (PPARγ antagonist, 10 μM), (C) Rosiglitizone (PPARγ agonist) at indicated concentrations in μM, (D) T0901317 (nonspecific LXR agonist) at indicated concentrations in μM, (E) LXR623 (LXRβ full agonist and LXRα partial agonist) at indicated concentrations in μM, followed by the treatment with or without oxLDL for an additional 24 hr. Abca1 expression was assessed by immunoblot analysis (left). Protein expression was quantified and analyzed (right). Data are mean ±SEM from three independent experiments. *p<0.05; **p<0.01.

PI3K/AKT signaling is impaired in oxLDL-stimulated Lrp1;Ldlr macrophages

We have previously shown in SMCs that LRP1 regulates mitogenic signaling, leading to ERK and AKT phosphorylation (Boucher et al., 2003; Zhou et al., 2009b). Demers et al. showed that PI3K/AKT activation can modulate the PPARγ/LXR/ABCA1 axis (Demers et al., 2009), thereby raising the possibility that PI3K activation might be dependent upon LRP1. We thus investigated the effect of oxLDL and Lrp1 phosphorylation on PI3K/Akt signaling in macrophages. Phospho-Akt levels were significantly decreased in Lrp1 macrophages, both at baseline and in response to oxLDL (Figure 12A). Moreover, inhibition of the PI3K/Akt pathway with LY294002, a PI3K inhibitor, or an Akt inhibitor, in Ldlr macrophages significantly attenuated Abca1 induction in response to oxLDL, such that Abca1 expression levels were comparable to those found in Lrp1 macrophages (Figure 12B). To show that PI3K/Akt is required for full induction of Abca1 expression by PPARγ/LXR, Ldlr macrophages were pre-incubated with PI3K/Akt inhibitors followed by PPARγ/LXR agonists. Inhibition of PI3K/Akt results in incomplete induction of Abca1 by both PPARγ and LXR agonists, similar to what is observed in macrophages carrying the Lrp1 mutation (Figure 12C and D). This suggested the existence of an endogenous mechanism that is dependent upon LRP1 tyrosine phosphorylation to activate PI3K/Akt and subsequently PPARγ/LXR-induced Abca1 expression.
Figure 12.

Lrp1-induced impairment of Abca1 up-regulation is dependent on PI3K/Akt activities.

(A) Western blot analysis of Akt phosphorylation in macrophages treated with or without ox-LDL. (B) Isolated peritoneal macrophages from Lrp1 and Ldlr were pre-incubated with LY294002 (PI3K antagonist, 10 μM) or Akt inhibitor (10 μM) for 1 hr, followed by ox-LDL treatment for an additional 24 hr. Abca1 protein levels were analyzed by Western blot analysis (left) and quantification is shown (right). (C–D) Macrophages were pretreated with LY294002 (10 μM) or Akt inhibitor (10 μM) for 1 hr, followed by the application of 10 μM rosiglitizone (C) or 10 μM T0901317 (D) for an additional 24 hr. Abca1 and pAkt expression were assessed by immunoblot analysis (left) and quantification is shown (right). Data are mean ±SEM from three independent experiments. *p<0.05; **p<0.01; ***p<0.001.

Lrp1-induced impairment of Abca1 up-regulation is dependent on PI3K/Akt activities.

(A) Western blot analysis of Akt phosphorylation in macrophages treated with or without ox-LDL. (B) Isolated peritoneal macrophages from Lrp1 and Ldlr were pre-incubated with LY294002 (PI3K antagonist, 10 μM) or Akt inhibitor (10 μM) for 1 hr, followed by ox-LDL treatment for an additional 24 hr. Abca1 protein levels were analyzed by Western blot analysis (left) and quantification is shown (right). (C–D) Macrophages were pretreated with LY294002 (10 μM) or Akt inhibitor (10 μM) for 1 hr, followed by the application of 10 μM rosiglitizone (C) or 10 μM T0901317 (D) for an additional 24 hr. Abca1 and pAkt expression were assessed by immunoblot analysis (left) and quantification is shown (right). Data are mean ±SEM from three independent experiments. *p<0.05; **p<0.01; ***p<0.001.

Knockdown of Shc1 inhibits oxLDL-induced Akt phosphorylation and Abca1 upregulation

To identify the missing link that connects LRP1 to PI3K/Akt, we evaluated the numerous adaptor proteins that interact with LRP1 (Barnes et al., 2001; Gotthardt et al., 2000). SHC1 is such an intracellular adaptor protein with an established role in mitogenic signal transduction (Pelicci et al., 1992). Tyrosine phosphorylation of Lrp1 is required for the binding of the intracellular adapter protein Shc1 in SMC, and the Lrp1 mutation prevents binding of Shc1 to Lrp1 (Figure 1). Using co-immunoprecipitation assays, we confirmed that the interaction between phosphorylated Lrp1 and Shc1 also occurs in macrophages (Figure 13A). To investigate the role of Shc1 in oxLDL-induced Abca1 expression, we employed shRNA-directed gene silencing to specifically reduce the expression levels of Shc1 in Ldlr and Lrp1 macrophages. The induction of Akt phosphorylation and Abca1 expression in response to oxLDL was significantly impaired by the knockdown of Shc1 in Ldlr macrophages, whereas Shc1 knock-down had no effect on Akt phosphorylation and Abca1 expression in Lrp1 macrophages (Figure 13B). We therefore concluded that Akt phosphorylation and Abca1 expression is dependent on the interaction between Shc1 and phosphorylated Lrp1.
Figure 13.

Binding of LRP1 to Shc1 is required for oxLDL-induced Abca1 up-regulation in macrophages.

(A) Representative immunoblots probed for LRP1 (upper) and total immunoprecipitated Shc1 levels in input cell lysate (lower) from co-immunoprecipitation assays using antibodies against Shc1 (Rb Shc1) or rabbit IgG (Rb IgG). Macrophages were treated with oxLDL for 24 hr prior to immunoprecipitation. (B) Peritoneal macrophages were infected with lentivirus expressing scramble shRNA or Shc1 shRNA for 48 hr to knockdown endogenous Shc1 expression, followed by oxLDL treatment for an additional 24 hr. Protein expression was determined by quantitative Western blot analysis. from three independent experiments (C). *p<0.05; **p<0.01; ***p<0.001.

Binding of LRP1 to Shc1 is required for oxLDL-induced Abca1 up-regulation in macrophages.

(A) Representative immunoblots probed for LRP1 (upper) and total immunoprecipitated Shc1 levels in input cell lysate (lower) from co-immunoprecipitation assays using antibodies against Shc1 (Rb Shc1) or rabbit IgG (Rb IgG). Macrophages were treated with oxLDL for 24 hr prior to immunoprecipitation. (B) Peritoneal macrophages were infected with lentivirus expressing scramble shRNA or Shc1 shRNA for 48 hr to knockdown endogenous Shc1 expression, followed by oxLDL treatment for an additional 24 hr. Protein expression was determined by quantitative Western blot analysis. from three independent experiments (C). *p<0.05; **p<0.01; ***p<0.001. Collectively, our data provide a novel mechanistic basis for the role of macrophage LRP1 in atherogenesis. As summarized in Figure 14A, tyrosine phosphorylation of LRP1, which is mediated by activated Src family tyrosine kinases in a range of inflammatory or proliferative conditions (van der Geer, 2002), is required for interaction with the adaptor protein SHC1, which in turn augments PI3K/AKT activation. Phospho-AKT modulates PPARγ/LXR driven gene expression of which ABCA1 is a prominent target with well-documented roles in lipid metabolism and atherosclerosis (Aiello et al., 2002; Huang et al., 2015; Rader et al., 2009; Shao et al., 2014; Singaraja et al., 2002; Su et al., 2005; Tall and Yvan-Charvet, 2015; Yvan-Charvet et al., 2007; Zhao et al., 2010). The activation of this LRP1/SHC1/PI3K/AKT/PPARγ/LXR axis is necessary for the full effect of nuclear hormone receptor ligand-induced and PPARγ/LXR-dependent expression of ABCA1 and the engulfment receptor MerTK. In the absence of LRP1/SHC1 interaction, the decreased expression of atheroprotective LXR target genes in macrophages, as exemplified here by ABCA1 and MerTK, leads to increased intracellular lipid accumulation, macrophage foam cell formation, impaired apoptotic cell clearance and thus increased atherosclerotic plaque formation, independent of systemic lipid levels.
Figure 14.

Role of LRP1 NPxY phosphorylation in macrophage lipid accumulation and atherogenesis.

(A) Tyrosine phosphorylation of LRP1 NPxY motifs (as indicated by asterisks), specifically the distal NPxY motif, is necessary for interaction with Shc1, which in turn activates PI3K/Akt signaling. Phospho-Akt modulates PPARγ/LXR driven Abca1 gene transcription and is necessary for the full effect of ox-LDL and PPARγ/LXR induced expression of Abca1 to mediate cholesterol efflux. Inhibition of PI3K/Akt (using LY294002 or Akt inhibitor) results in only partial induction of Abca1 in response to ox-LDL and PPARγ/LXR agonists (rosiglitazone, T0901317, LXR623). (B) LRP1 integrates inflammatory signals and cholesterol homeostasis in macrophages. Inflammatory signals are initiated by the interaction between oxLDL and CD36/TLR4-6 in lipid rafts. In the setting of inflammation or cholesterol loading, increased proximity of LRP1 with activated SFKs in lipid rafts favors LRP1 tyrosine phosphorylation. This, in turn, activates a Shc1/PI3K/Akt/Pparγ/Lxrα axis that promotes Abca1 expression and cellular cholesterol export, which then leads to reduction of lipid raft cholesterol content and dissociation of LRP1 from the lipid raft, thus creating a negative feedback loop. LRP1 can also be cleaved by γ–secretase, thereby releasing the intracellular domain (ICD) which translocates to the nucleus where it suppresses inflammatory gene expression (Zurhove et al., 2008). Whether the LRP1 ICD, in a phosphorylated or unphosphorylated state, can also alter ABCA1 expression is currently unknown. CD36, cluster of differentiation 36; TLR, toll like receptor; MyD88, myeloid differentiation primary response protein 88; TRIF, TIR domain-containing adaptor protein inducing IFNβ; SFK, SRC family kinase. (C) LRP1 regulates clearance of apoptotic cells (AC) through efferocytosis. LRP1 coordinates with other receptors, such AXL and MerTK, and adaptors such as RanBP9 and GULP, to recognize and engulf apoptotic cells. Engulfment of apoptotic cells is a critical step in the activation of LXR-responsive genes, including Abca1 and Mertk. PS, protein S; CRT, cell surface calreticulin; GAS6, growth arrest-specific 6; AXL, receptor tyrosine kinase; MerTK, Proto-oncogene tyrosine-protein kinase; RANBP9, RAN binding protein 9; GULP, engulfment adaptor PTB domain containing one.

Role of LRP1 NPxY phosphorylation in macrophage lipid accumulation and atherogenesis.

(A) Tyrosine phosphorylation of LRP1 NPxY motifs (as indicated by asterisks), specifically the distal NPxY motif, is necessary for interaction with Shc1, which in turn activates PI3K/Akt signaling. Phospho-Akt modulates PPARγ/LXR driven Abca1 gene transcription and is necessary for the full effect of ox-LDL and PPARγ/LXR induced expression of Abca1 to mediate cholesterol efflux. Inhibition of PI3K/Akt (using LY294002 or Akt inhibitor) results in only partial induction of Abca1 in response to ox-LDL and PPARγ/LXR agonists (rosiglitazone, T0901317, LXR623). (B) LRP1 integrates inflammatory signals and cholesterol homeostasis in macrophages. Inflammatory signals are initiated by the interaction between oxLDL and CD36/TLR4-6 in lipid rafts. In the setting of inflammation or cholesterol loading, increased proximity of LRP1 with activated SFKs in lipid rafts favors LRP1 tyrosine phosphorylation. This, in turn, activates a Shc1/PI3K/Akt/Pparγ/Lxrα axis that promotes Abca1 expression and cellular cholesterol export, which then leads to reduction of lipid raft cholesterol content and dissociation of LRP1 from the lipid raft, thus creating a negative feedback loop. LRP1 can also be cleaved by γ–secretase, thereby releasing the intracellular domain (ICD) which translocates to the nucleus where it suppresses inflammatory gene expression (Zurhove et al., 2008). Whether the LRP1 ICD, in a phosphorylated or unphosphorylated state, can also alter ABCA1 expression is currently unknown. CD36, cluster of differentiation 36; TLR, toll like receptor; MyD88, myeloid differentiation primary response protein 88; TRIF, TIR domain-containing adaptor protein inducing IFNβ; SFK, SRC family kinase. (C) LRP1 regulates clearance of apoptotic cells (AC) through efferocytosis. LRP1 coordinates with other receptors, such AXL and MerTK, and adaptors such as RanBP9 and GULP, to recognize and engulf apoptotic cells. Engulfment of apoptotic cells is a critical step in the activation of LXR-responsive genes, including Abca1 and Mertk. PS, protein S; CRT, cell surface calreticulin; GAS6, growth arrest-specific 6; AXL, receptor tyrosine kinase; MerTK, Proto-oncogene tyrosine-protein kinase; RANBP9, RAN binding protein 9; GULP, engulfment adaptor PTB domain containing one.

Discussion

We have generated a novel knock-in mouse model to investigate the physiological role of tyrosine phosphorylation at the distal NPxY motif within the cytoplasmic domain of LRP1 and its effect on staving off atherosclerosis. Using bone marrow transplantation, we showed that the accelerated atherosclerosis in Lrp1 mice is caused by a malfunction of macrophages leading to increased intracellular lipid accumulation independent of systemic lipid levels, and deceased apoptotic cell clearance. We further showed that LRP1, through a phosphotyrosine-dependent interaction with SHC1 and subsequent activation of PI3K/AKT, is required for the efficient stimulation of the anti-inflammatory and cholesterol export-promoting PPARγ and LXR pathway. In this study we have concentrated on ABCA1, a prominent, though by no means exclusive, target of this novel atheroprotective LRP1/SHC1/PI3K/AKT/PPARγ/LXR axis, which works in aggregate with other LRP1-dependent mechanisms (Barnes et al., 2001; Boucher et al., 2002; El Asmar et al., 2016; Subramanian et al., 2014; Zhou et al., 2009a; Zurhove et al., 2008) to prevent macrophage foam cell formation, suppress inflammation and promote apoptotic cell clearance (Tall and Yvan-Charvet, 2015). The inability of Shc1 to bind to Lrp1Y63F resulted in decreased activation of PI3K/AKT and reduced expression of the LXR target genes ABCA1 and MerTK, an established inducer of apoptotic cell clearance, in macrophages. Our data further demonstrate that this SHC1-mediated AKT phosphorylation is necessary for the LRP1 dependent induction of ABCA1. Rescue of Lrp1 macrophages with LXR and PPARγ agonists did not fully correct the diminished Abca1 levels, suggesting either the existence of an alternative mechanism wherein PI3K/AKT regulates ABCA1 expression independent of PPARγ/LXR (Chen et al., 2012), or that PI3K/AKT is a necessary upstream regulator of PPARγ/LXRα driven gene expression (Demers et al., 2009; Ishikawa et al., 2013). The model we propose begins with LRP1 tyrosine phosphorylation, an event mediated by Src-family kinases (SFK), which are often localized to lipid rafts (Simons and Toomre, 2000). LRP1 associates with lipid rafts in the plasma membrane, thus creating transient microdomains that are cell specific (Wu and Gonias, 2005). Membrane organization into lipid rafts not only explains LRP1 tyrosine phosphorylation, but also underscores the relationship with ABCA1 to maintain the homeostatic balance of cellular membrane composition and signal transduction (Figure 14B). Through cellular cholesterol export ABCA1 regulates cellular plasma membrane cholesterol content and membrane structural organization, specifically the formation of lipid rafts (Ito et al., 2015; Sezgin et al., 2017; Zhu et al., 2010). In the setting of inflammation or cholesterol loading, increased proximity of LRP1 with activated Src family kinases in lipid rafts favors LRP1 tyrosine phosphorylation. This, in turn, activates a SHC1/PI3K/AKT/PPARγ/LXRα axis that promotes ABCA1 expression and cellular cholesterol export. The induction of ABCA1 leads to reduction of lipid raft cholesterol content (Ito et al., 2015) and dissociation of LRP1 from lipid rafts, thus creating a self-limiting negative feedback loop and returning homeostatic balance to the plasma membrane. In cases of impaired LRP1 phosphorylation, the dynamic interaction between LRP1 and lipid rafts may be intact, however the downstream signaling events triggered by LRP1 tyrosine phosphorylation cannot be initiated, thus impairing cholesterol homeostasis and plasma membrane composition. LRP1 and ABCA1, however, play an even larger role by integrating cholesterol homeostasis with inflammatory signaling. By modulating membrane cholesterol content and lipid raft organization, macrophage ABCA1 regulates trafficking of Toll-like-receptor 4 (TLR4) to lipid rafts (Zhu et al., 2010). In lipid rafts, TLR4 forms a complex with TLR6 and oxLDL-binding CD36 (Figure 14B and C), which leads to recruitment of the adaptor MyD88, thus triggering inflammatory signaling (Stewart et al., 2010). ABCA1 itself has anti-inflammatory properties, as interaction of ApoA1 with ABCA1 activates JAK2/STAT3 (Tang et al., 2009). Finally, as demonstrated by Ito et al, induction of Abca1 by LXRs inhibits inflammatory NF-κB and MAPK signaling pathways downstream of TLRs (Ito et al., 2015). Therefore, by modulating LXR-driven ABCA1 gene expression through the SHC1/PI3K/AKT/PPARγ/LXRα axis, LRP1 is presenting itself as a pivotal regulator of the metabolic as well as inflammatory processes underlying atherosclerosis. In addition to the indirect anti-inflammatory effect through ABCA1, there is also emerging data that LRP1 can directly regulate inflammatory gene transcription in macrophages (Zurhove et al., 2008). After cleavage of the LRP1 intracellular domain (ICD) by γ-secretase from the plasma membrane, the LRP1 ICD translocates into the nucleus and acts as a transcriptional repressor of genes for inflammatory cytokines (Figure 14B) (Zurhove et al., 2008). In an analogous manner in endothelial cells, the LRP1 ICD has been shown to directly interact with PPARγ and function as a transcriptional co-regulator of the PPARγ target gene Pdk4 (Mao et al., 2017). Together these findings underscore the integrative relationship between LRP1 and transcriptional regulators LXR and PPARγ and their interdependent roles in cholesterol homeostasis and inflammation. A third critical macrophage process underlying atherogenesis is clearance of apoptotic cells, or efferocytosis (Figure 14C). Macrophage-specific deficiency of LRP1 is associated with increased macrophage apoptosis and decreased efferocytosis, leading to larger necrotic cores in atherosclerotic plaque (Misra and Pizzo, 2005; Yancey et al., 2010; Yancey et al., 2011) Mechanistically, this has been associated with reduced levels of pAKT (Yancey et al., 2010), similar to the findings in our Lrp1 mice. An additional mechanism through which the Lrp1 mutation may affect efferocytosis is through impaired activation of LXR. LXR-deficient macrophages have reduced phagocytic capacity (A-Gonzalez et al., 2009), which is associated with decreased expression of Mertk, an LXR-responsive gene. MerTK is critical for efficient macrophage phagocytosis and efferocytosis, and deficiencies in macrophage MerTK expression contribute to increased necrotic cores in atherosclerotic lesions (Li et al., 2006; Scott et al., 2001; Thorp et al., 2008). Finally, LRP1 itself is necessary for the efficient phagocytosis of apoptotic cells, as it is required for the formation of a multiprotein complex involving LRP1, the receptor tyrosine kinase AXL, and the scaffolding protein RANBP9 (Subramanian et al., 2014). As described by Subramanian et al., whereas AXL is involved in the recognition and binding of apoptotic cells, LRP1, by associating with GULP1 (Su et al., 2002), is required for the final engulfment of the dead cells. Whether these mechanisms, which are distinct from the Src kinase family-mediated activation of the LRP1/Shc1 signaling cascade, are themselves also modulated by LRP1 tyrosine phosphorylation remains currently unknown, but can now be tested using the knockin mouse model we have reported here. Our results, which show an identical atherogenic lipoprotein profile upon cholesterol-feeding of Ldlr mice transplanted with Ldlr or Lrp1 bone marrow, differ on first glance from those of Bi et al. (Bi et al., 2014), who showed reduced plasma lipid levels in mice lacking Abca1 completely in their monocytes/macrophages. This effectively negated the proatherogenic effect of Abca1 deficiency in lesion macrophages. In their model, however, elevated plasma cholesterol levels induced by cholesterol feeding and the resulting cholesterol overload of circulating cells led to the secretion of inflammatory cytokines, which reduced VLDL secretion by the liver and thus resulted in a less atherogenic plasma lipid profile, which subsided on a low cholesterol chow diet. In our case, monocyte/macrophages carrying the Y63F mutation in Lrp1 retain residual, though substantially lower, Abca1 expression, which would protect the circulating cells from cholesterol overload in a hyperlipidemic, cholesterol-fed state. In conclusion, our current studies have revealed a novel mechanism through which macrophage LRP1 not only regulates ABCA1 expression to maintain cholesterol efflux, but also integrates cellular cholesterol homeostasis with inflammation and efferocytosis. In aggregate, these macrophage-specific processes demonstrate the atheroprotective role of LRP1 in mechanisms distinct from those found in SMCs. Together, these results underscore the cell-specific nature of LRP1-mediated signaling and highlight the central role of LRP1 in integrating cellular cholesterol homeostasis with other atheroprotective processes.

Materials and methods

Materials

The PPARγ inhibitor T0070907 (cat# T8703), LXR activator T0901317 (cat# T2320), LXR 623 (ApexBio), Rosiglitizone (cat# R2408), LY294002 (cat# L9908), and Akt inhibitor 1,3-dihydro-1-(1-((4-(6-phenyl-1H-imidazo[4,5-g]quinoxalin-7-yl)phenyl)methyl)-4-piperidinyl-2H-bezimidazole-2-one trifluoroacetate salt hydrate (cat# A6730), and In Situ Cell Death Detection Kit, TMR red (cat# 12156792910) were purchased from Sigma-Aldrich (St. Louis, MO). EZ-LinkTM-Sulfo-NHS-SS-Biotin (cat# 21331), cholesterol kit (cat# TR13421) and triglyceride kit (cat# TR22421) were purchased from Thermo Fisher Scientific (Rockfold, IL). Antibodies against ABCG1 (cat# ab36969), β-actin (cat# ab8227), CD68 (cat# ab955), α-actin (cat# ab5694), and LXRα (cat# ab41902) were purchased from Abcam (Cambridge MA). Antibodies against ABCA1 (cat# NB400-164), SR-B1 (cat#NB400-104), and CD36 (cat# NB400-144) were from Novus Biologicals (Littleton, CO). Antibodies against cPLA2 (cat# 2832), p-cPLA2 (cat# 2831), Calnexin (cat#2433), total Akt (cat# 9272 s), p-Akt (cat# 9271), PDGFRβ (cat# 3169), p-PDGFRβ (cat# 88H8), p-Smad2/3 (cat# 3108), PPARγ (cat#2443), Erk 1/2 (cat# 4695) and p-Erk1/2 (cat# 4370) were purchased from Cell Signaling (Danvers, MA). Antibodies against Shc1 (cat# 610081), Dab2 (cat# 610465), and Mac-3 (cat# 550292) were purchased from BD Transduction Laboratories (Franklin Lakes, NJ). The antibodies against apoB (cat# 178467), apoE (cat# 178479), PDGF-BB (cat# GF149), and phosphotyrosine 4G10 antibody (cat# 05–1050) and were purchased from EMD Millipore (Billerica, MA). The antibody against MerTK (cat# AF591) was purchased from R and D Systems. Purified human apoAI was a gift from Mingxia Liu and John S. Parks at Wake Forest School of Medicine. A rabbit polyclonal antibody against a C-terminal epitope of LRP1 was synthesized as previously described (Herz et al., 1988).

Animals

The targeting strategy used to generate the mice carrying the Lrp1 substitution is illustrated in Figure 1 and detailed below. 8 week old mice were fed normal rodent Chow diet (Harlan Laboratories, Indianapolis, IN) or a high cholesterol/high fat (HCHF) diet containing 21% (w/w) milk fat, 1.25% (w/w) cholesterol and 0.5% (w/w) cholic acid (TD 02028, Harlan Laboratories, Indianapolis, IN) for 16 weeks.

Generation of Lrp1 mice

A loxP-flanked exon 88-exon 89 fragment followed by exon 88-neomycin-exon 89 cassette was inserted downstream of exon 87 of the murine LRP1 gene (Figure 1). The TAT sequence in the distal NPxY motif of the second exon 89 encoding for tyrosine 63 was mutated to TTT coding for phenylalanine by site-directed mutagenesis. The construct was electroporated into murine 129Sv/J embryonic stem cells. Homologous recombinant clones were identified by Southern blot analysis. A positive ES cell clone was injected into blastocysts to generate germ line chimaeras. Mutant offspring were generated by inter-crossing with Meox-Cre transgenic mice to remove the first exons of 88 and 89. Homozygous Lrp1 knock-in mutant mice (Lrp1) were subsequently crossed to homozygous LDL receptor knockout mice (Ldlr) on a C57Bl/6J background. The resultant Lrp1 and Lrp1 (=Ldlr) and their offspring were used for further experimental analysis.

Bone marrow transplant

Bone marrow recipients (Ldlr mice) were treated twice with 500 rad with a 4 hr break between exposures. Bone marrow was flushed from the femurs, tibia and fibulas of donor mice (Ldlr or Lrp1 mice) using PBS with 2% FCS. The bone marrow suspension was passed three times through an 18 g needle to create a single cell suspension and filtered on a 100 uM cell filter. Suspension was centrifuged at 1000 g for 6 min then diluted to 2 × 107 cells/ml in low glucose DMEM. Recipient mice were anesthetized using isoflurane and received a 100 ul injection of the cell dilution via the retro-orbital plexus. Post-transplant recipient mice were housed in sterile caging and administered prophylactic antibiotics in their drinking water for two weeks, followed by the indicated diet for 16 weeks.

Primary cell derivation and culture

Primary mouse aortic smooth muscle cells were explanted from the thoracic aorta of 8–10 week old mice with indicated genotype, following the protocol by Clowes et al. (1994). Briefly, the aortas were dissected under sterile conditions and the connective tissue and adventitia were removed carefully. The aortas were opened longitudinally and the intimas were scraped on luminal surface. Then the aortas were minced into small pieces and placed into a T25 flask with high glucose (4.5 g/L) DMEM containing 15% FCS, 100 U/ml penicillin, 100 mg/ml streptomycin, 20 mM L-glutamine. Both explants and cells were cultured at 37°C in 5% CO2. Cells were detached by incubation with 0.25% trypsin-EDTA solution. Cell of passages 4–6 were used for the experiments under the indicated conditions. Mouse peritoneal macrophages from Ldlr and Lrp1 mice were isolated 3 days after intraperitoneal injection of 3% thioglycollate solution and cultured in RPMI-1640 Medium containing 10% FBS. After overnight starvation, macrophages were treated under the indicated conditions, followed by Oil Red O staining or lysis for western blot analysis. Oxidized LDL (oxLDL) was prepared from LDL isolated from human plasma, which was treated with 10 μM CuSO4 for 24 hr at 37°C and then dialyzed in 0.09% saline containing 0.24 mM EDTA.

Smooth muscle cell migration and proliferation assays

SMC migration was assayed using a 6.5 mm- Transwell with 8 µm polycarbonate pore membrane inserts (cat# 3422, Corning). 5 × 104 cells in 100 µl were loaded into the top chamber of each well while the lower chambers were filled with 0.5% DMEM with or without PDGF-BB (10 ng/ml). After incubating at 37°C in 5% CO2 for 6 hr, non-migrated cells were scraped from the upper surface of the membrane insert. Cells on the lower surface were fixed with methanol and stained with Harris Modified Hematoxylin (HHS-16, Sigma). The number of SMC on the lower surface of the membrane insert was determined by counting four continuous high-power (200×) fields of constant area per well. Experiments were performed three times in duplicate wells. For SMC proliferation assays, 5000 cells were seeded into each well of 96-well plates and starved for 24 hr. Cells were incubated with or without 10 ng/ml PDGF-BB for 24 hr and then stained using BrdU Cell Proliferation Assay Kit (cat# 6813, Cell Signaling Technology), following the instructions.

Atherosclerotic plaque analysis

After 16 weeks of HCHF diet feeding, mice were subjected to an overnight fasting period and were then euthanized with isoflurane. Blood samples were collected for future use. For tissue preparation, the heart and entire aorta to the iliac bifurcation were harvested after perfusion with phosphate buffered saline (PBS) followed by 4% paraformaldehyde (Electron Microscopy Sciences, Hatfield, PA). After 24 hr in 4% paraformaldehyde, tissues were stored in 30% sucrose solution in PBS until further analysis. Aortas were dissected and opened longitudinally under a dissection microscope (Model Z30L, Cambridge Instruments). Hearts were embedded in Tissue-Tek O.C.T. compound and frozen to −20°C for analysis of atherosclerotic lesions at the aortic root. Three 10 µm thick cryosections spaced 100 µm apart were used for analysis. To evaluate the lesion size, the cryosections and whole aorta were stained with Oil Red O or hematoxylin and eosin. Semi-quantitative immunostaining was performed using primary antibodies against Mac-3 (1:200; BD Pharmingen), α–smooth muscle actin (1:200; Abcam), ABCA1 (1:50; Novus Biologicals) or CD68 (1:50; Abcam) and fluorescently labeled secondary antibodies goat anti-rat Alexa Fluor 488 (Thermo Fisher Scientific, A11006), goat anti-rabbit Alexa Fluor 594 (Thermo Fisher Scientific, A11012), or goat anti-mouse Alexa Fluor 594 (Thermo Fisher Scientific, A11032). Nuclei were counterstained with DAPI (Thermo Fisher Scientific, P36935). Images were obtained with a Zeiss Axiophot microscope, and the percentage of lesion area that was positively stained was determined using Image-Pro v.6.2 (Media Cybernetics).

Apoptosis analysis in vivo and in vitro

Cryo-sections of aortic roots or mouse peritoneal macrophages were prepared as described above and were stained using an In Situ Cell Death Detection Kit, following the manufacture’s instructions. Briefly, tissues or cells were rinsed in PBS and fixed with 4% paraformaldehyde solution at room temperature for 15 min, followed by washing in PBS for 30 min. Samples were incubated with 0.1% Triton X-100 in cold PBS for 2 min and rinsed twice in PBS, then incubated with TUNEL reaction mixture for 1 hr at 37°C in a humidified chamber in the dark. Samples were washed twice in PBS and analyzed directly by fluorescence microscopy. Nuclei were counterstained with DAPI.

Real time PCR

Total RNA from peritoneal macrophages treated with or without oxLDL was isolated by using TRIzol Reagent (Life technologies) and cDNA was prepared with a RT-kit (Applied Biosystems). The expression levels of Abca1, Pparg, Nr1h3 and Nr2h2 were measured by RT-PCR on 7900HT Fast Real-time PCR system with SYBR Green reagents and the following primer sets: mouse Abca1 (Forward: 5’-CGTTTCCGGGAAGTGTCCTA-3’, Reverse: 5’-GCTAGAGATGACAAGGAGGATGGA-3’), mouse Abca7 (Forward: 5’- ATCCTAGTGGCTGTCCGTCA-3’, Reverse: 5’-ATGGCTTGTTTGGAAAGTGG-3’), mouse Pparg (Forward: 5’- CACAATGCCATCAGGTTTGG-3’, Reverse: 5’-GCTGGTCGATATCACTGGAGATC-3’), mouse Nr1h3 (Forward; 5’-TCTGGAGACGTCACGGAGGTA-3’, Reverse: 5’-CCCGGTTGTAACTGAAGTCCTT-3’), Nr2h2 (Forward: 5’-CTCCCACCCACGCTTACAC-3’, Reverse: 5’-GCCCTAACCTCTCTCCACTCA-3’) and mouse Cyclophilin (Forward: 5’-TGGAGAGCACCAAGACAGACA-3’, Reverse: 5’-TGCCGGAGTCGACAATGAT-3’), which was used as the internal standard.

Surface protein biotinylation

Mouse peritoneal macrophages were grown in 6-well culture dishes and cell surface proteins were biotinylated as previously described.(Ding et al., 2016) After ox-LDL treatment, macrophages were washed with cold PBS buffer and then incubated in PBS buffer containing 1.0 mg/ml sulfo-NHS-SS-biotin (Pierce) for 30 min at 4°C. Excess reagent was quenched by rinsing in cold PBS containing 100 mM glycine. Cell lysates were prepared in 160 μl of RIPA lysis buffer [50 mM Tris-HCl, 150 mM NaCl, 1% NP-40, 2 mM EDTA, 2 mM MgCl2, and protease inhibitor mixture (Sigma), (pH8.0)]. After 20 min incubated at 4°C, lysates were collected and centrifuged at 14,000 × rpm for 10 min. 100 μg of total proteins were incubated with 100 μl of NeutrAvidin agarose (Pierce) at 4°C for 1.5 hr. Agarose pellets were washed three times using washing buffer [500 mM NaCl, 150 mM Tris-HCl, 0.5% Triton X-100 (pH8.0)], biotinylated surface proteins were eluted from agarose beads by boiling in 2x SDS sample loading buffer. Protein were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), transferred to nitrocellulose, and blotted with different antibodies.

Cholesterol efflux assay

Peritoneal macrophages were seeded in 24-well plates, labeled with 2 μCi/ml [3H]cholesterol (cat# 8794, Sigma-Aldrich), and loaded with 100 μg/ml oxLDL for 24 hr. Cells were then washed and equilibrated with 0.2% BSA-DMEM medium overnight. To determine cholesterol efflux, medium containing 20 μg/ml free apoA-I or 25 μg/ml HDL was added to cells. After 4 hr, aliquots of the medium were collected, and the [3H]cholesterol released was measured by liquid scintillation counting. The [3H]cholesterol remaining in the cells was determined by extracting the cell lipids in 1N NaOH and measured by liquid scintillation counting. The cholesterol efflux capacity (efflux%) is expressed as medium count/(medium count +cell count) X 100%.

Plasma analysis

Plasma samples were obtained by cardiac puncture from mice fasted overnight. Total plasma cholesterol and triglyceride levels were determined by commercially available enzymatic kits (TR13421 and TR22421, Thermo Scientific, Waltham, MA) following manufacturer`s instructions. For lipoprotein profile analysis, plasma samples were prepared by using Microvette 500K3E EDTA-columns (Sarstedt, Germany) following the same procedure as described for serum. Plasma lipoproteins were fractionated by fast-protein liquid chromatography (FPLC) using a Superose six column (10/300 GL). Cholesterol and triglyceride content of all fractions was measured by using the same method as described for serum lipid levels.

Western blot

Briefly, 20 µg of protein extracted from specified tissues or primary cultured cells or 20 μl of fractionated plasma samples was loaded on SDS-PAGE gel (BioRad, Hercules, CA) and transferred to nitrocellulose membranes (HybondTM-C Extra. RPN303, Amersham Biosciences, Piscataway, NJ). Blots were developed, visualized, and analyzed using the LiCor Odyssey CLX or ECL.

Co-immunoprecipitation

Primary smooth muscle cells (SMC) were cultured in serum-deprived DMEM medium (4500 mg/L glucose, Sigma-Aldrich) for 24 hr and then treated with 10 ng/ml PDGF-BB for 10 min. To show reduced phosphorylation in Lrp1 SMC, membrane fractions were obtained. Briefly, cell pellets were homogenized in homogenization buffer (20 mM TrisCl, 2 mM MgCl2, 0.25M Sucrose, 10 mM EDTA, and 10 mM EGTA) and spun down at low speed at 800 g for 5 min. Supernatants were transferred to into new tubes for ultracentrifugation at 55,000 rpm for 30 min (MX-120, Thermo Scientific). After removal of the supernatant, the pellet was re-suspended in re-suspension buffer (50 mM TrisCl, 2 mM CaCl2, 80 mM NaCl, and 1% NP-40). 500 µg membrane protein extract was used for immunoprecipitation (IP) and pre-cleared with non-immune serum. Non-specific binding was precipitated with protein A DynaBeads (Invitrogen, Grand Island, NY). Supernatant was mixed with mouse anti-phospho-tyrosine antibody at 4°C for 4 hr, and precipitated with DynaBeads at 4°C overnight. The antigen-antibody-protein complex was washed three times with wash buffer (500 mM NaCl, 150 mM Tri-HCl, 0.5% Triton-X100, pH8.0). The washed antigen-antibody-protein complex was resolved on SDS-PAGE gel and immunoblotted with rabbit anti-LRP1 antibody. To show altered adaptor-protein binding properties in the Lrp1 knock in mutation, SMC were treated with 10 ng/ml PDGF BB for 10 min following a starvation period of 24 hr. Cells were cross-linked using 0.05 µM DSP (Thermo Scientific, Waltham, MA) for 30 min and lysed in PBS containing 1% TritonX with proteinase inhibitor cocktail and phosphatase inhibitor for 30 min. Immunoprecipitation and Western blots were performed as described for the reduced phosphorylation experiment with secondary antibodies against adaptor proteins Shc1 and Dab2. For the macrophage co-IP experiments, membrane proteins from macrophages were prepared as described above after oxLDL treatment (100 μg/ml) for 24 hr.

shRNA and lentivirus transduction

A pLKO.1 lentiviral vector expressing Shc1 shRNA (TRCN0000055180), with the functional sequence CCGGGCTGAGTATGTTGCCTATGTTCTCGAGAACATAGGCAACATACTCAGCTTTTTG, to target the Shc-1 gene sequence (GCTGAGTATGTTGCCTATGTT), was purchased from Sigma Aldrich (St. Louis, MO). The scramble shRNA was a gift from David Sabatini (Addgene plasmid #1864).(Sarbassov et al., 2005) The hairpin sequence was as follows: CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG. To generate lentiviral particles, HEK293T cells were co-transfected with the Shc1 shRNA lentiviral plasmid pLKO.1 and Lentiviral packaging mix (psPAX2, pMD2.G; Addgene) using Fugene 6 Transfection Reagent (Roche, Hamburg, German). Culture supernatants containing lentivirus were harvested 48 hr after transfection. For lentiviral transduction, primary macrophage cells were treated with either Shc1-shRNA lentivirus, or scramble shRNA lentivirus for 24 hr. After recovering from viral infection, cells were incubated in fresh RPMI-1640 Medium with 100 µg/mL oxLDL for 24 hr. Cells were then lysed and protein analysis was performed by western blotting.

Statistics

All values were expressed as mean ±SEM. Unpaired 2-tailed student's t test or two-way ANOVA test were used for statistical analysis. A P value less than 0.05 between two groups was considered significant.

Study approval

Animal procedures were performed according to protocols approved by the Institutional Animal Care and Use Committee (IACUC) at the University of Texas Southwestern Medical Center at Dallas. In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included. [Editors’ note: a previous version of this study was rejected after peer review, but the authors submitted for reconsideration. The first decision letter after peer review is shown below.] Thank you for choosing to send your work entitled "Tyrosine phosphorylation of the LRP1 intracellular domain regulates macrophage ABCA1 expression" for consideration at eLife. Your full submission has been evaluated by Gary Westbrook (Senior editor) and three peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the decision was reached after discussions between the reviewers. Based on our discussions and the individual reviews below, we regret to inform you that your work will not be considered further for publication in eLife. The reviewers appreciated the effort involved in the creation of the Lrp-1 mutant knock-in mice, and commented that the work described was of high quality. However, the consensus was that the results at the present stage are more appropriate for a specialty journal than for the general audience of eLife. The reviewers agreed that it was not possible to conclude definitively that macrophages were the cause of the phenotype described and that more direct assessment of macrophage lipid handling was needed. They also believed that more mechanistic insight into the connections between Lrp-1, ppar, lxr and Abca1 would be required for the paper to be appropriate for eLife. Reviewer #1: In this manuscript, the authors created a knock in mouse model expressing LRP1 lacking tyrosine phosphorylation (Y63F) in its NPxY motif. Mice harboring this mutation exhibited accelerated atherosclerosis. Macrophages isolated from these knock in animals had higher levels of lipid accumulation, and lower levels of ABCA1 expression. The authors showed that the interaction between Shc and LRP1 was dependent on the phosphorylation of Y63, and appeared to be essential for PI3 Kinase/Akt activation and PPARγ/LXRα driven expression of ABCA1. I have the following concerns regarding this manuscript. 1) More evidence is needed to attribute the atherosclerosis phenotype to the macrophages. a) The authors showed that the PDGF and TGFβ signaling in smooth muscle cells and the morphology of the aorta appeared to be normal in the Y63F knock in animals, and based on these observations excluded the contribution of smooth muscle cells to atherosclerosis. However, it is not known whether or not the Y63F mutation would lead to changes in smooth muscle cell function independent of the PDGF and TGFβ signaling pathways. b) In addition, the cholesterol metabolism in other tissues such as liver, intestine and adipose tissue was not characterized at all. It is not explained why the Y63F animals have higher plasma cholesterol. It is not clear whether these animals are more prone to developing atherosclerosis just because they have higher plasma LDL? To convincingly claim this is a macrophage caused phenotype, the authors need to do a bone marrow transplant experiment. 2) The authors demonstrated that ABCA1 expression was lower in Y63F macrophages, but they did not provide evidence that ABCA1 is a required factor for the atherosclerosis phenotype. It is not clear whether or not the inflammation and the apoptosis signaling pathways are altered in the Y63F macrophages. 3) There are issues in the characterization of the Y63F macrophages in this study: a) It is not clear whether or not the expression levels of the Y63F LRP1 are similar to the endogenous LRP1 in macrophages. b) The interaction between LRP1 and Shc presented in this study is from smooth muscle cells. It is not clear the same is true in macrophages. c) The uptake and efflux of lipids by the Y63F macrophages need to be assayed, not deduced from the protein levels of several lipid transporters. 4) It is not demonstrated how LRP1 is affecting PPARγ or LXRα transcriptional activity in the present study. Reviewer #2: This is a generally interesting set of studies linking LRP1 phosphorylation to macrophage ABCA1 expression/function. The authors propose that the increased atherosclerosis seen in a knock in mouse with a LRP1 that could not be phosphorylated on Y63 was due to decreased macrophage cholesterol efflux through ABCA1, leading to cholesteryl accumulation. The manuscript is well written and argued, but there are still some issues/questions: 1) Lipid metabolism issues: A) The plasma non-HDL lipid levels are higher in the knock in mice- how much of the increased atherosclerosis is simply from that factor? One way of testing this possibility would be to perform a correlation analysis combining data from all the mice and examining the relationship between the plasma values and plaque parameters. B) It is curious that the HDL peak is not apparent on the tracings. LDLr-/- mice have relatively normal HDL-C levels. C) Also related to HDL- ABCCA1 plays a key role in HDL biogenesis and since this is a global knock in, there would be an expected decrease in HDL formation when ABCA1 function/level is impaired. Was there evidence for this? 2) The argument that overall there were no effects on PDGF or TGFβ signaling by tyrosine phosphorylation was based on total aortic homogenate. Though not very likely, it is still possible that there were opposite effects in different cell types in the plaques, resulting in no net changes. Are there any immunohistochemical data on some accepted marker of these pathways to show no changes in SMC and macrophages? 3) Is there a mechanistic basis for the change in necrotic core. Based on the studies of Tabas and others, this may reflect the efferocytotic activity of macrophages- is there evidence in vitro or in vivo for a change in efferocytosis and a mechanistic basis for this? 4) ABCA1 function is also sensitive to its subcellular distribution. In either the in vitro or in vivo macrophages, is there a redistribution of ABCA1 related to LRP1 phosphorylation? 5) Are there other LXR/PPAR targets effected besides ABCA1?- in other words, how specific are the effects? One obvious one is apoE, which is also a macrophage efflux factor. 6) I think a valuable addition would be to use macrophages with the WT and mutant LRP1 in the "Rothblat-Rader" assay in which they are loaded ex vivo with cholesterol (labeled and cold), then injected ip into mice and the integrated RCT pathway assessed by fecal sterol excretion. The host mice should be both WT and knock in, to see if the effects on ABCA1 are at the level of the liver (for HDL formation) or macrophage (for efflux). Reviewer #3: The authors generated mice engineered to express LRP1 with impaired tyrosine phosphorylation of the cytoplasmic domain. These mice show increased atherosclerosis after western-type diet with increased plasma cholesterol and TG levels, and increased foam cell accumulation and necrosis in aortic lesions. The authors show that lack of tyrosine phosphorylation in macrophage LRP1 reduces ABCA1 expression by interrupting Shc-1 binding and AKT phosphorylation in vitro. They conclude that tyrosine phosphorylation of LRP1 in macrophages regulates cholesterol efflux and is essential to prevent atherosclerosis. 1) Increased atherosclerosis may simply be the consequence of differences in cholesterol and TG. Although the authors showed connections between impaired macrophage LRP1 tyrosine phosphorylation and ABCA1 expression, has reduced ABCA1 expression been shown in vivo in the mouse to cause atherosclerosis independent of plasma lipid levels? 2) The authors claim that LRP1 regulates cholesterol efflux. However, experiments to test efflux capacity by macrophages defective in LRP1 phosphorylation were not performed. 3) The claim that the lack of phosphorylation of LRP1 in SMC does not affect SMC function is not corroborated by data on function, as all they show is IP-WB and in vivo staining of SMC in the arterial wall. 4) Data of Figure 9 are less convincing than reported, and do not provide a mechanistic proof. [Editors’ note: what now follows is the decision letter after the authors submitted for further consideration.] Thank you for submitting your work entitled "Phosphorylation of the LRP1 NPxY motif protects against atherosclerosis by regulating macrophage cholesterol export" for consideration by eLife. Your article has been reviewed by three peer reviewers, and the evaluation has been overseen by a Reviewing Editor and a Senior Editor. The reviewers have opted to remain anonymous. Our decision has been reached after consultation between the reviewers. Based on these discussions and the individual reviews below, we regret to inform you that your work will not be considered further for publication in eLife. Summary The reviewers recognized and applauded the considerable amount of experimental data in this paper, but they were skeptical that the significant decrease in atherosclerosis in the mutant LRP mouse could be explained by changes in ABCA1 expression. Studies by the laboratory of John Parks have suggested that the impact of macrophage ABCA1 deficiency on atherosclerosis are modest. Addressing this issue in a definitive fashion would necessitate breeding double knockout mice. Also, the reviewers thought that it would be important to test whether restoring AKT expression would restore the perturbed expression of ABCA1. In online discussions, the reviewers suggested that the impact of the LRP mutation on efferocytosis was not well developed. Finally, multiple reviewers thought that the paper might be better suited for a specialty journal. Reviewer #2: The authors describe an elegant approach to analyzing the functions of the NPxY motif in the intracellular domain of LRP1 and uncover a number of interesting findings, including well defined lack of Shc1 binding, alterations in plasma lipoproteins and increases in atherosclerosis when mice are challenged with high fat/cholesterol/bile salt diet. Moreover, the increase in atherosclerosis is also seen in a bone marrow transplantation study. The authors also show that the mutation reduces Abca1 expression and impairs AKT responses to oxidized LDL in peritoneal macrophages. However, the main conclusion as stated in the title of the Abstract is not well supported by the data provided. 1) There is about a 40% reduction in Abca1 mRNA an protein in LRP mutant macrophages. What is Abca1 expression in plaques? The authors cite Aiello et al. who did an ABCA1 bone marrow transplantation study as evidence that macrophage ABCA1 deficiency is sufficient to explain the atherosclerosis phenotype. However, studies which more specifically examined the impact of myeloid/macrophage deficiency of ABCA1 (as opposed to whole bone marrow deficiency) revealed at best a minimal atherosclerosis phenotype (Bi et al., 2014). Thus it is unlikely that reduced macrophage Abca1 can explain the fairly dramatic atherosclerosis findings in the present study. The authors may wish to consider making a compound mouse with both the LRP1 mutation and ABCA1 deficiency if they wish to examine this issue more critically. 2) While it seems clear that the LRP1 mutation causes a reduced AKT response to oxLDL it is less clear that this causes the reduction in Abca1. The authors use high concentrations of AKT inhibitors to show reductions in Abca1 and there is concern about cell toxicity. In any event, a more informative experiment would be to restore AKT in LRP1 mutant cells (e.g. using Myr-AKT) to see if that reverses the defect in Abca1. 3) Information on sex, genetic background and housing of mice (littermates together?) does not seem to be provided. This is especially important for atherosclerosis studies. 4) Necrotic core area increase is proportional to the overall increase in lesion size. More direct methods to assess efferocytosis in plaques could be used if the authors feel this is an important part of the paper. Reviewer #3: I read carefully the responses to my original comments and also read the responses to the other reviewers. In general, the authors have tried to be very responsive, especially in regard to providing data to support their points and to address the issues raised. I feel that in the area of efferocytosis, some rigor is still lacking. They note that MerTK expression is lower, and state that the decrease in efferocytosis is likely attributed to Mertk dysfunction. Likely is not a direct link, and even if this were true, the mechanism linking the mutation in Lrp1 to decreased MerTK expression and possible function is not shown. Reviewer #4: The authors have addressed all of the comments I had raised and have produced a monumentally large revised manuscript that challenges the reader's attention span and is overly rich in figures. Figures 4, 6 and panel B of 13 are not essential. [Editors’ note: the author responses to the first round of peer review follow.] Reviewer #1: In this manuscript, the authors created a knock in mouse model expressing LRP1 lacking tyrosine phosphorylation (Y63F) in its NPxY motif. Mice harboring this mutation exhibited accelerated atherosclerosis. Macrophages isolated from these knock in animals had higher levels of lipid accumulation, and lower levels of ABCA1 expression. The authors showed that the interaction between Shc and LRP1 was dependent on the phosphorylation of Y63, and appeared to be essential for PI3 Kinase/Akt activation and PPARγ/LXRα driven expression of ABCA1. I have the following concerns regarding this manuscript. 1) More evidence is needed to attribute the atherosclerosis phenotype to the macrophages. a) The authors showed that the PDGF and TGFβ signaling in smooth muscle cells and the morphology of the aorta appeared to be normal in the Y63F knock in animals, and based on these observations excluded the contribution of smooth muscle cells to atherosclerosis. However, it is not known whether or not the Y63F mutation would lead to changes in smooth muscle cell function independent of the PDGF and TGFβ signaling pathways. Atherosclerosis is associated with a phenotypic switch in SMCs from a contractile to a synthetic phenotype, characterized by increased SMC migration and proliferation regulated by growth promoters such as PGFβ, TGFβ, endothelin-1 (ET-1), thrombin, FGF, IL-1 and nitric oxide (NO). Previous studies in SMCs demonstrated that LRP1 was critical for PDGF-induced cell proliferation and migration. We initially hypothesized that this may be dependent upon tyrosine phosphorylation of the LRP1 cytoplasmic domain. Therefore, we used the Transwell Migration assay and BrdU Proliferation Assay to compare the migratory and proliferative response of primary aortic smooth muscle cells explanted from wild type or LRP1Y63F mice to PDGFβ or TGFβ. As shown in Author response image 1, no difference in migration (A) or proliferation (B) was observed betweenwild type and LRP1Y63F smooth muscle cells.
Author response image 1.
This figure has been included in the manuscript as Figure 4D. b) In addition, the cholesterol metabolism in other tissues such as liver, intestine and adipose tissue was not characterized at all. It is not explained why the Y63F animals have higher plasma cholesterol. It is not clear whether these animals are more prone to developing atherosclerosis just because they have higher plasma LDL? To convincingly claim this is a macrophage caused phenotype, the authors need to do a bone marrow transplant experiment. As shown in Figure 2A, there was a slight increase in plasma cholesterol levels in LRP1Y63F;LDLR-/- on HFHC diet. To understand the source of elevated total cholesterol, we performed FPLC lipoprotein analysis, which showed that elevated plasma cholesterol levels in LRP1Y63F;LDLR-/- mice fed with HCHF diet were attributed to increased VLDL-cholesterol with slightly reduced LDL- and HDL-cholesterol contents (Author response image 1A). Moreover, plasma apoB48 concentrations were markedly increased, with a shift toward larger sizes of VLDL/LDL-containing fractions in LRP1Y63F;LDLR-/- mice compared to LDLR-/- mice on HCHF diet. These results suggested that the LRP1 Y63F mutation resulted in a modest decreased clearance of postprandial lipids. To definitively demonstrate that the proatherogenic phenotype is due to macrophage pathology rather than elevated plasma cholesterol levels, we generated a bone marrow transplant model wherein LDLR-/- or LRP1Y63F;LDLR-/- bone-marrow derived mononuclear cells were transplanted into irradiated LDLR-/- mice. These mice were then fed a HCHF diet for 16 weeks. As shown in Figure 6A, HCHF diet resulted in very high plasma cholesterol levels after radiation in all mice. However, there was no difference in plasma lipid and apolipoprotien levels between LDLR-/→LDLR-/- and LRP1Y63F;LDLR-/-→LDLR-/- mice (Author response image 1B, Figure 6 B, C, D). By comparing Figure 6C to Figure 2C (Author response image 1A and B), we demonstrated that bone marrow transplantation eliminated the difference in FPLC lipid profiles. This suggested that the difference in lipid profiles seen in LDLR-/- vs. LRP1Y63F;LDLR-/- mice is due to the effect of the systemic LRP1Y63F mutation in the liver. Since LRP1 is involved in hepatic chylomicron clearance as well as ABCA1 expression, and ABCA1 is substantially reduced in Y63F mutant livers (Figure 7), we suspect that the modest difference in the lipoprotein profiles is mostly due to these mutation-induced changes of hepatic LPR1 function and the concomitant reduction in ABCA1 expression in the liver, which generates a hypomorphic Tangier phenotype. The molecular mechanism leading to these changes in liver function will require further extensive studies, which will become the focus of one or more independent manuscripts. As shown in Figure 8, despite the dramatically elevated cholesterol levels in both LDLR-/-→LDLR-/- and LRP1Y63F;LDLR-/-→LDLR-/- mice on HCHF diet, only the LRP1Y63F;LDLR-/-→LDLR-/- on HCHF diet developed severe atherosclerosis (Author response image 2A and B). These results demonstrate that the LRP1Y63F mutation in macrophages is sufficient to cause the observed exaggerated atherosclerotic response, independent of the modestly elevated plasma cholesterol levels in the systemic mutant.
Author response image 2.
2) The authors demonstrated that ABCA1 expression was lower in Y63F macrophages, but they did not provide evidence that ABCA1 is a required factor for the atherosclerosis phenotype. It is not clear whether or not the inflammation and the apoptosis signaling pathways are altered in the Y63F macrophages. Recent studies with genetically engineered mice lacking or overexpressing ABCA1 provide evidence that ABCA1 modulates atherosclerosis susceptibility. For example, ApoE-/- mice lacking ABCA1 specifically in liver (HSKO), developed significantly larger atherosclerotic lesions than control apoE-/- mice after 12 weeks on chow diet, suggesting that hepatic ABCA1 is antiatherogenic. 1). Brunham LR1, Singaraja RR, Duong M, Timmins JM, Fievet C, Bissada N, Kang MH, Samra A, Fruchart JC, McManus B, Staels B, Parks JS, Hayden MR. Tissue-specific roles of ABCA1 influence susceptibility to atherosclerosis.Arterioscler Thromb Vasc Biol. 2009 Apr;29(4):548-54. Furthermore, specific disruption of ABCA1 in bone marrow–derived cells induced atherosclerotic lesion development whereas macrophage overexpression of ABCA1 resulted in decreased susceptibility to spontaneous atherosclerosis in apoE knockout mice and in C57BL/6 mice with diet-induced atherosclerosis. 2). Van Eck M1, Bos IS, Kaminski WE, Orsó E, Rothe G, Twisk J, Böttcher A, Van Amersfoort ES, Christiansen-Weber TA, Fung-Leung WP, Van Berkel TJ, Schmitz. Leukocyte ABCA1 controls susceptibility to atherosclerosis and macrophage recruitment into tissues. Proc Natl Acad Sci U S A. 2002 Apr 30;99(9):6298-303. Epub 2002 Apr 23. 3). Van Eck M1, Singaraja RR, Ye D, Hildebrand RB, James ER, Hayden MR, Van Berkel TJ. Macrophage ATP-binding cassette transporter A1 overexpression inhibits atherosclerotic lesion progression in low-density lipoprotein receptor knockout mice. Arterioscler Thromb Vasc Biol. 2006 Apr;26(4):929-34. As shown in Figure 5, TUNEL staining of aortic root sections from HCHF-fed LDLR-/- and LRP1Y63F;LDLR/- mice or oxLDL-treated peritoneal macrophages from LDLR-/- and LRP1Y63F;LDLR-/- mice show that LRP1Y63F;LDLR-/- mice have increased numbers of apoptotic cells. (Author response image 2 A and B). Previous studies have demonstrated that deficiency in Mertk is associated with increased macrophage apoptosis and decreased efferocytosis, leading to increased necrotic core in Apoe-/- mice. Similarly, we have shown that peritoneal macrophages from LRP1Y63F;LDLR-/- macrophages have decreased expression of Mertk both at baseline and in response to treatment with oxLDL (Author response image 2C). Therefore, increased necrotic core and apoptosis in the LRP1Y63F;LDLR-/- mice is likely attributed to Mertk dysfunction caused by the macrophage LRP1 mutation. 4). Scott RS1, McMahon EJ, Pop SM, Reap EA, Caricchio R, Cohen PL, Earp HS, Matsushima GK. Phagocytosis and clearance of apoptotic cells is mediated by MER. Nature. 2001 May 10;411(6834):207-11. 5). Li Y, Gerbod-Giannone MC, Seitz H, Cui D, Thorp E, Tall AR, Matsushima GK, Tabas I. Cholesterolinduced apoptotic macrophages elicit an inflammatory response in phagocytes, which is partially attenuated by the Mer receptor. J Biol Chem. 2006 Mar 10;281(10):6707-17. Epub 2005 Dec 27. 6). Thorp E1, Cui D, Schrijvers DM, Kuriakose G, Tabas I. Mertk receptor mutation reduces efferocytosis efficiency and promotes apoptotic cell accumulation and plaque necrosis in atherosclerotic lesions of apoe-/- mice. Arterioscler Thromb Vasc Biol. 2008 Aug;28(8):1421-8. 3) There are issues in the characterization of the Y63F macrophages in this study: a) It is not clear whether or not the expression levels of the Y63F LRP1 are similar to the endogenous LRP1 in macrophages. The endogenous LRP1 expression levels in LRP1Y63F;LDLR-/- macrophages were identical to those in the LDLR-/- macrophages. This data is also summarized in Figure 9D. b) The interaction between LRP1 and Shc presented in this study is from smooth muscle cells. It is not clear the same is true in macrophages. The co-immunoprecipitation was repeated in isolated peritoneal macrophages. Peritoneal macrophages were treated with oxLDL (100µg/mL) for 24 hours, followed by lysis and coimmunoprecipation. Similar to the case in SMCs, we found that the Y63F mutation impaired association of Shc1 with LRP1. This data has been included in Figure 13. c) The uptake and efflux of lipids by the Y63F macrophages need to be assayed, not deduced from the protein levels of several lipid transporters. To assess cholesterol efflux in macrophages, we performed cholesterol efflux experiments in peritoneal macrophages from LDLR-/- and LRP1Y63F;LDLR-/- mice using [[3]H] cholesterol. Compared with LDLR-/- macrophages, LRP1Y63F;LDLR-/- macrophages showed significantly reduced efflux [E%] of [[3]H] cholesterol to apoAI but not to HDL. This may contribute to increased intracellular lipid accumulation in LRP1Y63F;LDLR-/- macrophages when incubated with oxLDL. This data has been included in Figure 9B. 4) It is not demonstrated how LRP1 is affecting PPARγ or LXRα transcriptional activity in the present study. Our data in Figures 9–13 show that the LRP1Y63F mutation affects LXR and PPARγ activity, and that this is dependent on the upstream phosphorylation of Akt. Previous work by Andre Tremblay’s group revealed that activation of the PI3K/Akt pathway leads to Akt recruitment to PPARγ, leading to increased transcriptional activity of PPARγ and LXRα and subsequent increased expression of ABCA1. 1) Demers A1, Caron V, Rodrigue-Way A, Wahli W, Ong H, Tremblay A. A concerted kinase interplay identifies PPARgamma as a molecular target of ghrelin signaling in macrophages. PLoS One. 2009 Nov 4;4(11):e7728. Our studies first showed that LRP1Y63F;LDLR-/- mice had lower basal levels of ABCA1 and phosphorylated Akt levels both in the presence and absence of oxLDL (Figure 9C and 12A). We then determined that ABCA1 expression was increased by Rosiglitazone, T0901317, and LXR623 in a dose dependent manner in both LDLR-/- and LRP1Y63F;LDLR-/- macrophages. However, rescue with LXR and PPARγ agonists did not fully correct the blunted ABCA1 levels in the LRP1Y63F;LDLR-/- mice (Figure 11C-E). We further demonstrated that inhibition of PI3K/Akt results in incomplete induction of ABCA1 by both PPARγ (Figure 11A) and LXR agonists (Figure 11B), similar to what is observed in macrophages with the LRP1Y63F mutation (Figure 11C-D). Finally, we confirmed that binding of Shc1 to LRP1 was required for Akt phosphorylation in macrophages (Figure 13). The LRP1Y63F mutation, which precludes phosphorylation of the second NPxY motif of LRP1 and thus inhibits binding of Shc1, leads to reduced Akt phosphorylation in response to oxLDL. Taken together, the decreased induction of ABCA1 in response to oxLDL in LRP1Y63F;LDLR-/- macrophages is due to reduced Akt phosphorylation, which in turn modulates PPARγ/LXR-driven gene expression. Reviewer #2: This is a generally interesting set of studies linking LRP1 phosphorylation to macrophage ABCA1 expression/function. The authors propose that the increased atherosclerosis seen in a knock in mouse with a LRP1 that could not be phosphorylated on Y63 was due to decreased macrophage cholesterol efflux through ABCA1, leading to cholesteryl accumulation. The manuscript is well written and argued, but there are still some issues/questions: 1) Lipid metabolism issues: A) The plasma non-HDL lipid levels are higher in the knock in mice- how much of the increased atherosclerosis is simply from that factor? One way of testing this possibility would be to perform a correlation analysis combining data from all the mice and examining the relationship between the plasma values and plaque parameters. B) It is curious that the HDL peak is not apparent on the tracings. LDLr-/- mice have relatively normal HDL-C levels. C) Also related to HDL- ABCCA1 plays a key role in HDL biogenesis and since this is a global knock in, there would be an expected decrease in HDL formation when ABCA1 function/level is impaired. Was there evidence for this? A) See reviewer #1 comments 1b. B) We collected fresh plasma from additional mice and repeated the FPLC experiments. As shown in the Author response image 1, LDLR-/- mice have a higher HDL-C peak than LRP1Y63F;LDLR-/- mice (A) while there is no difference of HDL-C levels between two bone marrow transplantation groups (B). This suggests that the small differences in lipid profile between LDLR-/- and LRP1Y63F;LDLR-/- mice are due to effects of the systemic LRP1Y63F mutation. Since LRP1 is essential in hepatic chylomicron clearance and also for hepatic ABCA1 expression (Figure 7), we conclude that the Y63F mutation may affect hepatic clearance of VLDL as well as HDL catabolism, thus accounting for the difference between LDLR-/- and LRP1Y63F;LDLR-/- mice and the bone marrow transplant mice. These corrected data are included in Figure 2. C) To support our hypothesis that the changes in lipoprotein profile are due to deficiency in hepatic LRP1, we also found that hepatic ABCA1 levels were significantly reduced in LRP1Y63F;LDLR-/- mice compared to LDLR-/- mice (Figure 7, panel A), while there was no difference between two BMT groups (Figure 7, panel B). 2) The argument that overall there were no effects on PDGF or TGFβ signaling by tyrosine phosphorylation was based on total aortic homogenate. Though not very likely, it is still possible that there were opposite effects in different cell types in the plaques, resulting in no net changes. Are there any immunohistochemical data on some accepted marker of these pathways to show no changes in SMC and macrophages? We appreciatethe comment that there may be cell-type dependent differences. This has also now been included into the discussion. In Figure 4B, we found no difference in markers of PDGF signaling in total aortic homogenate. In Figure 4C, we demonstrated that there was no difference in PDGF mediated signaling in smooth muscle cells explanted from the respective mouse aortas. We have focused primarily on PDGF mediated signaling, since this pathway, leading to mitogenic signaling, has been implicated in atherosclerosis. 3) Is there a mechanistic basis for the change in necrotic core. Based on the studies of Tabas and others, this may reflect the efferocytotic activity of macrophages- is there evidence in vitro or in vivo for a change in efferocytosis and a mechanistic basis for this? See reviewer #1 comment 2. 4) ABCA1 function is also sensitive to its subcellular distribution. In either the in vitro or in vivo macrophages, is there a redistribution of ABCA1 related to LRP1 phosphorylation? The ratio of surface/total ABCA1 in LRP1Y63F;LDLR-/- macrophages was similar to that in LDLR-/- microphages, although the levels of surface and total ABCA1 were both reduced in LRP1Y63F;LDLR-/- macrophages. This suggests that the LRP1Y63F mutation results in decreased ABCA1 expression rather than deficiency of ABCA1 transport to the cell surface. This data has been included in Figure 9D. 5) Are there other LXR/PPAR targets effected besides ABCA1?- in other words, how specific are the effects? One obvious one is apoE, which is also a macrophage efflux factor. As shown in the Author response image 3,after incubation with oxLDL for 24 hours, the mRNA levels of Abca1 and Lpl were significantly reduced in LRP1Y63F;LDLR-/- macrophages, with a similar trend for a reduction of Apoe mRNA levels that, however, did not reach significance, compared to LDLR-/- microphages. All 3 genes are downstream targets of LXR. However, Abca1 expression and ABCA1mediated cholesterol export showed the most dramatic changes in response to LRP1 mutation and oxLDL, and this effect is confirmed at the protein expression level by western blot (Figure 9C).
Author response image 3.
6) I think a valuable addition would be to use macrophages with the WT and mutant LRP1 in the "Rothblat-Rader" assay in which they are loaded ex vivo with cholesterol (labeled and cold), then injected ip into mice and the integrated RCT pathway assessed by fecal sterol excretion. The host mice should be both WT and knock in, to see if the effects on ABCA1 are at the level of the liver (for HDL formation) or macrophage (for efflux). These points have been addressed by the cholesterol efflux study (please see reviewer #1 comment 3c) and the bone marrow transplant model (please see reviewer #1 comment 1b). Reviewer #3: The authors generated mice engineered to express LRP1 with impaired tyrosine phosphorylation of the cytoplasmic domain. These mice show increased atherosclerosis after western-type diet with increased plasma cholesterol and TG levels, and increased foam cell accumulation and necrosis in aortic lesions. The authors show that lack of tyrosine phosphorylation in macrophage LRP1 reduces ABCA1 expression by interrupting Shc-1 binding and AKT phosphorylation in vitro. They conclude that tyrosine phosphorylation of LRP1 in macrophages regulates cholesterol efflux and is essential to prevent atherosclerosis. 1) Increased atherosclerosis may simply be the consequence of differences in cholesterol and TG. Although the authors showed connections between impaired macrophage LRP1 tyrosine phosphorylation and ABCA1 expression, has reduced ABCA1 expression been shown in vivo in the mouse to cause atherosclerosis independent of plasma lipid levels? See responses above and reviewer #1 comments 1b. 2) The authors claim that LRP1 regulates cholesterol efflux. However, experiments to test efflux capacity by macrophages defective in LRP1 phosphorylation were not performed. See responses above and reviewer #1 comment 3c. 3) The claim that the lack of phosphorylation of LRP1 in SMC does not affect SMC function is not corroborated by data on function, as all they show is IP-WB and in vivo staining of SMC in the arterial wall. See responses above and reviewer #1 comment 1a. 4) Data of Figure 9 are less convincing than reported, and do not provide a mechanistic proof. We have performed additional experiments to demonstrate that the Y63F mutation inhibits binding of Shc1 to LRP1 in macrophages (Figure 13A) and have proposed a mechanism consistent with our data and the relevant literature in Figure 14. LRP1 tyrosine phosphorylation is necessary for interaction with Shc1, which in turn activates PI3K/Akt signaling. Phospho-Akt modulates PPARγ/LXR driven Abca1 gene transcription and is necessary for the full effect of ox-LDL and PPARγ/LXR induced expression of ABCA1 to mediate cholesterol efflux. Inhibition of PI3K/Akt (using LY294002 or Akt inhibitor) results in only partial induction of Abca1 in response to ox-LDL and PPARγ/LXR agonists (rosiglitazone, T0901317, LXR623). (B) In the absence of LRP1 tyrosine phosphorylation, as in the case of the LRP1Y63F mutation, Dab2 rather than Shc1 associates with LRP1. Lack of the interaction with Shc1 decreases p-Akt, which in turn decreases Abca1 gene transcription, even in the presence of ox-LDL and PPARγ/LXR agonists, similar to what is observed in LRP1 wild type cells treated with PI3K/Akt inhibitors. Ultimately, decreased ABCA1 expression leads to impaired cholesterol efflux, thus accelerating atherogenesis. [Editors' note: the author responses to the re-review follow.] Summary The reviewers recognized and applauded the considerable amount of experimental data in this paper, but they were skeptical that the significant decrease in atherosclerosis in the mutant LRP mouse could be explained by changes in ABCA1 expression. Studies by the laboratory of John Parks have suggested that the impact of macrophage ABCA1 deficiency on atherosclerosis are modest. Addressing this issue in a definitive fashion would necessitate breeding double knockout mice. Also, the reviewers thought that it would be important to test whether restoring AKT expression would restore the perturbed expression of ABCA1. In online discussions, the reviewers suggested that the impact of the LRP mutation on efferocytosis was not well developed. Finally, multiple reviewers thought that the paper might be better suited for a specialty journal. Reviewer #2: The authors describe an elegant approach to analyzing the functions of the NPxY motif in the intracellular domain of LRP1 and uncover a number of interesting findings, including well defined lack of Shc1 binding, alterations in plasma lipoproteins and increases in atherosclerosis when mice are challenged with high fat/cholesterol/bile salt diet. Moreover, the increase in atherosclerosis is also seen in a bone marrow transplantation study. The authors also show that the mutation reduces Abca1 expression and impairs AKT responses to oxidized LDL in peritoneal macrophages. However, the main conclusion as stated in the title of the Abstract is not well supported by the data provided. 1) There is about a 40% reduction in Abca1 mRNA an protein in LRP mutant macrophages. What is Abca1 expression in plaques? The authors cite Aiello et al. who did an ABCA1 bone marrow transplantation study as evidence that macrophage ABCA1 deficiency is sufficient to explain the atherosclerosis phenotype. However, studies which more specifically examined the impact of myeloid/macrophage deficiency of ABCA1 (as opposed to whole bone marrow deficiency) revealed at best a minimal atherosclerosis phenotype (Bi et al., 2014). Thus it is unlikely that reduced macrophage Abca1 can explain the fairly dramatic atherosclerosis findings in the present study. The authors may wish to consider making a compound mouse with both the LRP1 mutation and ABCA1 deficiency if they wish to examine this issue more critically. 2) While it seems clear that the LRP1 mutation causes a reduced AKT response to oxLDL it is less clear that this causes the reduction in Abca1. The authors use high concentrations of AKT inhibitors to show reductions in Abca1 and there is concern about cell toxicity. In any event, a more informative experiment would be to restore AKT in LRP1 mutant cells (e.g. using Myr-AKT) to see if that reverses the defect in Abca1. 3) Information on sex, genetic background and housing of mice (littermates together?) does not seem to be provided. This is especially important for atherosclerosis studies. 4) Necrotic core area increase is proportional to the overall increase in lesion size. More direct methods to assess efferocytosis in plaques could be used if the authors feel this is an important part of the paper. Reviewer #3: I read carefully the responses to my original comments and also read the responses to the other reviewers. In general, the authors have tried to be very responsive, especially in regard to providing data to support their points and to address the issues raised. I feel that in the area of efferocytosis, some rigor is still lacking. They note that MerTK expression is lower, and state that the decrease in efferocytosis is likely attributed to Mertk dysfunction. Likely is not a direct link, and even if this were true, the mechanism linking the mutation in Lrp1 to decreased MerTK expression and possible function is not shown. Reviewer #4: The authors have addressed all of the comments I had raised and have produced a monumentally large revised manuscript that challenges the reader's attention span and is overly rich in figures. Figures 4, 6 and panel B of 13 are not essential. First, I want to thank you for giving us the opportunity to resubmit our manuscript formerly entitled “Phosphorylation of the LRP1 NPxY motif protects against atherosclerosis by regulating macrophage cholesterol export” and now entitled “LRP1 integrates macrophage cholesterol homeostasis and inflammatory responses in atherosclerosis”. Next, I should apologize if you found the tone of my previous letter not appropriate or helpful. It was borne out of the frustrations I and my coauthors felt as we were trying to make sense of the erratic appearance of the reviewers’ criticism, who appeared to question the role of ABCA1 in reverse cholesterol transport and atherosclerosis while every single published paper we were able to find reported the exact opposite, consistent with our own findings. Your editorial summary has now made this a lot clearer and we have revised the manuscript along these lines, after reconfirming and adding additional data to address specific reviewers’ concerns and questions. In addition, and specifically in order to address the misconception that macrophage ABCA1 plays no role in atherosclerosis, I am attaching a clarifying letter by my colleague and coauthor, John Parks, who also is the senior author of the Bi et al. study on which the reviewers had based their assessment. We hope that letter clarifies that our conclusions are in no way in conflict with the Bi et al. study. At this point let me emphasize again: The main thrust of our present manuscript was not to investigate the role of ABCA1 in atherosclerosis, which we had considered a settled issue and for which we have abundantly cited the pertinent literature. The main point of our study was to investigate the consequences of the tyrosine phosphorylation in the cytoplasmic domain of LRP1, which we find protects from atherosclerosis by activating a signaling axis that includes Shc1, PI3K, Akt, and PPARγ and which results in the boosting of the atheroprotective expression of LXR target genes. ABCA1 is a major LXR target and one that has been clearly shown to be atheroprotective by itself in numerous independent studies in the mouse and in humans (including in the Bi et al. study). The major difference between the ABCA1 knockout models, which show reduced VLDL production and thus have a less atherogenic plasma lipoprotein profile, and our LRP1 knockin mouse is that the former are lacking ABCA1 completely in their monocytes/macrophages, while in our model ABCA1 expression is reduced with lower, but clearly present, residual cholesterol export activity. Therefore, circulating monocytes, which do not have to deal with the excessive cholesterol-loading that resident macrophages in atherosclerotic lesions have to cope with, would be less prone to convert to an inflammatory phenotype than monocytes that completely lack ABCA1. In the course of being fed an atherogenic diet high in cholesterol the latter – but not the LRP1 mutant monocyte/macrophages that express ABCA1 merely at a lower level – would be unable to export the excess cholesterol taken up from the circulation through passive or active receptor-mediated mechanisms. This resulted in the increased expression of inflammatory cytokines, which reduced VLDL secretion by the liver through mechanisms that remain incompletely understood. In support of this interpretation of the data, Bi and colleagues found that in the absence of excess cholesterol feeding, inflammatory cytokine expression by genetically ABCA1-deficient monocyte/macrophages subsided, resulting in a normal lipoprotein profile, which now unmasked the previously occluded atheroprotective effect of macrophage ABCA1. The Bi et al. paper clearly states this, as the accompanying letter by Dr. Parks also confirms. We hope you and the reviewers will accept this detailed explanation of what the reviewers felt was an apparent conflict with the prior literature. However, there is actually no conflict. While we could put this detailed explanation into the discussion of the manuscript, we feel that this would merely distract from the main topic of the article, which is the tyrosine phosphorylationdependent LRP1 signaling axis, and send the discussion off onto an irrelevant tangent. We have thus addressed this minor issue only briefly by stating “Our results, which show an identical atherogenic lipoprotein profile upon cholesterol-feeding of LDLR-/- mice transplanted with LDLR-/- or LDLR-/-;LRP1Y63F bone marrow, differ from those of Bi et al., who showed reduced plasma lipid levels in mice lacking ABCA1 completely in their monocytes/macrophages. In their model, elevated plasma cholesterol levels and the resulting cholesterol overload led to the secretion of inflammatory cytokines, which subsided on a low cholesterol chow diet. In our case, monocyte/macrophages carrying the Y63F mutation in LRP1 retained residual, though substantially lower, ABCA1 expression, which would protect the circulating cells from cholesterol overload in a hyperlipidemic, cholesterol-fed state.” In addition to these specific changes, we have substantially rewritten the entire manuscript to emphasize the role of the novel LRP1/Shc/PI3K/Akt/PPARγ/LXR axis in the regulation of atheroprotective gene expression, in complete agreement with the seminal work by Peter Tontonoz and colleagues. We have striven to deemphasize the spotlight which was previous focused perhaps too prominently upon ABCA1 and instead have greatly broadened our discussion and interpretation of our results. In addition, we have discussed the documented roles of LRP1 in the suppression of the inflammatory response and in efferocytosis, as so elegantly described by Ira Tabas and his group. In support of our conclusions, especially the role of ABCA1 for the protection from atherosclerosis, we have also cited the comprehensive work and reviews from Alan Tall and colleagues and from Michael Hayden’s group. A fascinating topic, and one we would love to continue to explore, ideally in collaboration with the Tabas laboratory, is the role of the LRP1 tyrosine phosphorylation in efferocytosis. Given the sheer amount of work we have reported here, however, this is unfortunately far beyond the scope of the present study. However, our new animal model, reported here, will now open the door to explore this avenue.
  70 in total

1.  Enhanced foam cell formation, atherosclerotic lesion development, and inflammation by combined deletion of ABCA1 and SR-BI in Bone marrow-derived cells in LDL receptor knockout mice on western-type diet.

Authors:  Ying Zhao; Marieke Pennings; Reeni B Hildebrand; Dan Ye; Laura Calpe-Berdiel; Ruud Out; Martin Kjerrulf; Eva Hurt-Camejo; Albert K Groen; Menno Hoekstra; Wendy Jessup; Giovanna Chimini; Theo J C Van Berkel; Miranda Van Eck
Journal:  Circ Res       Date:  2010-11-11       Impact factor: 17.367

2.  Coordinate regulation of forskolin-induced cellular proliferation in macrophages by protein kinase A/cAMP-response element-binding protein (CREB) and Epac1-Rap1 signaling: effects of silencing CREB gene expression on Akt activation.

Authors:  Uma K Misra; Salvatore V Pizzo
Journal:  J Biol Chem       Date:  2005-09-19       Impact factor: 5.157

3.  Cytosolic phospholipase A2 is coupled to hormonally regulated release of arachidonic acid.

Authors:  L L Lin; A Y Lin; J L Knopf
Journal:  Proc Natl Acad Sci U S A       Date:  1992-07-01       Impact factor: 11.205

4.  Phagocytosis and clearance of apoptotic cells is mediated by MER.

Authors:  R S Scott; E J McMahon; S M Pop; E A Reap; R Caricchio; P L Cohen; H S Earp; G K Matsushima
Journal:  Nature       Date:  2001-05-10       Impact factor: 49.962

5.  Up-regulation of ATP binding cassette transporter A1 expression by very low density lipoprotein receptor and apolipoprotein E receptor 2.

Authors:  Xinping Chen; Zhongmao Guo; Emmanuel U Okoro; Hongfeng Zhang; LiChun Zhou; Xinhua Lin; Allman T Rollins; Hong Yang
Journal:  J Biol Chem       Date:  2011-12-14       Impact factor: 5.157

6.  Combined deficiency of ABCA1 and ABCG1 promotes foam cell accumulation and accelerates atherosclerosis in mice.

Authors:  Laurent Yvan-Charvet; Mollie Ranalletta; Nan Wang; Seongah Han; Naoki Terasaka; Rong Li; Carrie Welch; Alan R Tall
Journal:  J Clin Invest       Date:  2007-12       Impact factor: 14.808

7.  Inhibition of ABCA1 protein degradation promotes HDL cholesterol efflux capacity and RCT and reduces atherosclerosis in mice.

Authors:  LinZhang Huang; BaoYan Fan; Ang Ma; Philip W Shaul; HaiBo Zhu
Journal:  J Lipid Res       Date:  2015-03-11       Impact factor: 5.922

8.  LXRβ/estrogen receptor-α signaling in lipid rafts preserves endothelial integrity.

Authors:  Tomonori Ishikawa; Ivan S Yuhanna; Junko Umetani; Wan-Ru Lee; Kenneth S Korach; Philip W Shaul; Michihisa Umetani
Journal:  J Clin Invest       Date:  2013-07-08       Impact factor: 14.808

9.  Insulin-like growth factor-I stimulates Shc-dependent phosphatidylinositol 3-kinase activation via Grb2-associated p85 in vascular smooth muscle cells.

Authors:  Yashwanth Radhakrishnan; Laura A Maile; Yan Ling; Lee M Graves; David R Clemmons
Journal:  J Biol Chem       Date:  2008-04-16       Impact factor: 5.157

10.  Apoptotic cells promote their own clearance and immune tolerance through activation of the nuclear receptor LXR.

Authors:  Noelia A-Gonzalez; Steven J Bensinger; Cynthia Hong; Susana Beceiro; Michelle N Bradley; Noam Zelcer; Jose Deniz; Cristina Ramirez; Mercedes Díaz; German Gallardo; Carlos Ruiz de Galarreta; Jon Salazar; Felix Lopez; Peter Edwards; John Parks; Miguel Andujar; Peter Tontonoz; Antonio Castrillo
Journal:  Immunity       Date:  2009-07-30       Impact factor: 31.745

View more
  25 in total

Review 1.  Intracellular and Intercellular Aspects of Macrophage Immunometabolism in Atherosclerosis.

Authors:  Ira Tabas; Karin E Bornfeldt
Journal:  Circ Res       Date:  2020-04-23       Impact factor: 17.367

2.  Deletion of Macrophage Low-Density Lipoprotein Receptor-Related Protein 1 (LRP1) Accelerates Atherosclerosis Regression and Increases C-C Chemokine Receptor Type 7 (CCR7) Expression in Plaque Macrophages.

Authors:  Paul A Mueller; Lin Zhu; Hagai Tavori; Katherine Huynh; Ilaria Giunzioni; John M Stafford; MacRae F Linton; Sergio Fazio
Journal:  Circulation       Date:  2018-10-23       Impact factor: 29.690

3.  LRP1 Deficiency in Vascular SMC Leads to Pulmonary Arterial Hypertension That Is Reversed by PPARγ Activation.

Authors:  Laurent Calvier; Philippe Boucher; Joachim Herz; Georg Hansmann
Journal:  Circ Res       Date:  2019-04-26       Impact factor: 17.367

Review 4.  Updates of Recent Aortic Aneurysm Research.

Authors:  Frank M Davis; Alan Daugherty; Hong S Lu
Journal:  Arterioscler Thromb Vasc Biol       Date:  2019-03       Impact factor: 8.311

5.  TLR4 (Toll-Like Receptor 4)-Dependent Signaling Drives Extracellular Catabolism of LDL (Low-Density Lipoprotein) Aggregates.

Authors:  Rajesh K Singh; Abigail S Haka; Arky Asmal; Valéria C Barbosa-Lorenzi; Inna Grosheva; Harvey F Chin; Yuquan Xiong; Timothy Hla; Frederick R Maxfield
Journal:  Arterioscler Thromb Vasc Biol       Date:  2019-10-10       Impact factor: 8.311

6.  Macrophage LRP1 (Low-Density Lipoprotein Receptor-Related Protein 1) Is Required for the Effect of CD47 Blockade on Efferocytosis and Atherogenesis-Brief Report.

Authors:  Paul A Mueller; Yoko Kojima; Katherine T Huynh; Richard A Maldonado; Jianqin Ye; Hagai Tavori; Nathalie Pamir; Nicholas J Leeper; Sergio Fazio
Journal:  Arterioscler Thromb Vasc Biol       Date:  2021-11-11       Impact factor: 8.311

7.  Low-density lipoprotein receptor-related protein-1 dysfunction synergizes with dietary cholesterol to accelerate steatohepatitis progression.

Authors:  Allyson N Hamlin; Sivaprakasam Chinnarasu; Yinyuan Ding; Xunde Xian; Joachim Herz; Anja Jaeschke; David Y Hui
Journal:  J Biol Chem       Date:  2018-05-11       Impact factor: 5.157

8.  Intracellular lipid metabolism impairs β cell compensation during diet-induced obesity.

Authors:  Risheng Ye; Ruth Gordillo; Mengle Shao; Toshiharu Onodera; Zhe Chen; Shiuhwei Chen; Xiaoli Lin; Jeffrey A SoRelle; Xiaohong Li; Miao Tang; Mark P Keller; Regina Kuliawat; Alan D Attie; Rana K Gupta; William L Holland; Bruce Beutler; Joachim Herz; Philipp E Scherer
Journal:  J Clin Invest       Date:  2018-02-19       Impact factor: 14.808

9.  Myeloid-Specific Deletion of Epsins 1 and 2 Reduces Atherosclerosis by Preventing LRP-1 Downregulation.

Authors:  Megan L Brophy; Yunzhou Dong; Huan Tao; Patricia G Yancey; Kai Song; Kun Zhang; Aiyun Wen; Hao Wu; Yang Lee; Marina V Malovichko; Srinivas D Sithu; Scott Wong; Lili Yu; Olivier Kocher; Joyce Bischoff; Sanjay Srivastava; MacRae F Linton; Klaus Ley; Hong Chen
Journal:  Circ Res       Date:  2019-02-15       Impact factor: 17.367

Review 10.  Efferocytosis in health and disease.

Authors:  Amanda C Doran; Arif Yurdagul; Ira Tabas
Journal:  Nat Rev Immunol       Date:  2019-12-10       Impact factor: 53.106

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.