Literature DB >> 29133885

A conserved stem of the Myxococcus xanthus sRNA Pxr controls sRNA accumulation and multicellular development.

Yuen-Tsu N Yu1,2, Elizabeth Cooper3, Gregory J Velicer4,5.   

Abstract

The small RNA (sRNA) Pxr negatively controls multicellular fruiting body formation in the bacterium Myxococcus xanthus, inhibiting the transition from growth to development when nutrients are abundant. Like many other prokaryotic sRNAs, Pxr is predicted to fold into three stem loops (SL1-SL3). SL1 and SL2 are highly conserved across the myxobacteria, whereas SL3 is much more variable. SL1 is necessary for the regulatory function of Pxr but the importance of SL3 in this regard is unknown. To test for cis genetic elements required for Pxr function, we deleted the entire pxr gene from a developmentally defective strain that fails to remove Pxr-mediated blockage of development and reintroduced variably truncated fragments of the pxr region to test for their ability to block development. These truncations demonstrated that SL3 is necessary for Pxr function in the defective strain. We further show that a highly conserved eight-base-pair segment of SL3 is not only necessary for Pxr to block development in the defective strain under starvation conditions, but is also required for Pxr to prevent fruiting body development by a developmentally proficient wild-type strain under high-nutrient conditions. This conserved segment of SL3 is also necessary for detectable levels of Pxr to accumulate, suggesting that this segment either stabilizes Pxr against premature degradation during vegetative growth or positively regulates its transcription.

Entities:  

Mesh:

Substances:

Year:  2017        PMID: 29133885      PMCID: PMC5684412          DOI: 10.1038/s41598-017-15439-w

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


Introduction

Small RNAs (sRNA) play major roles in bacterial gene regulation[1-3], including in the Gram-negative myxobacteria, which cooperatively construct multicellular fruiting bodies in response to starvation[4,5]. By base-pairing with mRNAs, sRNAs can modulate protein translation and mRNA degradation. The sRNA Pxr in the model myxobacterium Myxococcus xanthus was previously found to regulate the transition from vegetative growth when nutrients are abundant to the initiation of fruiting body development upon starvation[4]. Deletion of pxr from the developmentally proficient lab reference strain GJV1 causes robust fruiting body development and high levels of spore production when growth substrate is abundant, whereas GJV1 undergoes development only when growth resources are scarce or absent. Pxr is produced in two forms, one long (Pxr-L) and one short (Pxr-S), with Pxr-L presumably being processed by a ribonuclease to Pxr-S. Pxr-S appears to be the active form of Pxr blocking development, as Pxr-S levels are rapidly diminished in response to early developmental signals upon onset of starvation whereas Pxr-L remains present at high levels throughout development[4]. The pxr gene appears to have originated in the base lineage of the Myxococcales suborder Cystobacterineae, as pxr homologs were found in almost all examined species within this suborder[6]. Divergent homologs from several Cystobacterineae species, including Stigmatella aurantiaca, as well as the inferred ancestral allele, have been shown to effectively control development in M. xanthus [7], thus indicating that pxr is likely to play a similar role in controlling development across species. pxr appears to have co-evolved with genes encoding a two-component regulatory system that are present upstream of pxr in all myxobacterial species examined to date[8]. This conserved two-component system (pxrR/pxrK) has been shown to regulate Pxr synthesis and processing[8]. Pxr was identified due to a spontaneous mutation that restored developmental proficiency to the developmentally defective strain OC[9]. OC is a descendant of the developmentally-proficient lab reference strain GJV1 and evolved during 1000 generations of vegetative growth in a high-nutrient liquid environment[10]. During that evolution experiment, the OC lineage accumulated 14 mutations[11] and concomitantly lost the ability to effectively develop and produce heat-resistant spores[10]. During a subsequent competition experiment, a spontaneous mutation in an OC cell restored developmental proficiency to the resulting mutant, PX[9]. That mutation occurred within the loop of the first of three predicted stem-loop structures (SL1-SL3) of Pxr and inactivated Pxr function[4]. Strain OC is defective at development because Pxr-mediated blockage of development is not alleviated upon starvation (Fig. 1a). Deletion of pxr from OC removes that blockage and allows development to proceed[4] (Fig. 1b), as does either deletion of the SL1 loop[8] or a single-base substitution in the fifth base of that loop (C to A)[4]. Thus, Pxr SL1 is essential for control of M. xanthus development. While the functional roles of specific sequence elements in some non-coding regulatory sRNAs in other bacteria have been explored extensively[12], it remains unknown whether other segments of the predicted Pxr structure other than SL1 are necessary for Pxr function. Here we examine the functional effects of a series of deletions from the 3′ end of the pxr coding region, including deletions that remove part or all of SL3, as well as deletion of a highly conserved eight base-pair segment of the SL3 stem.
Figure 1

Model of the Pxr-mediated defect in OC development. (a) In this model, strain OC is developmentally defective (no fruiting body formation on starvation plates, see image on right (scale bar ~1 mm)) because it fails to relay an early developmental signal that normally deactivates the functional form of Pxr sRNA, which blocks development during vegetative growth in developmentally proficient strains. Therefore, Pxr remains present in OC even under starvation and thereby continues to block development. (b) Deletion of the Pxr coding gene from OC alleviates negative regulation and thus allows development to proceed. In the image to the right, fruiting bodies form on starvation plates (especially clusters of intertwined fruiting bodies linked together at the edge of the spotted starving population that forms a darkened circle indicated by an arrow).

Model of the Pxr-mediated defect in OC development. (a) In this model, strain OC is developmentally defective (no fruiting body formation on starvation plates, see image on right (scale bar ~1 mm)) because it fails to relay an early developmental signal that normally deactivates the functional form of Pxr sRNA, which blocks development during vegetative growth in developmentally proficient strains. Therefore, Pxr remains present in OC even under starvation and thereby continues to block development. (b) Deletion of the Pxr coding gene from OC alleviates negative regulation and thus allows development to proceed. In the image to the right, fruiting bodies form on starvation plates (especially clusters of intertwined fruiting bodies linked together at the edge of the spotted starving population that forms a darkened circle indicated by an arrow).

Results

The third stem loop of Pxr is required for control of development

We constructed several plasmids carrying sequences that all begin at the same position within the 3′-terminal region of the pxrR gene (previously known as Mxan_1078 and nla19)[8]. pxrR lies immediately upstream of pxr and is predicted to encode an NtrC-like response regulator that is part of a two-component signal transduction system along with the predicted histidine kinase gene pxrK (previously known as Mxan_1077)[8]. These plasmids extend variable lengths to include either the entire predicted pxr coding region (pPxr, pPxr+36 and pPxr+75) or only 5′ portions of pxr lacking part or all of SL3 (pPxr-27 and pPxr−46). Plasmids pPxr+36 and pPxr+75 include sequence extending 36 and 75 bases beyond the predicted 3′ end of pxr, respectively. Additionally, a plasmid carrying sequence also starting from the same position in pxrR as the other plasmids but not including the pxr coding sequence (pPxrΔ) was constructed as a control to test for any effect of plasmid-vector integration. All of these plasmids were integrated into a mutant of strain OC from which the pxr coding sequence was deleted (OC Δpxr) but which still retains the intergenic sequence between pxrR and pxr, thus creating merodiploids for the pxr region (Fig. 2a). All of the resulting transformants share the same 167 bp 3′ terminal sequence of pxrR and the 260-bp region upstream of pxr, including its predicted σ54 promoter and the upstream enhancer binding region.
Figure 2

Pxr SL3 is necessary for inhibition of development and accumulation of Pxr. (a) A diagram of the pxr region for each pxr derivative (left) and each strain’s corresponding developmental phenotype on TPM plates (right). The opened and dotted rectangles represent the pxrR and Mxan_1079 genes, respectively. Red arrows represent the annotated pxr coding region and red lines without an arrow indicate truncated alleles. Blue lines indicate intergenic regions. The positions from which pxr was deleted are represented by double vertical lines and the positions of plasmid integration are represented by brackets. Strains lacking pxr (OC Δpxr, OC Δpxr::pPxrΔ) or part or all of SL3 (OC Δpxr::pPxr−27, OC Δpxr::pPxr−46) produce darkened fruiting bodies (indicated by arrows) whereas the three strains containing complete copies of pxr (OC Δpxr::pPxr, OC Δpxr::pPxr+36, OC Δpxr::pPxr+75) do not (scale bar ~1 mm). (b) The predicted secondary structure of Pxr. The locations of the C-A substitution and 8-nt deletion that restore high sporulation to strain OC[4,9] are shown in red. The positions of 3′ primers used for generating respective pxr-truncated constructs (pPxr, pPxr−27 and pPxr−46) are shown with blue arrows. (c) Deletion of pxr from OC allows OC Δpxr to restore sporulation, whereas integration of three plasmids carrying the entire pxr gene (pPxr, pPxr+36 and pPxr+75) suppresses sporulation. Integration of plasmids carrying pxr fragments lacking either the entire third stem-loop sequence (pPxr−46) or only the third loop and right side of the corresponding stem (pPxr−27) fails to control development, as does integration of the vector-only control pPxrΔ. Error bars represent 95% confidence intervals and black downward arrows indicate the absence of spores at the limit of detection (also in Figs 2d and 4a). (d) GJV1 Δpxr can sporulate in the presence of abundant nutrients while GJV1 cannot. The introduction of a functional copy of pxr restores Pxr-mediated blockage of development at high nutrient levels. (e) Pxr accumulation patterns from Northern-blot analysis of strains GJV1 (lane 1), OC Δpxr::pPxr+36 (lanes 2 and 3), OC Δpxr::pPxr+75 (lane 4), OC Δpxr::pPxr (lane 5), OC Δpxr::pPxr−27 (lane 6), OC pxr::pPxr−46 (lane 7) and OC Δpxr (lane 8). The asterisk indicates bands due to non-specific binding to the Pxr probe.

Pxr SL3 is necessary for inhibition of development and accumulation of Pxr. (a) A diagram of the pxr region for each pxr derivative (left) and each strain’s corresponding developmental phenotype on TPM plates (right). The opened and dotted rectangles represent the pxrR and Mxan_1079 genes, respectively. Red arrows represent the annotated pxr coding region and red lines without an arrow indicate truncated alleles. Blue lines indicate intergenic regions. The positions from which pxr was deleted are represented by double vertical lines and the positions of plasmid integration are represented by brackets. Strains lacking pxr (OC Δpxr, OC Δpxr::pPxrΔ) or part or all of SL3 (OC Δpxr::pPxr−27, OC Δpxr::pPxr−46) produce darkened fruiting bodies (indicated by arrows) whereas the three strains containing complete copies of pxr (OC Δpxr::pPxr, OC Δpxr::pPxr+36, OC Δpxr::pPxr+75) do not (scale bar ~1 mm). (b) The predicted secondary structure of Pxr. The locations of the C-A substitution and 8-nt deletion that restore high sporulation to strain OC[4,9] are shown in red. The positions of 3′ primers used for generating respective pxr-truncated constructs (pPxr, pPxr−27 and pPxr−46) are shown with blue arrows. (c) Deletion of pxr from OC allows OC Δpxr to restore sporulation, whereas integration of three plasmids carrying the entire pxr gene (pPxr, pPxr+36 and pPxr+75) suppresses sporulation. Integration of plasmids carrying pxr fragments lacking either the entire third stem-loop sequence (pPxr−46) or only the third loop and right side of the corresponding stem (pPxr−27) fails to control development, as does integration of the vector-only control pPxrΔ. Error bars represent 95% confidence intervals and black downward arrows indicate the absence of spores at the limit of detection (also in Figs 2d and 4a). (d) GJV1 Δpxr can sporulate in the presence of abundant nutrients while GJV1 cannot. The introduction of a functional copy of pxr restores Pxr-mediated blockage of development at high nutrient levels. (e) Pxr accumulation patterns from Northern-blot analysis of strains GJV1 (lane 1), OC Δpxr::pPxr+36 (lanes 2 and 3), OC Δpxr::pPxr+75 (lane 4), OC Δpxr::pPxr (lane 5), OC Δpxr::pPxr−27 (lane 6), OC pxr::pPxr−46 (lane 7) and OC Δpxr (lane 8). The asterisk indicates bands due to non-specific binding to the Pxr probe.
Figure 4

The conserved 8-bp portion of the Pxr SL3 stem (SL3:8 bp) is necessary for Pxr function. (a) An allele of pxr lacking the conserved 8-bp segment (pxr^) fails to block sporulation when integrated into OC Δpxr. (b) Developmental phenotypes on 0.3% casitone CTT agar. GJV1 Δpxr and GJV1 Δpxr::pPxr^ form darkened fruiting bodies (a single fruiting body is indicated by an arrow) whereas GJV1 does not. GJV1 forms only translucent mounds, but not opaque fruiting bodies (scale bar ~1 mm). (c) Northern blot analysis of Pxr accumulation in liquid CTT medium. Pxr transcript does not accumulate to visibly detectable levels in GJV1 Δpxr::pPxr^ but is present at high levels in both forms (Pxr-L and Pxr-S) in GJV1. The asterisk indicates bands due to non-specific binding to the Pxr probe.

As reported previously[4], deletion of pxr from OC (strain OC Δpxr) restores fruiting body development and spore production to high levels relative to OC (which fails to aggregate into visible fruiting bodies and makes zero or few spores under standard developmental conditions (Figs 1 and 2a,c)). As expected, integration of the negative control plasmid pPxrΔ lacking pxr into OC Δpxr did not eliminate fruiting body formation or reduce spore production in the resulting transformant (Fig. 2a,c). Additionally, integration of all three plasmids carrying the entire pxr coding region (pPxr, pPxr+36 and pPxr+75) into OC Δpxr resulted in blockage of both fruiting body formation (Fig. 2a) and spore production (Fig. 2c), indicating that pxr is functionally expressed. Unlike complete copies of pxr, fragments of pxr lacking half or all of SL3 (pPxr−27 and pPxr−46, respectively) were unable to block development (Fig. 2a). Transformants produced spores at levels similar to those of GJV1 and OC Δpxr (Fig. 2c). The experiments above were all performed in the context of the OC genomic background, which differs from its evolutionary ancestor GJV1 by 14 known mutations[11]. As shown both previously[4] and here, deletion of pxr from GJV1 (creating strain GJV1 Δpxr) causes development to proceed and produces heat-resistant spores in the presence of abundant nutrients (e.g. 0.3% casitone, Fig. 2d), indicating that pxr controls the transition of M. xanthus from growth on abundant nutrients to development in response to starvation. To demonstrate that the results above are not likely to be specific to the OC background, we introduced a full copy of pxr on plasmid pPxr into strain GJV1 Δpxr. If the introduced pxr is active and performs the same function as the original native pxr, fruiting body development and spore production should be blocked. Indeed this is the case, as integration of pPxr restored pxr blockage of high-nutrient development, whereas integration of the corresponding plasmid vector lacking any pxr sequence (pPxrΔ) did not (Fig. 2d).

The third stem loop of Pxr is essential for Pxr accumulation

Consistent with our developmental assays, integration of all three plasmids carrying the entire pxr gene into OC Δpxr resulted in accumulation of high levels of Pxr-S, the short active form of Pxr that negatively regulates development (Fig. 2e, lanes 2–5). In contrast, integration of the two plasmids lacking part or all of SL3 (pPxr−27 and pPxr−46), yielded no visible Pxr transcript of the expected sizes (Fig. 2e, lanes 6–7). Rather, the respective transformants showed the same transcriptional profile as the control strain lacking pxr (Fig. 2e, lane 8), thus suggesting that the Pxr transcripts lacking part or all of SL3 may be unstable. Interestingly, levels of the long form of Pxr, Pxr-L, were much lower in the merodiploids transformed with plasmids that included both the entire predicted pxr gene and a downstream extension (Fig. 2e, lanes 2–4) than were present in the transformant carrying only pxr with no extension (Fig. 2e, lane 5). This result implies that the region extending 36 bp downstream of the predicted pxr coding sequence reduces Pxr-L accumulation, but only in the context of these merodiploid transformants of OC Δpxr. Additionally, the accumulated levels of Pxr-L in all three merodiploids (Fig. 2e, lanes 2–5) bearing the pxr gene were significantly lower than that found in the control strain GJV1 (Fig. 2e, lane 1). This reduction may be due to the second copy of the pxr promoter and the upstream enhancer-binding region preceding the pxr-deleted allele in the merodiploids (Fig. 2a) that may sequester important transcription factors such as PxrR and sigma factor away from transcribing the functional Pxr.

A conserved 8-bp segment of Pxr SL3 is essential for blockage of development in both the OC and GJV1 genomic backgrounds

Comparison of pxr sequences across a phylogenetically diverse range of myxobacterial species revealed a highly conserved 8-bp segment within the Pxr SL3 stem (Fig. 3, the boxed region in the sequence alignment and within the simulated SL3). We therefore tested whether this stem segment is necessary for Pxr function by constructing an allele of pxr lacking the respective 16 bases (pxr^, Fig. 3b). Integrating of the plasmid carrying this allele (pPxr^) into OC Δpxr failed to block sporulation (Fig. 4a). Thus, like the two pxr alleles lacking either the entire SL3 sequence (pxr ) or the 3′-terminal half of SL3 (pxr ) (Fig. 2a,c), pxr^ is non-functional and the conserved 8-bp segment of the SL3 stem appears to be essential for Pxr function.
Figure 3

Comparative analysis of pxr sequences across the myxobacteria reveals a highly conserved segment of the predicted third stem-loop structure. (a) Sequence alignment of 14 myxobacterial pxr homologs. Two segments of eight bases (boxed regions) that are complementary are predicted to form the core of the third Pxr stem and are conserved across nine highly diverse species of myxobacteria, whereas other portions of this stem and the corresponding loop are less conserved. (Corallococcus = Corallococcus collaroides strain DSM 2259, Ccm = M. macrosporus, Mxf = M. fulvus, Mxfl = M. flavescens, Mxs = M. stipitatus, Mxv = M. virescens, Stigmatella = Stigmatella aurantiaca strain DW4/3–1. Strain sources are listed in Table 1 of Chen et al.[6]. Asterisks indicate bases conserved across all homologs. Parentheses indicate complementary pairing. (b) The diagram shows the position of the highly conserved 8-bp stem (boxed) located in the third stem loop of the predicted Pxr secondary structure.

Comparative analysis of pxr sequences across the myxobacteria reveals a highly conserved segment of the predicted third stem-loop structure. (a) Sequence alignment of 14 myxobacterial pxr homologs. Two segments of eight bases (boxed regions) that are complementary are predicted to form the core of the third Pxr stem and are conserved across nine highly diverse species of myxobacteria, whereas other portions of this stem and the corresponding loop are less conserved. (Corallococcus = Corallococcus collaroides strain DSM 2259, Ccm = M. macrosporus, Mxf = M. fulvus, Mxfl = M. flavescens, Mxs = M. stipitatus, Mxv = M. virescens, Stigmatella = Stigmatella aurantiaca strain DW4/3–1. Strain sources are listed in Table 1 of Chen et al.[6]. Asterisks indicate bases conserved across all homologs. Parentheses indicate complementary pairing. (b) The diagram shows the position of the highly conserved 8-bp stem (boxed) located in the third stem loop of the predicted Pxr secondary structure.
Table 1

Plasmid, strain and primer information.

PlasmidDescriptionReference
pCR-BluntCloning/integrative vectorInvitrogen
pPxr+75 The insert is amplified by primers GV367 + 371. It contains 167 bp of Mxan_1078 3′-terminus, the entire 413 bp intergenic region bearing the entire pxr coding sequence and 32 bp of the Mxan_1079 5′- terminus.This work
pPxr+36 The insert is amplified by primers GV367 + 492. It contains 167 bp of Mxan_1078 3′-terminus and 407 bp of intergenic sequence ending 7 bp upstream of the Mxan_1079 start codon. It bears the entire pxr coding sequence.This work
pPxrThe insert is amplified by primers GV367 + 611. It contains 167 bp of Mxan_1078 3′-terminus and 370 bp of intergenic sequence ending 44 bp upstream of the Mxan_1079 start codon. It bears the entire predicted pxr coding sequence.This work
pPxr−27 The insert is amplified by primers GV367 + 612. It contains 167 bp of Mxan_1078 3′-terminus and 343 bp intergenic sequence ending 71 bp upstream of the Mxan_1079 start codon. It is missing the second half of SL3.This Work
pPxr−46 The insert is amplified by primers GV367 + 613. It contains 167 bp of Mxan_1078 3′-terminus and 324 bp intergenic sequence ending 90 bp upstream of the Mxan_1079 start codon. It is missing most of SL3.This work
pPxrΔ The insert is amplified by primers GV367 + 490. It contains 167 bp of Mxan_1078 3′-terminus and 260 bp of intergenic sequence ending 154 bp upstream of the Mxan_1079 start codon. It is missing the entire pxr coding sequence.This work
pPxr^The insert is amplified by primers GV367 + 683. It contains 167 bp of the Mxan_1078 3′-terminus and 354 bp of intergenic sequence ending 44 bp upstream of the Mxan_1079 start codon. Is it missing the 8-bp conserved segment of the SL3 stem (SL3:8 bp).This work
Strain Description Reference
Top10 E.coli strain for plasmid constructionInvitrogen
GJV1WT M. xanthus strain, a derivative of DK1622 10,18
GJV1 Δpxr GJV1 with the entire pxr gene deleted 4
OCKanamycin-resistance marked derivative of obligate cheater strain GVB207.3 (aka GJV32) 4,9
GVB207.3unmarked version of OC 4,9
OC Δpxr GVB207.3 with the entire pxr gene deleted 4
OC Δpxr::pPxr+75 OC Δpxr with plasmid pPxr+75 integrated at the native pxr locusThis work
OC Δpxr::pPxr+36 OC Δpxr with plasmid pPxr+36 integrated at the native pxr locusThis work
OC Δpxr::pPxrΔ OC Δpxr with plasmid pPxrΔ integrated at the native pxr locusThis work
OC Δpxr::pPxrOC Δpxr with plasmid pPxr integrated at the native pxr locusThis work
OC Δpxr::pPxr−27 OC Δpxr with plasmid pPxr−27 integrated at the native pxr locusThis work
OC Δpxr::pPxr−46 OC Δpxr with plasmid pPxr−46 integrated at the native pxr locusThis work
OC Δpxr::pPxr^OC Δpxr with plasmid pPxr^ integrated at the native pxr locusThis work
GJV1 ::pPxrGJV1 with plasmid pPxr integrated at the native pxr locusThis work
GJV1 ::pPxrΔ GJV1 with plasmid pPxrΔ integrated at the native pxr locusThis work
GJV1 Δpxr::pPxrGJV1 Δpxr with plasmid pPxr integrated at the native pxr locusThis work
GJV1 Δpxr::pPxrΔ GJV1 Δpxr with plasmid pPxrΔ integrated at the native pxr locusThis work
GJV1 Δpxr::pPxr^GJV1 Δpxr with plasmid pPxr^ integrated at the native pxr locusThis work
Primer Sequence
GV367CCCAGGTGGTGGAAGAGG
GV371CGCAGCACCCACTGAGATTC
GV492CTTTCGTCGCGAGCCGAG
GV490CGATGTGTCCCGCGCATTCC
GV611AAAAGAAGGCGGCCCGACAC
GV612AGGTGCCGGGCCGCGGGTC
GV613TTCTCAAGGTGACTCACCGG
GV683AAAAGAAGACACCCCAAAGAGGTGCG
GGTCTTCTCAAGGTGACTCACC
The conserved 8-bp portion of the Pxr SL3 stem (SL3:8 bp) is necessary for Pxr function. (a) An allele of pxr lacking the conserved 8-bp segment (pxr^) fails to block sporulation when integrated into OC Δpxr. (b) Developmental phenotypes on 0.3% casitone CTT agar. GJV1 Δpxr and GJV1 Δpxr::pPxr^ form darkened fruiting bodies (a single fruiting body is indicated by an arrow) whereas GJV1 does not. GJV1 forms only translucent mounds, but not opaque fruiting bodies (scale bar ~1 mm). (c) Northern blot analysis of Pxr accumulation in liquid CTT medium. Pxr transcript does not accumulate to visibly detectable levels in GJV1 Δpxr::pPxr^ but is present at high levels in both forms (Pxr-L and Pxr-S) in GJV1. The asterisk indicates bands due to non-specific binding to the Pxr probe. We also asked whether deletion of the conserved segment of SL3 would eliminate Pxr function in the GJV1 genomic background. To do so, we integrated pPxr^ into GJV1 Δpxr and tested for fruiting-body formation under high-nutrient conditions. In the presence of abundant nutrients, GJV1 does not form darkened fruiting bodies due to blockage of development by pxr but GJV1 Δpxr does (Fig. 4b). Integration of pPxr^ into GJV1 Δpxr failed to restore the blockage of fruiting body development under high-nutrient conditions and showed the same phenotype as GJV1 Δpxr (Fig. 4b). Northern-blot analysis revealed that the 8-bp conserved segment of SL3 is necessary for accumulation of Pxr transcript, as no Pxr transcript of any size was observed for GJV1 Δpxr::pPxr^ (Fig. 4c). This segment of the SL3 stem might affect Pxr-transcript accumulation either by stabilizing Pxr-L once it has been produced or by facilitating transcription of pxr.

Discussion

Non-coding sRNAs primarily modulate expression of target genes by base-pairing to their mRNAs and thus causing mRNA degradation or altered protein translation[1,2]. Pxr sRNA is highly expressed in the vegetative stage and processed into the putative active smaller form (Pxr-S) to presumably either directly repress developmental genes or enhance the expression of other developmental inhibitors when nutrients are abundant[4]. However, the direct targets of Pxr (if multiple) and their relationships to genes known to positively regulate the early stages of development remain under investigation. To facilitate better understanding of how Pxr regulates development, we sought to identify segments pivotal to its function. Our results demonstrate the necessity of Pxr SL3 for regulating the Pxr-mediated developmental pathway. Most studies examining functional components of sRNA regulators have focused on sRNA interactions with regulatory targets (e.g. sequences involved in sRNA binding)[13-15]. In the case of Pxr, however, we have identified a highly conserved 8-bp segment within the third predicted stem loop (SL3:8 bp) that appears to be essential in maintaining levels of Pxr sufficient for effective negative regulation of fruiting body development. In particular, deletion of the invariable 8-bp stem abolishes the accumulation of Pxr transcripts and results in a pxr-null phenotype. Comparison across all known pxr alleles exclusively identified in myxobacteria showed that the most variable sequences are located in the annotated SL3 (despite the highly conserved 8-bp segment core) while SL1 and SL2 are much more conserved as a whole[6]. Mutation or deletion within the loop of SL1 eliminates the negative regulatory function of pxr, but does not prevent accumulation of high levels of Pxr transcript, indicating that SL1 plays a key role in Pxr functionality, but not in its transcription or in its stability[4,8]. Such SL1-mediated Pxr functionality may involve target pairing or RNA-chaperone binding (although M. xanthus does not carry a homolog of hfq [16]). In contrast to the effects of a deletion in the SL1 loop[8], deletion of SL3:8 bp in the GJV1 background strongly affects sRNA accumulation (Fig. 4c), which reflects a balance between sRNA synthesis and decay. The necessity of SL3:8 bp for Pxr accumulation might be due to an autoregulatory effect on transcription, as occurs with some other sRNAs[17,18]. However, there is no evidence to suggest this scenario. In particular, the response regulator pxrR, which has been shown to regulate pxr transcription[8], is not predicted to be a target of Pxr (unpublished results). Alternatively, it is possible that SL3:8 bp is a critical determinant of Pxr stability, such that Pxr transcripts of pxr^ are synthesized but rapidly degrade and are thus not detected on Northern blots. If the SL3:8 bp segment is crucial in protecting the transcripts from ribonuclease attack either by shielding the RNA from ribonuclease binding or by interacting with protective proteins, it is expected that deletion of SL3:8 bp will severely diminish Pxr accumulation. In E. coli, Hfq together with ribonucleases such as PNPase (polynucleotide phosphorylase) and RNasePH have been shown to stabilize some sRNAs and facilitate regulation of their targets[19,20]. In Pseudomonas putita, Hfq and Crc bind to CrcZ sRNA and protect it from degradation[21]. However, in those studies the sRNA regions conferring protection against degradation remain elusive. It has been documented that Hfq can recognize the 3′-polyU region of SgrS sRNA to maintain its stability[22]. While there is no homolog of hfq gene found in myxobacteria, it is possible that some myxobacteria proteins other than Hfq can perform a chaperone-like function to promote sRNA stability. Further analysis of the functional role of SL3:8 bp may identify any such chaperone-like proteins and provide further insights regarding how levels of the myxobacterial sRNA Pxr are regulated during the transition from growth to development.

Methods

Strain and plasmid descriptions and primer sequences used in this work are listed in Table 1. Plasmid, strain and primer information.

Development assays and sporulation efficiency

The developmental phenotypes of the pxr-derivative strains as well as the controls were examined on TPM[23] 1.5% agar starvation plates. Mid-log phase cultures grown in CTT[24] medium were centrifuged and resuspended in TPM liquid to a density of ~5 × 109 cells/ml. 50 µl of resuspended culture were spotted onto TPM agar plates and incubated at 32 °C. After four or five days, images of developmental phenotypes were taken with a Zeiss Stemi 2000 stereomicroscope. At day five of development the developing populations were harvested into 1 ml of ddH2O, incubated at 50 °C for two hours, sonicated twice for 10 seconds to disperse heat-resistant spores. All sonicated samples were serially diluted in ddH2O and then plated into CTT soft (0.5%) agar. The number of spores produced by each strain was calculated by multiplying the colony count of germinated spores on CTT soft agar by the relevant dilution factor. Development assays were performed in four temporally independent replicates for the experiments reported in Fig. 2c and two replicates for the experiments reported in Figs 2d and 4a.

Northern-blot analysis of Pxr sRNA

Pxr sRNA generated from each strain was analysed in a Northern-blot assay described previously[4]. Total RNA was prepared from mid-log phase cultures growing in CTT medium and small RNA fragments (<200 nt) were prepared with the MirVana miRNA isolation kit (Ambion). RNA concentrations were estimated by a NanoDrop spectrophotometer (Thermo Scientific). Equal amounts of RNA (0.7 μg) were electrophoresed in a 10% SequaGel (National Diagnostics). RNA transcripts were electro-transferred onto a BrightStar®-Plus positively charged nylon membrane (Ambion) at 180 mA for one hour and were fixed onto the membrane with a UV cross-linker. The membrane was hybridized with 100 pmol 3′Biotin-TEG-pxr oligo probe (Sigma, the probe is complementarily base-paired to the sequences within SL1) in 5 ml of UltraHyb-Oligo buffer (Ambion) overnight at 37 °C after completing pre-hybridization in 4 ml of UltraHyb-Oligo buffer for one hour at 37 °C. The positions and relative content of Pxr RNAs were detected and visualized with BrightStar® Biodetect non-isotopic kit (Ambion).

Plasmid and strain construction

All plasmids were cloned by a similar procedure. The Pxr sRNA coding region is mapped within a 413-bp intergenic region between Mxan_1078 and Mxan_1079 [4,9]. To make plasmids containing a series of the pxr 3′-terminal truncations, pxr fragments were first PCR-amplified using the same upstream primer located 167-bp upstream of the Mxan_1078 stop codon (GV367) and a series of downstream primers that generated fragments of desired length (Table 1). The resulting PCR fragments were gel-purified, cloned into the pCR-Blunt (Invitrogen) vector and were verified by sequencing. The downstream primers were designed to generate two fragments containing the complete predicted pxr coding region plus extensions of different length beyond the predicted end of pxr (pPxr+75 and pPxr+36), one fragment containing the entire pxr gene with no extension (pPxr), two fragments lacking part of the pxr gene (pPxr−27, which lacks the SL3 loop and the downstream portion of the SL3 stem, and pPxr−46, which lacks the entire predicted SL3 sequence) and one fragment lacking the complete pxr gene (pPxrΔ). To generate pPxr^ bearing the pxr derivative devoid of an 8-bp segment of the SL3 stem, a 48-mer primer missing the 16 respective nucleotides (GV683) was used together with GV367 to generate the PCR insert. All of the plasmids described above thus contain a region homologous to the M. xanthus GJV1/OC genomes (ranging from 427 bp to 612 bp in length) that allows integration via single crossing-over to generate cognate mero-diploid pxr-derivative constructs (Fig. 2a). The end positions of the 3′ primers used to generate inserts for plasmids pPxr, pPxr−27 and pPxr−46 on the predicted three-stem-loop structure of Pxr are shown in Fig. 2b.
  24 in total

Review 1.  Bacterial small RNA regulators: versatile roles and rapidly evolving variations.

Authors:  Susan Gottesman; Gisela Storz
Journal:  Cold Spring Harb Perspect Biol       Date:  2011-12-01       Impact factor: 10.005

Review 2.  Small RNA regulators and the bacterial response to stress.

Authors:  S Gottesman; C A McCullen; M Guillier; C K Vanderpool; N Majdalani; J Benhammou; K M Thompson; P C FitzGerald; N A Sowa; D J FitzGerald
Journal:  Cold Spring Harb Symp Quant Biol       Date:  2006

3.  DsrA RNA regulates translation of RpoS message by an anti-antisense mechanism, independent of its action as an antisilencer of transcription.

Authors:  N Majdalani; C Cunning; D Sledjeski; T Elliott; S Gottesman
Journal:  Proc Natl Acad Sci U S A       Date:  1998-10-13       Impact factor: 11.205

4.  PolyU tail of rho-independent terminator of bacterial small RNAs is essential for Hfq action.

Authors:  Hironori Otaka; Hirokazu Ishikawa; Teppei Morita; Hiroji Aiba
Journal:  Proc Natl Acad Sci U S A       Date:  2011-07-25       Impact factor: 11.205

5.  Evolution of sensory complexity recorded in a myxobacterial genome.

Authors:  B S Goldman; W C Nierman; D Kaiser; S C Slater; A S Durkin; J A Eisen; J Eisen; C M Ronning; W B Barbazuk; M Blanchard; C Field; C Halling; G Hinkle; O Iartchuk; H S Kim; C Mackenzie; R Madupu; N Miller; A Shvartsbeyn; S A Sullivan; M Vaudin; R Wiegand; H B Kaplan
Journal:  Proc Natl Acad Sci U S A       Date:  2006-10-02       Impact factor: 11.205

6.  Adaptive evolution of an sRNA that controls Myxococcus development.

Authors:  Yuen-Tsu N Yu; Xi Yuan; Gregory J Velicer
Journal:  Science       Date:  2010-05-21       Impact factor: 47.728

Review 7.  Regulation by small RNAs in bacteria: expanding frontiers.

Authors:  Gisela Storz; Jörg Vogel; Karen M Wassarman
Journal:  Mol Cell       Date:  2011-09-16       Impact factor: 17.970

8.  Spontaneous Reversions of an Evolutionary Trait Loss Reveal Regulators of a Small RNA That Controls Multicellular Development in Myxobacteria.

Authors:  Yuen-Tsu N Yu; Manuel Kleiner; Gregory J Velicer
Journal:  J Bacteriol       Date:  2016-11-04       Impact factor: 3.490

9.  Loss of social behaviors by myxococcus xanthus during evolution in an unstructured habitat.

Authors:  G J Velicer; L Kroos; R E Lenski
Journal:  Proc Natl Acad Sci U S A       Date:  1998-10-13       Impact factor: 11.205

10.  Effect of Crc and Hfq proteins on the transcription, processing, and stability of the Pseudomonas putida CrcZ sRNA.

Authors:  Sofía Hernández-Arranz; Dione Sánchez-Hevia; Fernando Rojo; Renata Moreno
Journal:  RNA       Date:  2016-10-24       Impact factor: 4.942

View more
  1 in total

1.  Mutation of rpoB Shifts the Nutrient Threshold Triggering Myxococcus Multicellular Development.

Authors:  Sabrina A Eisner; Gregory J Velicer; Yuen-Tsu N Yu
Journal:  Front Microbiol       Date:  2022-03-03       Impact factor: 5.640

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.