Literature DB >> 29118933

Prevalence of cytotoxin-associated genes of Helicobacter pylori among Iranian GERD patients.

Aref Shavalipour1, Habib Malekpour2, Hossein Dabiri1,2, Hossein Kazemian3, Homayon Zojaji4, Mahboube Bahroudi4.   

Abstract

AIM: Since the impact of H. pylori and its virulence is not clear in GERD, this study aimed to evaluate the prevalence of cag A and cag E gens of H. pylori among Iranian GERD patients.
BACKGROUND: Gastroesophageal reflux disease (GERD) is defined as a condition of reflux the stomach juice by low pH causes tissue damage. Helicobacter pylori may or may not influence the GERD; however, it is unclear.
METHODS: This study was a case-control study performed on patients with GERD who underwent upper gastrointestinal endoscopy at Taleghani Hospital of Tehran, Iran. Prevalence of H. pylori and presence of the cag A and cag E genes in GERD and control group was investigated.
RESULTS: H. pylori was detected in 54% and 62% of GERD and control groups respectively. Prevalence of cag A gene among GERD patients was 44.4% whereas among the control group it was 87%. Prevalence of the cag E among GERD patients and control group was 44.4% and 64% respectively. Coexistence of cag A and cag E in GERD patients was 25.7% and in the control patients it was 54.8%.
CONCLUSION: We did not find correlation between H. pylori existence in GERD patients in comparison to the control group. Similar to other Asian studies, the presence of the cag A in control group was more than GERD patients significantly. The co-existence of cag A and cag E was also more in control group significantly.

Entities:  

Keywords:  Cag A; Cag E; GERD; Helicobacter pylori; Iran

Year:  2017        PMID: 29118933      PMCID: PMC5660267     

Source DB:  PubMed          Journal:  Gastroenterol Hepatol Bed Bench        ISSN: 2008-2258


Introduction

Gastro esophageal reflux disease (GERD) is defined as a condition in which the reflux of the stomach juice by low pH causes tissue damage. GERD’s prevalence in Western countries is about 20% and it is 2.5% – 6.7% in Asian population; however, the prevalence is increasing in Asian populations (1). According to previous studies, Helicobacter pylori may or may not influence the GERD; however, it is unclear (2). H. pylori is a Gram negative micro-aerophilic spiral shaped bacteria that colonize the gastric lumen of humans and other primates (3). Infection with H. pylori occurs worldwide, but the geographical prevalence varies greatly from 90% in developing countries to 20–50% in developed countries (4). It can be the major cause of peptic ulcer and gastritis and is known to have a relation with some infectious and non-infectious diseases, such as parasitic infection, malignancy, autoimmune thyroid disease, and GERD (4-6). Cytotoxin-associated gene products (Cag A and Cag E) are virulence factors of H.pylori which contribute to disease progress (7). Previous studies suspected that Cag A of H.pylori plays a role in the pattern of infections and diseases such as GERD (8, 9). Polymerase chain reaction (PCR) technique that has sensitivity and specificity for the diagnosis of H.pylori is also pathologic methods has these characteristics so these are the gold standard for diagnosis of H.pylori (37،38،39). Many epidemiological studies demonstrated a negative association between H. pylori infection and GERD. Some of the virulence factors, such as Cag A, may affect the diverse prevalence of GERD. A high incidence of Cag A-positive isolates has been reported in Asian population. The variety of H. pylori infection in Eastern and Asian countries among GERD patients is attributed to Cag A gene. So far, many studies have evaluated the effects of H. pylori eradication among GERD patients, but it is inconclusive. Eradication of Cag A positive H. pylori leads to recovery of acid secretion capacity and corpus gastritis which might be the causes of the higher incidence of GERD in Asian population (2). Of the cag pathogenicity island genes, the cagE gene (cytotoxin associated gene E), is also related to an increased production of IL-8 in the gastric epithelial cells (41). Thereby the cagE is an important marker of pathogenicity alone or combined with cagA (40).Since the impact of H. pylori and its virulence in GERD development is not yet well clear, so we aimed to evaluate the prevalence of H. pylori as well as its major Cag pathogenesity island markers including Cag A and Cag E gens in GERD patients compare to control group referring to Taleghani Hospital, Tehran, Iran.

Methods

Participants The current case-control study was performed on patients who had undergone endoscopy at Taleghani Hospital of Tehran, Iran during one year (2014). Primers sequences used in the current study According to various studies in Iran, the average prevalence of GERD patients was 27% (10). The number of patients with GERD symptoms was calculated with the following formula: N= z2 P (1-P)/ d2. (Prevalence (P) = 0.27; z = 1.96; d = 0.05) Prevalence of the cag A and cag E genes among GERD and control patients Therefore, during the study, 303 cases were investigated. All patients were examined by a gastroenterologist. Also questionnaires was loaded for each patient prior to biopsy. Based on gastroenterologist's diagnosis (upper gastrointestinal endoscopy and physician examination), only 50 patients were diagnosed with GERD. Of other patients without Gastro esophageal reflux disease, 50 patients were considered as control group equal to GERD group. The presence of H. pylori infection in the subjects was determined by histological examination and detection of the ure C gene by polymerase chain reaction (PCR). Biopsy After a fasting period, upper endoscopy was performed with a standard forward-viewing endoscope. After inspection of the entire gastric mucosa, multiple biopsies were taken from the stomach. During endoscopy samples taken from the gastric antrum were placed in the the sterile microtube and was transferred to the laboratory. The specimens were preserved at -20 C for next steps. Histological examination The biopsy samples of the gastric antrum destined for histology were fixed in formalin and stained with Hematoxylin-Eosin (H&E) and Giemsa. (42) DNA extraction and PCR performing DNA of biopsy samples was extracted by DNA extraction kit (DNeasy 96 Blood & Tissue Kit, Qiagen, USA). To confirm the presence of H. pylori among samples, PCR reaction was performed for Ure C gene. After identification of H. pylori positive samples, PCR was carried out for cag A and cag E genes as described previously (11) (Table 1 the primer were mentioned) (36).
Table 1

Primers sequences used in the current study

GenePrimer designationSequenceReference
Ure C Ure CR1Ure CF1GCTTACTTTCTAACACTAACGCGCGGATAAGCTTTTAGGGGTGTTAGGGG37
Cag A CagA F1CagA R1AACAGGACAAGTAGCTAGCCTATTAATGCGTGTGTGGCTG37
Cag E CagE F1CagE R1GCGGCAGTAACCAACCTTATCACAAGCCCATTAGGATCATTGTG36
Statistical analysis All data were analyzed using SPSS 22. For compression of the presence of H. pylori among GERD patients and control group, Cag A and Cag E between the two groups, Fisher’s exact test and Chi-Square were used. A P value of <0.05 was considered as significant.

Results

Out of 50 GERD patients, 42% were male (n=21) and 58% female (n=29) with the mean age of 45.78 ±22 years. In the control group, 54% were male and 46% female with mean age of patients with the mean age of 41.27± 18 years. The ure C PCR results in the GERD group showed that in 54% (n=27) of patient samples, H. Pylori DNA was detected whereas 62% (n=31) of the control group showed positive results for ure C gene (figure 1). And about ure C in control group and GERD group we cannot found statistical significance was seen in presence of H. pylori between the GERD and control groups. Prevalence of the cag A gene among GERD patients was 44.4% (n=12) whereas among the control group was 87% (n=27) (figure 2). Prevalence of the cag E among GERD patient was 44.4% (n=12) whereas among the control patients it was 64% (n=20) (figure 3). Coexistence of the cag A and cag E as in GERD patients was 25.7% (n=7) and in the control patients it was 54.8% (n=17) (Table 2).
Figure 1

PCR results for the ureC gene in H. pylori isolates.

Figure 2

PCR results for the cagA gene in H. pylori isolates.

Figure 3

PCR results for the cagE gene in H. pylori isolates.

Table 2

Prevalence of the cag A and cag E genes among GERD and control patients

Patientsnumber H. pylori
Virulence genes (%)
negative positive Cag A Cag E Co-presence
GERD 50232712(44.4)12(44.4)7(25.7)
Control 50193127(87)20(64)17(54.8)
P value-0.540.00070.180.03

Discussion

H. pylori infection plays a major role in the pathogenesis of peptic ulcer disease, chronic gastritis, and development of gastric cancer. However, its role in reflux diseases such as GERD is not clear (12-14). PCR results for the ureC gene in H. pylori isolates. Line1: positive sample for the ure C, Line2: Size marker (50bp), Line 3: Positive control for ure C, Line4: Negative control for the ure. PCR results for the cagA gene in H. pylori isolates. GERD reduces the patients’ quality of life and imparts a significant economic burden on the healthcare system (15–17). Bacterial virulence and host inflammatory responses are important in determining the patterns of acid secretion and gastritis (18). PCR results for the cagE gene in H. pylori isolates. The incidence of H. pylori infection in patients with GERD varies widely from 30 to 90% (19). Geographical location of the studies due to the difference in the prevalence of H. pylori in the world is the reason of this heterogeneity (20). These epidemiological data do not support a causative role of H. pylori for reflux disease, but they suggest a negative association (21). Consistent to Johnson LF et al. study, we did not find a significant association between H. pylori prevalence among the GERD patients and control group. Other researchers have even found a lower incidence of H. pylori infection in patients with GERD and have suggested a ''protective'' role of H. pylori against the GERD (22، 23). Their findings are inconsistent with our results. In Asian populations, in contrast to Far East and European populations, patients with gastric ulcer get complicated by corpus-predominant gastritis, which is characterized by atrophy of acid-secreting glands due to gastric acid hypo-secretion (24،25). Gastric acid hypo-secretion prevents the development of GERD. According to previous Asian population-based studies, the prevalence of GERD is reported to have a lower prevalence (26،29); this confirms the theory. Also, H. pylori and GERD have been found to be negatively associated and strongly dependent on cytotoxin-associated gene product Cag A positive strains (8). Recently, a study reported that H. pylori Cag A positive may potentially protect against development of GERD (30،31). According to previous studies, most Cag A positive strains in Asian countries were East Asian Cag A positive strains which can protect people against GERD (18). On the other hand, it has been reported that eradication of Cag A positive H. pylori strains is a risk factor for newly developed GERD (32،33). A meta-analysis study demonstrated that eradication of Cag A positive H. pylori was related to a higher risk of developing GERD in Asian studies (34). Also another study demonstrated a strong negative association between Barrett’s esophagus or erosive esophagitis and H. pylori, particularly in Cag A positive strains (35). our finding in Iranian subjects, similar to many studies as well as Xie T et al. report, showed that the cag A positive H. pylori strains were less common among GERD patients in comparison to the control group (P = 0.0001) but we did not find any association between Cag E in the GERD patients and control group. The co-existence of Cag A and Cag E in the control group was more than GERD patients significantly (P = 0.034). Our finding was supportive for the protective role of H. pylori with the cagA /cagE positive genotype against GERD development. Anita P et al showed prevalence of cagE in GERD patients is more from the genes studied, but no association was detected between cagE genotypes and clinical outcome (43). The paradox is that our study is probably due to the geographical distance between the two studies In Conclusion, we evaluated the prevalence of the Cag A and Cag E genes of H. pylori among GERD patients. We didn’t find any correlation between H. pylori frequency in GERD patients in comparison with the control group. However in accordance with several Asian studies, H. pylori strains from GERD patients were less positive for cagA gene as well as co-existence of cagA/cagE compared with the control group indicating probably protective role of these factor against GERD. However, more studies are needed to confirming this correlation and finding the possible mechanisms accurately.
  38 in total

Review 1.  Diagnosis of Helicobacter pylori: what should be the gold standard?

Authors:  Saurabh Kumar Patel; Chandra Bhan Pratap; Ashok Kumar Jain; Anil Kumar Gulati; Gopal Nath
Journal:  World J Gastroenterol       Date:  2014-09-28       Impact factor: 5.742

2.  cagE as a biomarker of the pathogenicity of Helicobacter pylori.

Authors:  Ivy Bastos Ramis; Júlia Silveira Vianna; Lande Vieira da Silva Junior; Andrea Von Groll; Pedro Eduardo Almeida da Silva
Journal:  Rev Soc Bras Med Trop       Date:  2013 Mar-Apr       Impact factor: 1.581

3.  High incidence of reflux oesophagitis after eradication therapy for Helicobacter pylori: impacts of hiatal hernia and corpus gastritis.

Authors:  H Hamada; K Haruma; M Mihara; T Kamada; M Yoshihara; K Sumii; G Kajiyama; M Kawanishi
Journal:  Aliment Pharmacol Ther       Date:  2000-06       Impact factor: 8.171

Review 4.  Helicobacter pylori and gastroesophageal reflux disease: friends or foes?

Authors:  J P Gisbert; J M Pajares; C Losa
Journal:  Hepatogastroenterology       Date:  1999 Mar-Apr

5.  Prolonged use of proton pump inhibitors, CagA status, and the outcome of Helicobacter pylori gastritis.

Authors:  Sunna Gudlaugsdottir; Hermann van Dekken; Theo Stijnen; J H Paul Wilson
Journal:  J Clin Gastroenterol       Date:  2002 May-Jun       Impact factor: 3.062

6.  Work productivity and activity impairment in gastroesophageal reflux disease in Korean full-time employees: a multicentre study.

Authors:  Woon Geon Shin; Heung Up Kim; Sang Gyun Kim; Gwang Ha Kim; Ki-Nam Shim; Jeong Wook Kim; Jin Il Kim; Jae Gyu Kim; Jae J Kim; Da-Hae Yim; Sue K Park; Soo-Heon Park
Journal:  Dig Liver Dis       Date:  2012-02-09       Impact factor: 4.088

7.  Distribution of Helicobacter pylori cagA, cagE, oipA and vacA in different major ethnic groups in Tehran, Iran.

Authors:  Hossein Dabiri; Parviz Maleknejad; Yoshio Yamaoka; Mohammad M Feizabadi; Fereshteh Jafari; Maryam Rezadehbashi; Farrokh A Nakhjavani; Akbar Mirsalehian; Mohammad R Zali
Journal:  J Gastroenterol Hepatol       Date:  2009-08       Impact factor: 4.029

8.  Meta-analysis: the relationship between Helicobacter pylori infection and gastro-oesophageal reflux disease.

Authors:  F Cremonini; S Di Caro; S Delgado-Aros; A Sepulveda; G Gasbarrini; A Gasbarrini; M Camilleri
Journal:  Aliment Pharmacol Ther       Date:  2003-08-01       Impact factor: 8.171

9.  The burden of illness of gastro-oesophageal reflux disease: impact on work productivity.

Authors:  B B Dean; J A Crawley; C M Schmitt; J Wong; J J Ofman
Journal:  Aliment Pharmacol Ther       Date:  2003-05-15       Impact factor: 8.171

Review 10.  Helicobacter pylori Infection in Gastroesophageal Reflux Disease in the Asian Countries.

Authors:  Su Jin Hong; Sang Woo Kim
Journal:  Gastroenterol Res Pract       Date:  2015-01-06       Impact factor: 2.260

View more
  4 in total

Review 1.  Interactions between Helicobacter pylori and gastroesophageal reflux disease.

Authors:  Oya Yucel
Journal:  Esophagus       Date:  2018-08-27       Impact factor: 4.230

2.  Prevalence of tumor necrosis factor alpha inducing protein (tipα) gene of Helicobacter pylori and its association with upper gastrointestinal diseases in India.

Authors:  Shweta Mahant; Shubham Mehra; Ayushi Chhawchharia; Bipul Chandra Karmakar; Sangita Paul; Asish Kumar Mukhopadhyay; Sudeep Bose; Kunal Das; Rajashree Das
Journal:  3 Biotech       Date:  2021-04-30       Impact factor: 2.406

Review 3.  Relationship between Helicobacter pylori infection and GERD.

Authors:  Serena Scida; Michele Russo; Chiara Miraglia; Gioacchino Leandro; Lorella Franzoni; Tiziana Meschi; Gian Luigi De' Angelis; Francesco Di Mario
Journal:  Acta Biomed       Date:  2018-12-17

4.  The association between helicobacter pylori infection and erosive gastroesophageal reflux disease; a cross-sectional study.

Authors:  Ramin Niknam; Kamran Bagheri Lankarani; Mohsen Moghadami; Seyed Alireza Taghavi; Leila Zahiri; Mohammad Javad Fallahi
Journal:  BMC Infect Dis       Date:  2022-03-19       Impact factor: 3.090

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.