| Literature DB >> 29118739 |
Hannah Kleyer1, Robin Tecon1, Dani Or1.
Abstract
Rapid advances in genome sequencing technologies enable determination of relative bacterial abundances and community composition, yet, changes at the species level remain difficult to detect despite importance for certain ecological inferences. We present a method for extraction and direct quantification of species composition of a predefined multispecies bacterial community using microfluidic-based quantitative real-time PCR (qPCR). We employ a nested PCR approach based on universal 16S rRNA gene pre-amplification followed by detection and quantification of absolute abundance of bacterial species using microfluidic array of parallel singleplex qPCR reactions. Present microfluidic qPCR supports 2,304 simultaneous reactions on a single chip, while automatic distribution of samples and reactants minimizes pipetting errors and technical variations. The utility of the method is illustrated using a synthetic soil bacterial community grown in two contrasting environments - sand microcosms and batch cultures. The protocol entails extraction of total nucleic acid, preparation of genomic DNA, and steps for qPCR assessment of bacterial community composition. This method provides specific and sensitive quantification of bacterial species requiring only 2 ng of community DNA. Optimized extraction protocol and preamplification step allow for rapid, quantitative, and simultaneous detection of candidate species with high throughput. The proposed method offers a simple and accurate alternative to present sequencing methods especially when absolute values of species abundance are required. Quantification of changes at the species level contributes to the mechanistic understanding of the roles of particular species in a bacterial community functioning.Entities:
Keywords: Fluidigm; absolute quantification; community assembly; microbial ecology; porous media; real-time PCR; soil bacterial community; synthetic community
Year: 2017 PMID: 29118739 PMCID: PMC5661172 DOI: 10.3389/fmicb.2017.02017
Source DB: PubMed Journal: Front Microbiol ISSN: 1664-302X Impact factor: 5.640
Bacterial strains used in this study.
| Species | Strain | Gram | Phylum | Origin | Cells | Motile | Sporulating |
|---|---|---|---|---|---|---|---|
| A6T | + | Actinobacteria | Soil | Rods | - | - | |
| 168 trp+ | + | Firmicutes | Soil | Rods | + | + | |
| LB400T | - | β-Proteobacteria | Rhizosphere | Rods | + | - | |
| MG1655 | - | γ-Proteobacteria | Human gut | Rods | + | - | |
| DSM20030T | + | Actinobacteria | Soil | Cocci | - | - | |
| T27T | + | Firmicutes | Rhizosphere | Rods | + | + | |
| CHA0T | - | γ-Proteobacteria | Soil | Rods | + | - | |
| CMT.9.A | - | γ-Proteobacteria | Rhizosphere | Rods | + | - | |
| CFN 42T | - | α-Proteobacteria | Rhizosphere | Rods | + | - | |
| A3(2) | + | Actinobacteria | Soil | Filaments | - | + | |
| 7CT | - | α-Proteobacteria | Soil | Rods | - | - |
Primers used in this study.
| Name | Sequence (5′ to 3′) | Tm (°C) | CG Content (%) | Length (nt) | Target pos. 16S | Reference |
|---|---|---|---|---|---|---|
| A_chlo F | CAGCTTGCTGGTGGATTA | 60.5 | 50.0 | 18 | 79–183 | This study |
| A_chlo R | CACCATGCGATGATCAGT | 61.3 | 50.0 | 18 | This study | |
| B_subt F | GACAGATGGGAGCTTGCT | 61.1 | 55.6 | 18 | 68–201 | This study |
| B_subt R | TGTAAGTGGTAGCCGAAGC | 61.0 | 52.6 | 19 | This study | |
| B_xeno F | AATACATCGGAACGTGTCCT | 61.3 | 45.0 | 20 | 118–283 | This study |
| B_xeno R | TCCTCTCAGACCAGCTACAG | 60.3 | 55.0 | 20 | This study | |
| E_coli F | GAAGCTTGCTTCTTTGCTG | 61.0 | 47.4 | 19 | 78–177 | This study |
| E_coli R | TTGGTCTTGCGACGTTATG | 62.8 | 47.4 | 19 | This study | |
| M_lute F | GACATGTTCCCGATCGCC | 67.1 | 61.1 | 18 | 992–1126 | This study |
| M_lute R | CCACCATTACGTGCTGGC | 65.7 | 61.1 | 18 | This study | |
| P_prot F | GTACTTGTACCTGGTGGCG | 61.2 | 57.9 | 19 | 79–157 | This study |
| P_prot R | GTATTAGCGCCCGTTTCC | 62.4 | 55.6 | 18 | This study | |
| P_sabi F | GAGTTATGATGGAGCTTGCT | 59.0 | 45.0 | 20 | 68–180 | This study |
| P_sabi R | GGTATGCACCAGAAGGTCTT | 61.1 | 50.0 | 20 | This study | |
| P_stut F | CTTGCTCCATGATTCAGC | 60.1 | 50.0 | 18 | 82–165 | This study |
| P_stut R | ACGTATGCGGTATTAGCGT | 60.2 | 47.4 | 19 | This study | |
| R_etli F | CGCAGGGAAACTTGTGCTAA | 65.4 | 50.0 | 20 | 152–270 | This study |
| R_etli R | CTATGGATCGTCGCCTTGG | 65.9 | 57.9 | 19 | This study | |
| S_viol F | GAACGATGAACCACTTCGGTG | 65.3 | 50.0 | 20 | 63–179 | This study |
| S_viol R | GATGCCTGCGAGGGTCAGTA | 66.2 | 57.9 | 19 | This study | |
| X_auto F | GATCTACCCAATGGTACGG | 59.5 | 52.6 | 19 | 128–209 | This study |
| X_auto R | GTTCATCCAATGGCGATA | 60.0 | 44.4 | 18 | This study | |
| 27F | AGAGTTTGATCCTGGCTCAG | 61.5 | 50 | 20 | ||
| 1492R | CGGTTACCTTGTTACGACTT | 58.7 | 45 | 20 | ||
| 534R | ATTACCGCGGCTGCTGG | 67.7 | 64.7 | 17 | ||
| 1099F mod | AACGAGCGCAACCCT | 61.2 | 60 | 15 | modified from | |
| 1407R mod | GACGGGCGGTGTGTA | 60.9 | 66.7 | 15 | modified from | |