Literature DB >> 29115389

Renoprotective effect of erythropoietin via modulation of the STAT6/MAPK/NF-κB pathway in ischemia/reperfusion injury after renal transplantation.

Jinhua Zhang1, Daqiang Zhao1, Ning Na1, Heng Li1, Bin Miao1, Liangqing Hong1, Zhengyu Huang1.   

Abstract

Ischemia/reperfusion injury (IRI) commonly occurs in renal transplantation. Erythropoietin (EPO) exerts a protective effect in IRI. To investigate the underlying molecular mechanism, rat models of renal IRI were established and treated with EPO and/or lentivirus‑mediated EPO-siRNA, the signal transducer and activator of transcription 6 (STAT6) inhibitor AS1517499, the JNK inhibitor SP600125, the p38 mitogen-activated protein kinase (MAPK) inhibitor SB203580, and the nuclear factor (NF)-κB inhibitor lactacystin. Histological examination revealed that EPO protected the kidney from IRI, through decreasing the extent of tissue congestion and inflammatory cell infiltration; however, EPO siRNA did not exert the same protective effect. In addition, the EPO level was inversely associated with renal IRI. EPO downregulated the expression of interferon-γ, interleukin (IL)-4, creatinine and caspase-3, and upregulated the expression of IL-10, thymic stromal lymphopoietin, STAT6, p-JNK and p-p38, while the opposite effects were observed with the administration of EPO-siRNA and the specific respective inhibitors. Further results revealed that MAPK (p-JNK and p-p38) acted upstream of NF-κB, and that NF-κB signaling regulated the expression of caspase-1 and -3, which may be responsible for the cytotoxicity associated with IRI. Taken together, the results of the present study demonstrated that EPO exerted a protective effect in renal IRI via the STAT6/MAPK/NF-κB pathway. This protective effect of EPO may improve reperfusion tolerance in ischemic kidneys and benefit transplant recipients.

Entities:  

Mesh:

Substances:

Year:  2017        PMID: 29115389      PMCID: PMC5746301          DOI: 10.3892/ijmm.2017.3204

Source DB:  PubMed          Journal:  Int J Mol Med        ISSN: 1107-3756            Impact factor:   4.101


Introduction

Kidney transplantation is an efficacious treatment for patients with end-stage renal disease (1,2). The in situ regional cooling technique with static cold storage was developed to maximize the benefit of the donated kidney for the recipient (3), and has achieved excellent kidney graft function and good graft survival (4). However, renal ischemia/reperfusion injury (IRI), which is a major cause of acute renal injury (formerly referred to as acute renal failure) and a risk factor for the quality of a kidney graft, rejection and renal fibrosis, is directly correlated with the survival of the recipient (5,6). Furthermore, the complex association of pathophysiological processes with inflammation makes the ischemic kidney injury an important risk factor for progression of chronic kidney disease (7). It was documented that inflammation, apoptosis and necrosis, hypoxic injury and production of reactive oxygen species are involved in the pathogenesis of IRI (8). The modulation of inflammatory response, inhibition of apoptosis and amelioration of oxidative stress confer an advantage to the prevention and treatment of IRI (9,10). Erythropoietin (EPO) has been found to confer such an advantage (11,12), but the underlying molecular mechanism remains unclear. Inflammation is invariably found to be an important initiating and aggravating factor in both acute and chronic kidney injury (13). Nuclear factor-κB (NF-κB), a pivotal mediator of the inflammatory response, modulates the expression levels of adhesion molecules, chemokines and other pro-inflammatory molecules in the kidney (14,15). It was reported that interleukin (IL)-4 promoted the activation of signal transducer and activator of transcription 6 (STAT6), suppressing the transcriptional activation of NF-κB-dependent proinflammatory mediators following liver IRI (16,17). Apoptosis is a principal cause of cell death in the kidney following IRI (18,19). Apoptosis-related proteins, such as caspase-3, play important roles in renal IRI (20,21). Therefore, regulating inflammation and cell death is a promising therapeutic strategy for reversing IRI and protecting renal allografts. EPO is a hematopoietic hormone produced by the kidney and fetal liver in response to hypoxia, inflammation and cell death (22). EPO exerts numerous protective effects. Importantly, EPO may exert antioxidant, anti-inflammatory and anti-apoptotic effects against IRI in the brain (23) and kidney (24). It was demonstrated that, under conditions of renal IRI, the expression levels of EPO in the kidney were decreased (25). A variety of signal transduction pathways, including mitogen-activated protein kinase (MAPK) and NF-κB, were involved in the EPO-mediated cytoprotective effects (26,27). The cell-protective effect of EPO was significantly attenuated by pretreatment with the specific p-p38 inhibitor, suggesting that MAPK pathways may be responsible for cell survival under cytotoxic conditions (26). EPO treatment significantly decreased the lipopolysaccharide-induced elevation of creatinine (Cr) and NF-κB, indicating that EPO may play a protective role against IRI by reducing the inflammatory response and tissue degeneration, possibly via the NF-κB signaling pathway (27). Therefore, the mechanisms underlying the protective effect of EPO against renal IRI remain to be fully elucidated. The aim of the present study was to investigate the effect of EPO on the levels of chemokines, including interferon (IFN)-γ, IL-4, IL-10 and Cr, by the siRNA technique, and determine whether the renoprotective effect of EPO against IRI is exerted through the STAT6/MAPK/NF-κB pathway by using specific inhibitors, including the STAT6 inhibitor AS1517499, the JNK inhibitor SP600125, the p38 MAPK inhibitor SB203580, and the NF-κB inhibitor lactacystin. This detailed protective mechanism of EPO may improve reperfusion tolerance in ischemic kidneys and benefit transplant recipients.

Materials and methods

Animals

Specific pathogen-free (SPF) adult male Lewis rats (n=64) and Brown Norway rats (n=64), 12–16 weeks old, weighing 250–350 g were purchased from Charles River Laboratories (Beijing, China). All animal experiments were performed in accordance with the Experimental Animal Regulations established by The Ministry of Science and Technology of the People's Republic of China, and the Guidelines for the Care and Use of Laboratory Animals published by the National Institutes of Health (Bethesda, MD, USA). The study received ethical approval from the Ethics Committee of Sun Yat-sen University. Prior to performing the experiments, all the animals were subjected to an overnight fast with unlimited access to water.

Establishment of the animal model

The SPF rats were randomly allocated to three groups (control, EPO and EPO-siRNA; n=8). The Lewis rats were used as the recipients, and the Brown Norway rats were used as donors in the renal transplants. Kidney transplantation was performed as previously described (28). In brief, the rats were anesthetized with inhalation of 10% chloral hydrate 0.3 ml/100 g body weight. The left kidney was prepared by freeing the ureter from the attachments. The donor kidney and ureter were removed en bloc. Donor kidney grafts were washed with 4°C saline solution and stored in 4°C HCA solution. The right kidney was removed from the recipient, and the donor kidney was transplanted. An anastomosis was created between the donor and recipient renal artery, renal vein and ureters with end-to-end anastomosis, to establish the unilateral orthotopic renal transplantation rat model. Rat rectal temperature was maintained at 35–37°C during surgery. After surgery, the rats were placed on a heat pad until they recovered.

Experimental design

After establishment of the unilateral orthotopic renal transplantation rat model, continuous administration of saline solution, recombinant human EPO (500 U/kg), or lentivirus-mediated EPO siRNA (1×107 infectious units) (sc-37220-V; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA) was performed, once a day for 7 days. After the last administration, the rats were sacrificed and the kidneys were removed and processed for immunohistochemistry (IHC) and immunofluorescence (IFC) assessment of EPO levels, hematoxylin and eosin (H&E), periodic acid-Schiff (PAS), PAS-methenamine (PASM) and Masson's trichrome staining, for detection of the levels of creatinine (Cr), EPO, IL-4, IL-10 and IFN-γ, and for western blot analysis of thymic stromal lymphopoietin (TSLP), STAT6, NF-κB, JNK, p38, and caspase-1 and -3 in renal tissues. To further investigate the role of the STAT6/MAPK/NF-κB pathway in EPO-mediated renoprotection. The other 40 rats were divided into 5 groups (control, and 4 groups of the different inhibitors; n=8). The animals received the STAT6 inhibitor AS1517499 (10 mg/kg), the JNK inhibitor SP600125 (30 mg/kg), the p38 MAPK inhibitor SB203580 (15 mg/kg), or the NF-κB inhibitor lactacystin (10 mg/kg) in the presence of EPO and using the same route of administration of EPO following renal transplantation. The rats were then sacrificed and the kidneys were removed and processed for H&E, PAS, PASM, and Masson's trichrome staining, for detection of the levels of Cr, EPO, IL-4, IL-10 and IFN-γ, and for western blot analysis of TSLP, STAT6, NF-κB, JNK, p38, and caspase-1 and -3 in renal tissues.

IHC and IFC

The kidneys were processed for IHC and IFC according to standard protocols. For IHC, 3-μm paraffin sections using rabbit anti-mouse EPO monoclonal antibody (1:100; sc-5290) and goat anti-rabbit IgG poly-HRP (1:100; sc-2004) (both from Santa Cruz Biotechnology, Inc.). For IFC, the sections were fixed in 4% paraformaldehyde and incubated with rabbit anti-human EPO monoclonal antibody (1:50; sc-80995) and FITC-labeled goat anti-rabbit secondary antibody (1:150; sc-2004) (both from Santa Cruz Biotechnology, Inc.). The fluorescence intensity of EPO was calculated by using ImageJ software (National Institutes of Health). For nuclear staining, DAPI was used and confocal images were acquired as previously described (29,30) using the LSM 510 microscope (Carl Zeiss AG, Oberkochen, Germany). Formalin-fixed paraffin-embedded tissues were also stained with H&E and PAS, PASM and Masson's trichrome staining.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA was extracted with TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Carlsbad, CA, USA) from homogenated whole kidneys. RNA was reverse transcribed to cDNA using SuperScript II Reverse Transcriptase (Invitrogen; Thermo Fisher Scientific). RT-qPCR was performed on an ABI Prism 5700 Sequence Detection system (Applied Biosystems, Foster City, CA, USA) with SYBR-Green PCR Core reagents. The primers are listed in Table I. GAPDH served as internal control. The relative mRNA expression levels of each target gene were normalized to those of the controls using the 2−ΔΔCq method.
Table I

Primer sequences used for RT-qPCR.

GenesPrimer sequences (5′-3′)
GAPDHF: GGTGAAGGTCGGTGTGAAC
GAPDHR: CCTTGACTGTGCCGTTGAA
EPOF: AGAATGAAGGTGGAAGAACAGG
EPOR: CCCGAAGCAGTGAAGTGAGG
IFN-γF: GAACTGGCAAAAGGACGGTAA
IFN-γR: AACTTGGCGATGCTCATGAAT
IL-4F: CCACCTTGCTGTCACCCTGT
IL-4R: CCGTGGTGTTCCTTGTTGC
IL-10F: CTATGTTGCCTGCTCTTACTGG
IL-10R: ATGTGGGTCTGGCTGACTGG

RT-qPCR, reverse transcription-polymerase chain reaction; F, forward; R, reverse; EPO, erythropoietin; IFN, interferon; IL, interleukin.

Enzyme-linked immunosorbent assay (ELISA)

Serum Cr, EPO, IL-4, IL-10 and IFN-γ levels were detected in a 96-well microtiter plate by using a commercial ELISA kit (Biosource, Camarillo, CA, USA) according to the manufacturer's instructions. All samples were tested in duplicate. The plate was read at 450 nm on a microplate reader (BioTek Instruments, Inc., Winooski, VT, USA). The levels were calculated from a standard curve and expressed in pg/ml.

Western blot analysis

The protein lysates were prepared with RIPA and subjected to three freeze/thaw cycles using liquid nitrogen. The lysates were then electrophoresed in 10% SDS-PAGE (Bio-Rad Laboratories, Inc., Hercules, CA, USA), transferred to nitrocellulose membrane, blocked with 0.5% skimmed milk and incubated with TSLP, STAT6, NF-κB, JNK, p38 and caspase-1 and -3 primary antibodies (all from Santa Cruz Biotechnology, Inc.) for 1 h. Polyclonal anti-GAPDH was used as an internal control. After three washes, the membrane was incubated with horseradish peroxidase-conjugated IgG and developed under chemiluminescence condition (Amersham Pharmacia Biotech, Piscataway, NJ, USA) using ChemiDoc XRS (Bio-Rad Laboratories, Inc.). The quantification and analysis for the blots were performed with ImageJ software.

Statistical analysis

All data are presented as means ± standard deviation. Data between groups were compared using two-tailed unpaired t-test or analysis of variance. P<0.05 was considered to indicate statistically significant differences. All analyses were performed using SPSS 16.0 software (SPSS Inc., Chicago, IL, USA).

Results

Pathological changes of the kidneys

Following continuous administration of saline solution, recombinant human EPO (500 U/kg), or lentivirus-mediated EPO-siRNA for 7 days, histological analysis of kidneys was performed (Fig. 1). The images of H&E, PAS, PASM and Masson's staining revealed that IRI occurred after renal transplantation. Infiltration of inflammatory cells, with a large number of lymphocytes around the blood vesselst was observed. Furthermore, EPO protected the kidney from IRI, through decreasing the extent of tissue congestion and inflammatory cell infiltration; however, EPO-siRNA did not exert the same protective effect.
Figure 1

Histological analysis revealed pathological changes in the kidneys. The unilateral orthotopic renal transplantation rat model included administration of saline solution (control), recombinant human erythropoietin (EPO; 500 U/kg), or lentivirus-mediated EPO-siRNA. The kidneys were processed for hematoxylin and eosin (H&E), periodic acid-Schiff (PAS), PAS-methenamine (PASM) and Masson's trichrome staining.

The level of EPO was detected in the kidneys (Fig. 2). Both IHC (Fig. 2A) and IFC images (Fig. 2B), and data qualification (Fig. 2C) revealed that the EPO levels in EPO-treated rats were higher compared with those in the saline solution and EPO-siRNA groups. Thus, the EPO level appears to be inversely correlated to the renal IRI.
Figure 2

Level of erythropoietin (EPO) in the kidneys. (A) Immunohistochemistry, (B) immunofluorescence and (C) qualification. The unilateral orthotopic renal transplantation rat model was etsbalished with administration of saline solution (control), recombinant human EPO (500 U/kg), or lentivirus-mediated EPO-siRNA. **P<0.01 vs. control.

EPO downregulates the expression of IFN-γ, IL-4 and Cr and upregulates the expression of IL-10, and this effect is reversed by EPO-siRNA

The expression of EPO, IFN-γ, IL-4 and IL-10 in tissues and serum were detected by RT-qPCR and ELISA, respectively (Fig. 3A–G). As expected, EPO tissue and serum levels were significantly upregulated in rats with EPO administration, and was significantly downregulated by EPO-siRNA (Fig. 3A and E). EPO treatment reduced the expression of IFN-γ (Fig. 3B and F) and IL-4 (Fig. 3C and G), as well as the serum levels, whereas it increased the expression of IL-10 at the mRNA level and in the serum (Fig. 3D and H). All these effects induced by EPO were reversed by EPO-siRNA.
Figure 3

Changes in the levels of erythropoietin (EPO), interferon (IFN)-γ, interleukin (IL)-4, IL-10, creatinine (Cr), thymic stromal lymphopoietin (TSLP), signal transducer and activator of transcription 6 (STAT6), p-JNK, p-p38, and caspase-1 and -3. The unilateral orthotopic renal transplantation rat model was established by administration of saline solution (control), recombinant human EPO (500 U/kg), or lentivirus-mediated EPO-siRNA. Using RT-qPCR, the expression of (A) EPO, (B) IFN-γ, (C) IL-4 and (D) IL-10 in renal tissues were detected. Using ELISA, the serum level of (E) EPO, (F) IFN-γ, (G) IL-4, (H) IL-10 and (I) Cr were detected. (J) Using western blot analysis, the expression of EPO, TSLP, STAT6, p-JNK, p-p38 and caspase-1 and -3 were also detected and (K) quantified. *P<0.05; **P<0.01 vs. control. RT-qPCR, reverse transcription-quantitative polymerase chain reaction.

The Cr level in the serum was also investigated (Fig. 3I). The results revealed that, compared with controls, EPO administration decreased the serum level of Cr, and EPO-siRNA increased the serum level of Cr.

EPO upregulated the expression of TSLP, STAT6, p-JNK and p-p38, and downregulated the expression of caspase-3, while EPO-siRNA exerted the opposite effects

To analyze the underlying molecular mechanisms for EPO-mediated renoprotection, the changes in TSLP and STAT6/MAPK/NF-κB pathway were detected by western blot analysis (Fig. 3J and K). EPO administration upregulated the expression of TSLP, STAT6, p-JNK, p-p38, but downregulated the expression of caspase-3. By contrast, EPO-siRNA decreased the expression of EPO, TSLP, STAT6, p-JNK, p-p38 and caspase-1, but increased the expression of caspase-3, indicating that EPO protects the kidney from IRI via the STAT6/MAPK/NF-κB signaling pathway.

Assessment of the role of the STAT6/MAPK/NF-κB pathway in EPO-mediated renoprotection from IRI

We further investigated whether the STAT6 inhibitor AS1517499, the JNK inhibitor SP600125, the p38 MAPK inhibitor SB203580, or the NF-κB inhibitor lactacystin suppressed the effects of EPO in inhibiting renal IRI (Figs. 4 and 5). The histological analysis revealed that EPO-mediated renoprotection was obviously inhibited by AS1517499, SP600125, SB203580 and lactacystin (Fig. 4).
Figure 4

Histological analysis of the signal transducer and activator of transcription 6 (STAT6)/mitogen-activated protein kinase (MAPK)/nuclear factor-κB (NF-κB) pathway in erythropoietin (EPO)-mediated renoprotection from ischemia/reperfusion injury. Rats with unilateral orthotopic renal transplantation received the STAT6 inhibitor AS1517499, the JNK inhibitor SP600125, the p38 MAPK inhibitor SB203580, or the NF-κB inhibitor lactacystin in the presence of EPO. Rats administered EPO served as control.

Figure 5

Erythropoietin (EPO) modulates the levels of interferon (IFN)-γ, interleukin (IL)-4, IL-10, creatinine (Cr) and caspase-1 and -3 via the signal transducer and activator of transcription 6 (STAT6)/mitogen-activated protein kinase (MAPK)/nuclear factor-κB (NF-κB) pathway. Rats with unilateral orthotopic renal transplantation received the STAT6 inhibitor AS1517499, the JNK inhibitor SP600125, the p38 MAPK inhibitor SB203580, or the NF-κB inhibitor lactacystin, in the presence of EPO. Rats administered EPO were used as control. Using RT-qPCR, the expression of (A) IFN-γ, (B) IL-4 and (C) IL-10 in renal tissues was detected. Using ELISA, the serum level of (D) IFN-γ, (E) IL-4, (F) IL-10 and (G) Cr was detected. (H) Using western blot analysis, the expression of STAT6, p-JNK, p-p38, p65 and caspase-1 and -3 with concurrent administration of EPO and AS1517499 were detected and (I) quantified. The (J) expression of p-JNK, p65 and caspase-1 and -3 with administration of EPO and SP600125; (K) expression of p-p38, p65 and caspase-1 and -3 with administration of EPO and SB203580; and the (L) expression of p65 and caspase-1 and -3 with administration of EPO and lactacystin were detected and quantified. *P<0.05 and **P<0.01 vs. control.

The chemokine levels were also measured (Fig. 5A–G). IFN-γ (Fig. 5A and C) and IL-4 (Fig. 5B and D) at the mRNA level and in the serum levels were significantly increased by these inhibitors in the presence of EPO, while IL-10 levels (Fig. 5C and F) were significantly decreased in the presence of EPO. The serum level of Cr in the presence of EPO was also increased by each of these inhibitors (Fig. 5G). The STAT6 inhibitor AS1517499 inhibited the expression of STAT6, p-JNK, p-p38 and p65, while it increased the expression of caspase-1 and -3 in the presence of EPO (Fig. 5H and I), suggesting that STAT6 acted upstream of MAPK (p-JNK and p-p38) and NF-κB. The JNK inhibitor SP600125 and the p38 MAPK inhibitor SB203580 inhibited the expression of p-JNK and p65, while they increased the expression of caspase-1 and -3 in the presence of EPO (Fig. 5J and K), suggesting that MAPK (p-JNK and p-p38) acted upstream of NF-κB. The NF-κB inhibitor lactacystin upregulated the expression of caspase-1 and -3 in the presence of EPO (Fig. 5L). Therefore, all the inhibitors of STAT6, JNK, p38 MAPK and NF-κB reversed the changes in the chemokine levels, Cr levels, and caspase-1 and -3 expression. These results suggest that the STAT6/MAPK/NF-κB signaling pathway was involved in EPO-mediated renoprotection from IRI.

Discussion

Recent studies suggested that the MAPK/NF-κB signaling pathway is involved in the EPO-mediated protection from IRI following renal transplantation (26,27), and that the STAT6̸NF-κB signaling pathway is involved in the inflammatory responses (16,17). Moreover, apoptosis is known to play a key role in renal IRI (18,19). Apoptosis-related proteins, such as caspase-3, may be involved in renal IRI (20,21). However, the role of the STAT6/MAPK/NF-κB signaling pathway in EPO-induced renoprotection remains poorly understood. In the present study, a sham-operation group was not constructed; all experiments were performed following establishment of the unilateral orthotopic renal transplantation rat model. We demonstrated that recombinant human EPO protected against IRI following renal transplantation by reducing the inflammatory responses and promoting cell survival under cytotoxic conditions. Specific inhibitors, including the STAT6 inhibitor AS1517499, the JNK inhibitor SP600125, the p38 MAPK inhibitor SB203580, and the NF-κB inhibitor lactacystin, reversed the effects of EPO, further suggesting the importance of the STAT6̸MAPK̸NF-κB signaling pathway in EPO-mediated renoprotection from IRI. EPO is produced by the kidney and fetal liver and has long been considered as merely a factor modulating erythropoiesis. However, recent studies demonstrated that EPO may also exert protective effects against hypoxia, inflammation and cell death following IRI in the kidney (27), brain (31), and myocardium (32–34). Our results demonstrated that EPO protected the kidney from IRI, through decreasing the extent of tissue congestion and inflammatory cell infiltration; however, EPO-siRNA did not exert such a protective effect. IHC (Fig. 2A) and IFC (Fig. 2B) images revealed that the EPO levels in EPO-treated rats were higher compared with those the the saline solution and EPO-siRNA groups, suggesting that the EPO level is inversely correlated with renal IRI. EPO increased the levels of anti-inflammatory cytokines, such as IL-10, while it reduced the levels of pro-inflammatory cytokines, such as IFN-γ and IL-4, and Cr. This is consistent with previous studies demonstrating that treatment with anti-inflammatory cytokine IL-10 reduced renal and systemic inflammation (35), and reduced the serum levels of proinflammatory cytokine IFN-γ, protecting the kidney from injury (36). These data suggest that EPO not only suppressed the expression of pro-inflammatory cytokines, but also increased the level of anti-inflammatory cytokines. TLSP is a critical cytokine that exacerbates allergic and fibrotic reactions (37). TLSP is mainly produced by epithelial cells and its production is induced by inflammatory cytokines (38). NF-κB also regulates TSLP mRNA expression (38). TSLP was highly expressed in the kidney in the presence of EPO, and this was inhibited by EPO-siRNA, indicating that TSLP may be involved in EPO-mediated protection from IRI. It has been reported that MAPK and NF-κB played an important role in EPO-mediated cytoprotective effects (26,27). EPO significantly decreased the lipopolysaccharide-induced elevation of Cr and NF-κB levels, indicating that EPO may play a protective role against IRI by reducing the inflammatory response and tissue degeneration, possibly via the NF-κB signaling pathway (27). Furthermore, STAT6 was elevated by inflammatory cytokines, such as IL-4, and then suppressed the transcriptional activation of NF-κB-dependent proinflammatory mediators following liver IRI (16,17). In the present study, the specific inhibitors of STAT6, JNK, p38 MAPK and NF-κB reversed the EPO-induced changes in the levels of IFN-γ, IL-4, IL-10, Cr and TSLP. In addition, MAPK (p-JNK and p-p38) acted upstream of NF-κB, and NF-κB signaling regulated the expression of caspase-1 and -3, which may responsible for the cytotoxicity observed under IRI conditions. In conclusion, the present study demonstrated that EPO exerted a protective effect in renal IRI via the STAT6/MAPK/NF-κB pathway.
  38 in total

Review 1.  TSLP expression: cellular sources, triggers, and regulatory mechanisms.

Authors:  Toshiro Takai
Journal:  Allergol Int       Date:  2012-01-25       Impact factor: 5.836

2.  Erythropoietin pretreatment ameliorates renal ischaemia-reperfusion injury by activating PI3K/Akt signalling.

Authors:  Jiong Zhang; Yu-Rong Zou; Xiang Zhong; Hanlu Ding Fei Deng; Lei Pu; Kun Peng; Li Wang
Journal:  Nephrology (Carlton)       Date:  2015-04       Impact factor: 2.506

3.  The fate of 359 renal allografts harvested from non-heart beating cadaver donors at a single center.

Authors:  K Hoshinaga; R Shiroki; T Fujita; T Kanno; Y Naide
Journal:  Clin Transpl       Date:  1998

4.  Interleukin-4 suppression of tumor necrosis factor alpha-stimulated E-selectin gene transcription is mediated by STAT6 antagonism of NF-kappaB.

Authors:  B L Bennett; R Cruz; R G Lacson; A M Manning
Journal:  J Biol Chem       Date:  1997-04-11       Impact factor: 5.157

5.  Erythropoietin alleviates post-ischemic injury of rat hearts by attenuating nitrosative stress.

Authors:  Ming-Jen Lu; Yih-Sharng Chen; Ho-Shiang Huang; Ming-Chieh Ma
Journal:  Life Sci       Date:  2012-04-12       Impact factor: 5.037

6.  Erythropoietin pretreatment exerts anti-inflammatory effects in hepatic ischemia/reperfusion-injured rats via suppression of the TLR2/NF-κB pathway.

Authors:  Q-S Liu; Z-W Cheng; J-G Xiong; S Cheng; X-F He; X-C Li
Journal:  Transplant Proc       Date:  2015-03       Impact factor: 1.066

Review 7.  Searching for NF-kappaB-based treatments of ischemia reperfusion injury.

Authors:  Christopher A Latanich; Luis H Toledo-Pereyra
Journal:  J Invest Surg       Date:  2009 Jul-Aug       Impact factor: 2.533

Review 8.  Ischemia/reperfusion injury in kidney transplantation: mechanisms and prevention.

Authors:  M Kosieradzki; W Rowiński
Journal:  Transplant Proc       Date:  2008-12       Impact factor: 1.066

9.  Human endometrial regenerative cells attenuate renal ischemia reperfusion injury in mice.

Authors:  Peng Sun; Jian Liu; Wenwen Li; Xiaoxi Xu; Xiangying Gu; HongYue Li; Hongqiu Han; Caigan Du; Hao Wang
Journal:  J Transl Med       Date:  2016-01-28       Impact factor: 5.531

10.  Protection against ischemia/reperfusion‑induced renal injury by co‑treatment with erythropoietin and sodium selenite.

Authors:  Lu Liu; Chao Liu; Lan Hou; Juan Lv; Fang Wu; Xuefei Yang; Shuting Ren; Wenjun Ji; Meng Wang; Lina Chen
Journal:  Mol Med Rep       Date:  2015-10-09       Impact factor: 2.952

View more
  13 in total

Review 1.  STAT signaling in polycystic kidney disease.

Authors:  Sebastian Strubl; Jacob A Torres; Alison K Spindt; Hannah Pellegrini; Max C Liebau; Thomas Weimbs
Journal:  Cell Signal       Date:  2020-04-20       Impact factor: 4.315

Review 2.  Erythropoietin, a multifaceted protein with innate and adaptive immune modulatory activity.

Authors:  Chiara Cantarelli; Andrea Angeletti; Paolo Cravedi
Journal:  Am J Transplant       Date:  2019-04-25       Impact factor: 8.086

3.  From Initiation to Maintenance: HIV-1 Gp120-induced Neuropathic Pain Exhibits Different Molecular Mechanisms in the Mouse Spinal Cord Via Bioinformatics Analysis Based on RNA Sequencing.

Authors:  Jian Huang; Fei Lin; Yanling Hu; Chris Bloe Bloe; Dan Wang; Wenping Zhang
Journal:  J Neuroimmune Pharmacol       Date:  2022-01-21       Impact factor: 4.147

4.  Renoprotective potential of exogen erythropoietin on experimental ruptured abdominal aortic aneurysm model: An animal study.

Authors:  Gokalp Altun; Yavuz Cakiroglu; Zerrin Pulathan; Esin Yulug; Ahmet Mentese
Journal:  Iran J Basic Med Sci       Date:  2020-02       Impact factor: 2.699

5.  Synergistic renoprotective effects of sesame oil and erythropoietin on ischemic kidney injury after renal transplantation.

Authors:  Liyu Ye; Fang Xiao; Jijun Xie; Lingling Feng; Zhangjun Tang; E Chen; Chuchu Chen; Bowen Xu; Ronghai Deng
Journal:  AMB Express       Date:  2020-01-07       Impact factor: 3.298

6.  Renal Tubular Epithelial TRPA1 Acts as An Oxidative Stress Sensor to Mediate Ischemia-Reperfusion-Induced Kidney Injury through MAPKs/NF-κB Signaling.

Authors:  Chung-Kuan Wu; Chia-Lin Wu; Tzong-Shyuan Lee; Yu Ru Kou; Der-Cherng Tarng
Journal:  Int J Mol Sci       Date:  2021-02-25       Impact factor: 5.923

7.  The combination of vitamin D3 and erythropoietin alleviates acute kidney injury induced by ischemia-reperfusion via inhibiting inflammation and apoptosis.

Authors:  Long-Yan Qin; Xin Lin; Juan Liu; Rong Dong; Jing Yuan; Yan Zha
Journal:  Iran J Basic Med Sci       Date:  2021-02       Impact factor: 2.699

Review 8.  Adipose-Derived Stem/Stromal Cells in Kidney Transplantation: Status Quo and Future Perspectives.

Authors:  Gabriele Storti; Evaldo Favi; Francesca Albanesi; Bong-Sung Kim; Valerio Cervelli
Journal:  Int J Mol Sci       Date:  2021-10-17       Impact factor: 5.923

9.  Erythropoietin Ameliorates Ischemia/Reperfusion-Induced Acute Kidney Injury via Inflammasome Suppression in Mice.

Authors:  Jihye Kwak; Jin Hyun Kim; Ha Nee Jang; Myeong Hee Jung; Hyun Seop Cho; Se-Ho Chang; Hyun-Jung Kim
Journal:  Int J Mol Sci       Date:  2020-05-13       Impact factor: 5.923

10.  Calreticulin Blockade Attenuates Murine Acute Lung Injury by Inducing Polarization of M2 Subtype Macrophages.

Authors:  Zhilong Jiang; Zhihong Chen; Lu Hu; Lin Qiu; Lei Zhu
Journal:  Front Immunol       Date:  2020-01-30       Impact factor: 7.561

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.