| Literature DB >> 29104643 |
Tao Zhou1, Shanliang Guo1, Shaolin Wang1, Qiong Li1, Mingsheng Zhang1.
Abstract
This study was designed to investigate possible protective effects of sevoflurane on myocardial ischemia-reperfusion injury (MIRI) and its impact on expression of HIF-1α and caspase-3 in rats, so as to provide new insights for the treatment of MIRI. Forty SD rats were randomly divided into four groups (n=10) including Sham operation (Sham), ischemia-reperfusion (IR), sevoflurane preconditioning group (Sevo-Pre) and sevoflurane post-conditioning (Sevo-Post) groups. Perfusion was performed using ex vivo heart perfusion. The baseline values of cardiac function were recorded in each group at the end of balanced perfusion and after 60 min of reperfusion. Myocardial infarct size (MIS) was calculated at the end of perfusion using TTC staining. Levels of HIF-1α and caspase-3 protein and HIF-1α (western blotting) and Bcl-2 mRNA (RT-qPCR) were detected at the end of reperfusion. Our results showed no significant differences in cardiac function between the groups at the end of the balanced perfusion. After reperfusion for 60 min, however, the cardiac functions of the Sevo-Pre and Sevo-Post groups were significantly better than those in the IR group, and the MIS at the end of reperfusion was significantly decreased. Western blotting and RT-qPCR showed that expression of HIF-1α protein was significantly increased, expression of caspase-3 protein was significantly decreased and expression of HIF-1α and Bcl-2 mRNA were significantly increased in Sevo-Pre and Sevo-Post groups compared with the levels in the IR group at the end of reperfusion. There were no significant differences in experimental results between Sevo-Pre and Sevo-Post groups. Our data support the idea that sevoflurane can improve MIRI in rats by improving cardiac function and reducing MIS. This protective effect seems to be achieved by activation of HIF-1α and inhibition of caspase-3.Entities:
Keywords: HIF-1α; caspase-3; myocardial ischemia-reperfusion injury; sevoflurane
Year: 2017 PMID: 29104643 PMCID: PMC5658739 DOI: 10.3892/etm.2017.5078
Source DB: PubMed Journal: Exp Ther Med ISSN: 1792-0981 Impact factor: 2.447
Sequence of primers used in real-time qPCR.
| Primer | Sequence (5′-3′) |
|---|---|
| HIF-1α | F: GACACCGCGGGCACCGATTC |
| R: TGCTTCGCCGAGATCGTGCTG | |
| Bcl-2 | F: TGAACCGGCATCTGCACAC |
| R: CGTCTTCAGAGACAGCCAGGAG | |
| ACTB | F: CAGGGCGTGATGGTGGGCA |
| R: CAAACATCATCTGGGTCATCTTCTC |
F, forward; R, reverse.
Effect of sevoflurane treatment on hemodynamic parameters of IR treated hearts.
| Group | HR/beats·min−1 | LVDP/kPa | LVEDP/kPa | +dp/dtmax/kPa·s−1 | −dp/dtmax/kPa·s−1 |
|---|---|---|---|---|---|
| End of balanced perfusion | |||||
| Sham | 307±13 | 15.7±1.4 | 0.74±0.13 | 436±17 | 338±24 |
| I-R | 310±11 | 15.9±2.0 | 0.79±0.24 | 452±13 | 324±31 |
| Sevo-Pre | 303±18 | 16.3±1.8 | 0.82±0.11 | 446±21 | 340±17 |
| Sevo-Post | 310±12 | 15.3±2.2 | 0.77±0.16 | 449±23 | 334±24 |
| 60 min reperfusion | |||||
| Sham | 298±12 | 16.3±1.5 | 0.78±0.13 | 424±16 | 328±18 |
| I-R | 173±15[ | 7.8±2.6[ | 4.34±1.35[ | 283±12[ | 189±23[ |
| Sevo-Pre | 256±13[ | 10.2±1.5[ | 3.26±0.45[ | 326±15[ | 223±13[ |
| Sevo-Post | 263±17[ | 11.0±1.4[ | 3.49±0.56[ | 324±21[ | 234±17[ |
Compared with Sham group
P<0.01; compared with I-R group
P<0.05; compared with I-R group
P<0.01.
Figure 1.Graph showing effect of sevoflurane treatment on MIS, as evidenced on TTC staining. **P<0. 01, nsP>0.05.
Figure 2.Effect of sevoflurane treatment on the expression of (A) HIF-1α and (B) caspase-3 proteins as seen by western blot analysis. Compared with Sham group, △△P<0.01; compared with I-R group, *P<0.05; compared with I-R group, **P<0.01; nsP>0.05. β-actin was used to normalize the relative expression levels across groups.
Figure 3.Graph showing effect of sevoflurane treatment on the relative expression of HIF-1α and Bcl-2 mRNAs. Compared with Sham group, △△P<0.01; compared with I-R group, **P<0.01; nsP>0.05. β-actin was used to normalize expression levels for comparisons.