Literature DB >> 29104487

IER5 is involved in DNA Double-Strand Breaks Repair in Association with PAPR1 in Hela Cells.

Xin-Ping Yu1, Yu-Mei Wu1, Yang Liu1, Ming Tian1, Jian-Dong Wang1, Ku-Ke Ding2, Teng Ma3, Ping-Kun Zhou3.   

Abstract

The immediate early response gene 5 (IER5) is a radiation response gene induced in a dose-independent manner, and has been suggested to be a molecular biomarker for biodosimetry purposes upon radiation exposure. Here, we investigated the function of IER5 in DNA damage response and repair. We found that interference on IER5 expression significantly decreased the efficiency of repair of DNA double-strand breaks induced by ionizing radiations in Hela cells. We found that IER5 participates in the non-homologous end-joining pathway of DNA breaks repair. Additionally, we identified a number of potential IER5-interacting proteins through mass spectrometry-based protein assays. The interaction of IER5 protein with poly(ADP-Ribose) polymerase 1 (PARP1) and Ku70 was further confirmed by immunoprecipitation assays. We also found that Olaparib, a PARP1 inhibitor, affected the stability of IER5. These results indicate that targeting of IER5 may be a novel DNA damage response-related strategy to use during cervical cancer radiotherapy or chemotherapy.

Entities:  

Keywords:  DNA double strand break repair; IER5; Olaparib.; PARP1; cervical cancer; ionizing radiation

Mesh:

Substances:

Year:  2017        PMID: 29104487      PMCID: PMC5666564          DOI: 10.7150/ijms.21510

Source DB:  PubMed          Journal:  Int J Med Sci        ISSN: 1449-1907            Impact factor:   3.738


Introduction

Cervical cancer is a leading threat to women's health, especially in developing countries 1. The treatment for cervical cancer includes surgery, radiation, and chemotherapy. Concurrent chemoradiotherapy has been regarded as the standard treatment of locally advanced cervical cancer 2-5. Because of the widespread uptake of screening for the early detection of cervical cancer, its death rate has declined 1, 6. However, no significant improvements have been achieved in cervical cancer survival rate over the past three decades 7. Therefore, it is necessary to discover new and effective strategies for a favorable therapeutic outcome. Specific molecules involved in radiosensitivity have been the focus of many studies in recent years 8. One of such molecules, immediate early response gene 5 (IER5), was found to be induced by ionizing radiation (IR) in studies using cDNA microarray technology 9, 10. IER5 belongs to the immediate-early gene family, and encodes a protein of 327 amino acids, mostly located in the cytoplasm 11. IER5 can be induced by growth-promoting and oncogenic signals, IR and heat shock. IER5 plays a role in cell proliferation, and it inhibits cell proliferation through the reduction of Cdc25B expression, resulting in G2/M cell cycle arrest 11, 12. Additionally, IER5 interacts with protein phosphatase 2A (PP2A) and is involved in the generation of a hypophosphorylated active form of heat shock factor 1 (HSF1), contributing to proliferation and survival of cancer cells 13-15. Previous studies have shown that the expression of IER5 in response to radiation response is dose-independent 16. IER5 is involved in DNA damage repair. Therefore, it has been suggested that IER5 can be used as molecular biomarker for biodosimetry purposes 16, 17. However, whether IER5 functions in cervical cancer cellular response to radiation is still unclear. In the present study, we report that IER5 is involved in the DNA repair process. Specifically, IER5 participates in non-homologous end joining (NHEJ)-mediated DNA double strand breaks (DSBs) repair. Additionally, we used immunoprecipitation assays and mass spectrometry (MS) to identify the proteins that interact with IER5. Our study has established the foundation to further study the role of IER5 in cervical cancer, and hypothesized its use in cancer therapy.

Materials and methods

Patient samples and immunohistochemistry

Human cervical tissue samples were obtained from Beijing Biobank of Clinical Resources. The collection of human tissue samples was approved and supervised by the Ethics Committee of Beijing Obstetrics and Gynecology Hospital. Thirty-one cervical cancer tissues and 20 normal cervical tissues were obtained. Immunohistochemistry was carried out using the Ultra-Sensitive S-P kit (Boster Bioscience [Hubei Province, China] Co. LTD), following the manufacturer's instructions. The staining of IER5 was scored considering both the percentage of positive cells and intensity of the staining, as described previously 18. The number of positive cells was counted in at least ten fields for each section and analyzed with the Image Pro Plus software.

Cell culture and treatment

Hela cells were cultured in Dulbecco's modified Eagle's medium (Hyclone), supplemented with 10 % fetal calf serum (FBS, Sigma), and 100 U/ml penicillin and 100 mg/ml streptomycin (Hyclone). Cells were incubated at 37 ºC, in a 5 % CO2 incubator. Cells were irradiated with 60Co γ-rays at a dose rate of 1.98 Gy/min at room temperature. Cells were treated with 10 μM Olaparib (Selleck), MG132 (Merck), or cycloheximide (CHX, Sigma), as indicated; stock solution were prepared in dimethyl sulfoxide (DMSO ).

Reverse transcription and quantitative polymerase chain reaction

Total RNA was extracted from cells using TRIzol (Invitrogen). Reverse transcription (RT-PCR) was carried out using the ReverTra Ace qPCR RT Master Mix with gDNA Remover kit (TOYOBO), following the manufacturer's instructions. Quantitative PCR (qPCR) was performed with a Bio-Rad iCycler&iQ Real-time PCR system (Bio-Rad) and a fluorescence-labeled SYBR Green real master Mix kit (TIANGEN Biotech [Beijing] Co. LTD). The mRNA primers were as follows: IER5 (forward: 5'CCGGGAACGTGGCTAACC3'; reverse: 5'TTCCGTAGGAGTCCCGAGAA3'); β-actin (forward: 5'GCGCGGCTACAGCTTCA3'; reverse: 5'CTTAATGTCACGCACGATTTCC3').

Plasmids, RNA interference and cell transfection

The cDNA of IER5 was amplified by RT-PCR from total RNA extracted from Hela cells and cloned into the pCMV plasmid in frame with the sequence encoding 3×FLAG epitopes (p3×FLAG-IER5-CMV). To specifically knock down gene expression in Hela cells, the following small interfering RNAs (siRNAs) were used: native control siRNA (siNC) (UUCUCCGAACGUGUCACGUTT), siIER5 (CCUCAUCAGCAUCUUCGGUUU), si53BP1 (GAAGGACGGAGUACUAAUATT), siRAD51 (GAAGCUAUGUUCGCCAUUATT). The pDR-GFP, pEGFP-Pem1-Ad2 and pCherry plasmids and I-SceI had been previously obtained by our laboratory. Hela cells were seeded into 6-well plates or 100 mm culture plates and cultured in medium without antibiotics; siRNAs or plasmids were transfected into cells using Lipofectamine 2000 (Invitrogen), following the manufacturer's recommendations. Cells were harvested 36/48 h after transfection and subjected to the specified assays.

Western blot analysis

Cells were lysed in lysis buffer (Thermo); equal amounts of protein were separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred onto polyvinylidene fluoride membranes. The membranes were blocked with 5 % milk in TBST (20 mM Tris-HCl, 500 mM NaCl [pH7.5], 0.1 % [v/v] Tween 20) for 1 h at room temperature, and incubated with the primary antibodies overnight at 4 °C. Membranes were then incubated with the appropriate secondary antibody for 1 h at room temperature, and washed with TBST. Bands were visualized using the Image quant LAS500 system (GE). Antibodies used in this study: anti-IER5 goat polyclonal antibody (Abcam), anti-IER5 rabbit polyclonal antibody (Santa Cruz), anti-GAPDH mouse monoclonal antibody (Zhong Shan Jin Qiao), anti-PARP1 rabbit monoclonal antibody (Santa Cruz), anti-Ku70 mouse monoclonal antibody (Abcam), anti-Ku80 rabbit monoclonal antibody (Santa Cruz), anti-FLAG M2 mouse monoclonal antibody (Sigma), anti-53BP1 rabbit polyclonal antibody (Santa Cruz), anti-RAD51 rabbit polyclonal antibody (Proteintech), anti-γH2AX mouse monoclonal antibody (Millipore), anti-Ubiquitinylated proteins mouse monoclonal antibody (Millipore), and anti-PADPR mouse monoclonal antibody (Abcam).

Neutral comet assay

Hela cells were collected at 0 h (mock treated), 10 min, 1 h, 4 h and 6 h after treatment with IR (4 Gy). Neutral Comet assays were performed using the Single Cell Gel Electrophoresis Assay kit (Trevigen), according to the manufacturer's instructions. Comet tail moments (TM) of 50 cells in each experiment were measured under microscope and analyzed with the CASPLab (version1.2.3) software. The results from three independent experiments were analyzed by ANOVA.

Immunoprecipitation

Hela Cells were transfected with the p3×FLAG-IER5-CMV plasmid; 36 h later, the cells were irradiated with IR (4Gy). Cells were lysed with lysis buffer (20 mM Tris-HCl [pH8.0]; 100 mM NaCl; 0.5 % Nonidet P 40; 1 mM EDTA; protease inhibitor cocktail [Roche]) and centrifuged at 12000 g for 10 min at 4 °C. Cells lysates were precleared using protein A/G agarose beads (Santa Cruz) and incubated with anti-FLAG M2 affinity gel (Sigma) for 2 h at 4 °C. The gels with bound immuno complexes were then washed with lysis buffer for three times and subjected to SDS-PAGE, Coomassie Brilliant Blue staining and western blot analysis using specific antibodies.

NHEJ and homologous recombination (HR) assays

Hela cells were transfected first with siRNAs and, after 48 h, alternatively with the pEGFP-Pem1-Ad2 (a NHEJ reporter) linearized with the restriction enzymes HindIII or I-SceI or the pDR-GPF (a HR reporter) plasmids. The pCherry plasmid was used as a control for transfection efficiency. After 12/72 h, cells were collected for fluorescence-activated cell sorter (FACS) analyses of the GFP+/pCherry+ cells, which indicated the efficiency of NHEJ or HR.

Statistical analysis

The SPSS version 18.0 software was used for all statistical analysis. The data were calculated and shown as mean ± SEM of at least three experiments. The one-way ANOVA, χ2 test and student's t-test were used to assess the statistical significance of differences. The Database for Annotation, Visualization and Integrated Discovery (DAVID) online database was used to analyze the MS report. Statistical significance was defined as p < 0.05.

Results

The expression of IER5 was higher in tumor tissues than in normal cervical tissues

We analyzed the expression of IER5 in 31 cervical cancer tissues samples and 20 normal cervical tissue samples. The expression of IER5 was largely localized in the cytoplasm and significantly increased in cancer samples (Fig. 1). Specifically, 93.5 % (29 of 31) of the cancer samples showed IER5 expression, whereas 35 % of normal cervices (7 of 20) were IER5-positive (Table 1).
Figure 1

Immunohistochemistry analysis of IER5 expression in cervical cancer and normal samples. × 200 magnification: the samples of cervical cancer show strong expression of IER5.

Table 1

Immunohistochemical analysis of IER5 in cervical cancers and normal cervical samples

Immunohistochemical stainingTumorNormal
Positive297
Negative213
Total3120
χ2 testP <0.05

Suppression of IER5 was associated with a DSB repair defect

We previously reported that IER5 expression is induced in response to DSBs 19, 20. Additionally, IER5 has been indicated as a potential biomarker to radiation exposure 16. To address the role of IER5 in DSBs, we compared the DNA damage response in Hela cells untreated (siNC) or treated with siIER5 (to knockdown IER5 expression), upon IR exposure (4 Gy). We analyzed the phosphorylation of H2AX at Ser 139 (γH2AX), a marker of DSBs 21, in the cells at different time points after IR treatment. We found that the amount of γH2AX in IER5-depleted cells increased dramatically at 0.5 h after IR exposure compared to the control cells, and persisted up to 10 h after irradiation (Fig. 2a and b).
Figure 2

IER5-depleted cells show a DSB repair defect. a. IER5-depleted Hela cells were treated with 4 Gy of IR, and γH2AX levels were detected by western blot at different time points after irradiation. b. Quantification of γH2AX levels based on densitometric scanning of the immunoblotting signals of γH2AX shown in a. c. Detection of DSBs by a neutral comet assay in siNC- and siIER5-treated Hela cells subjected to IR (4Gy). d. Quantification of comet tail moment (averages ± SD) with the CASPLab software. Fifty cells per group were examined.

Next, we performed neutral comet assays to further demonstrate the suppression of IER5 was associated with a DSBs repair defect. It is known that, in a neutral comet assay, TM values are positively correlated with the degree of DNA damage 22. The majority of cells appeared damaged 10 min after IR, showing large comet tails, while 6 h after IR, the damage was repaired in most cells and comet tails returned to background levels. In IER5-depleted cells, the TM values were significantly higher than in control cells 10 min, 1 h and 4 h after IR (Fig. 2c and d). Taken together, these results indicated that the suppression of IER5 renders the cells more sensitive to DNA damage.

IER5 regulates NHEJ-mediated DSBs repair

Because IER5 is a DNA damage-related protein, we decided to investigate which specific DNA repair process IER5 is involved in. NHEJ and HR are two key pathways in the repair of DSBs 23. We first looked at the NHEJ repair pathway, by performing an NHEJ assay in which the rejoining of a previously linearized plasmid (cut between the promoter and the GFP coding sequence), allows the expression of GFP 24. We depleted IER5 or 53BP1, a key factor in NHEJ 25, in Hela cells, through RNA interference (Fig.3a), and transfected the linearized pEGFP-Pem1-Ad2 plasmid along with the pCherry expression plasmid to monitor the transfection efficiency. The NHEJ efficiency was indicated by the percentage of GFP+/Cherry+ cells in FACS analyses. We found that the depletion of IER5, similarly to that of 53BP1, was associated with a lower efficiency of NHEJ (Fig. 3b and c).
Figure 3

IER5 regulates NHEJ-mediated DSB repair. a. Western blot indicating IER5 and 53BP1 knockdown by specific siRNAs. b. FACS analyses of NHEJ assay in Hela cells treated with IER5 and 53BP1 siRNAs. c. Quantification of the NHEJ assay. d. Western blot indicating IER5 and RAD51 knockdown in Hela cells upon treatment with specific siRNAs. e. Efficiency of HR, as analyzed by FACS. f. Quantification of the HR assay.

Next, we assessed whether IER5 also plays a role in HR. The pDR-GFP plasmid contains two non-functional GFP genes and an I-SceI cleavage site in the first GFP cassette. When I-SceI produces a DSB in the GFP gene, its sequence can be repaired by HR, forming a functional GFP gene 26. The pCherry expression plasmid was co-transfected with the HR reporter to monitor the transfection efficiency. We depleted IER5 or RAD51, a key factor in HR 27, in Hela cells using siRNAs (Fig. 3d) and measured the percentage of GFP+/Cherry+ cells in FACS analyses. Depletion of IER5 did not affect the percentage of GFP+/Cherry+ cells (Fig. 3e and f) and therefore the efficiency of HR. These results suggested that IER5 plays a role in NHEJ-mediated DSB repair, but is not involved in DSB repair through HR.

IER5 interacts with poly(ADP-ribose) polymerase 1 (PARP1) and Ku70

To further investigate how IER5 mediates DSB repair, we constructed the p3×FLAG-IER5-CMV plasmid to perform immunoprecipitation experiments. The expression of FLAG tagged-IER5 was verified by western blot (Fig. 4a). Next, Hela cells were transfected with the p3×FLAG-IER5-CMV plasmid and immunoprecipitation assays were performed to identify potential IER5-binding partners. The immunoprecipitates were separated by 12 % SDS-PAGE and Coomassie Brilliant Blue staining was used to visualize the proteins on the gels as bands (Fig. 4b). Chosen bands were cut from the gel and analyzed by MS. A total of 347 and 256 proteins were identified in irradiated and non-irradiated samples, respectively; these proteins were further analyzed using the DAVID online database. Ten proteins were associated with DNA metabolic processes and DNA repair (Table 2). Co-immunoprecipitation assays demonstrated that PARP1 and Ku70 interacted with IER5 in Hela cells (Fig. 4c). In western blot assays, we examined the PARylation status of IER5 under IR stress, and found it is not affected by DNA damage cells (Fig. 4d). Furthermore, PARP1 levels decreased in IER5-deficient cells compared control cells (Fig. 4e).
Figure 4

IER5 interacts with PARP1 and Ku70. a. the expression of the 3×FLAG tagged-IER5 fusion protein was verified by western blot. b. To identify IER5 interacting proteins, Hela cells stably expressing FLAG-tagged IER5 were irradiated with IR (4Gy). Immunoprecipitates were isolated from cell lysates using the anti-FLAG M2 affinity gel, separated on a 12% SDS-PAGE gel and subsequently subjected to Coomassie Brilliant Blue staining. c. The poly(ADP-ribose) polymerase (PARP1) protein and Ku70 were identified as IER5-interacting proteins by western blot. d. Hela cells were exposed to IR (4Gy) or mock-treated, and immunoprecipitation assays were performed using an anti- IER5 antibody. The immunoprecipitates were blotted and probed with a PAR antibody. e. Decreased level of PARP1 protein in IER5-depleted Hela cells.

Table 2

MS and DAVID online database analysis of IER5 interacting protein

protein IDprotein namescorematches
gi|7582386Bcl-2-associated transcription factor short form43517
gi|1806048nuclear DNA helicase II43318
gi|178152poly(ADP-ribose) polymerase1033
gi|460771hnRNP-E1843
gi|4503841X-ray repair cross-complementing protein 6783
gi|31645glyceraldehyde-3-phosphate dehydrogenase683
gi|35053uracil DNA glycosylase633
gi|1575536regulator of nonsense transcript stability512
gi|5881961Dhm1-like protein482
gi|386772histone H3362

Olaparib decreased the stability of IER5

PARP1 is thought to act as a key regulator of DNA repair 28 and its inhibitor, Olaparib, has been approved for clinical cancer treatment 29. Considering the above findings, we wondered whether the catalytic activity of PARP1 would correlate with the expression of IER5 protein in Hela cells. Western blot assays were performed to detect the amount of IER5 at different time points after treatment of the cells with Olaparib (10 μM). Olaparib was associated with the decrease in the levels of IER5 6 h after the treatment (Fig. 5a). The mRNA level of IER5 was determined by qPCR in Olaparib-treated and control cells. Surprisingly, the mRNA level of IER5 was increased in Olaparib-treated cells (Fig. 5b), suggesting that the down regulation of IER5 in these cells may be the result of increased protein degradation.
Figure 5

Olaparib decreases the stability of IER5. a. The treatment of cells with the PARP1 inhibitor Olaparib (10 μM) decreased IER5 expression. b. IER5 mRNA increased in cells treated with 10 μM Olaparib for the indicated times. c. IER5 protein stability decreased after Olaparib treatment. d. The ubiquitinylation of IER5 protein increased after Olaparib treatment.

To prove this hypothesis, Hela cells were treated with Olaparib and the protein synthesis inhibitor CHX and harvested at different times after treatment. The degradation of IER5 was significantly faster in the presence of Olaparib (Fig. 5c), indicating that PARP1 activity is required for IER5 stability. Finally, we examined whether Olaparib regulates IER5 protein stability via proteasome-mediated degradation. Hela cells were pretreated with DMSO or 10 μM Olaparib for 2 h and further incubated with the proteasome inhibitor MG132 (10 μM) for 6 h. The ubiquitination of IER5 increased in Olaparib-treated cells (Fig. 5d), suggesting that Olaparib promotes the degradation of IER5 through the ubiquitin-proteasome system.

Discussion

Previous studies have suggested that higher IER5 expression is associated with poor prognosis in various cancer patients 13. Ahn et al. reported that IER5 is upregulated (89.3 folds) in cervical cancer specimens compared to normal ones 30. However, the relationship between IER5 expression and function has not been fully understood, so far. In this study, we explored the mechanisms through which IER5 is involved in DNA repair in Hela cells. After IR, DNA damage was more severe in IER5-depleted cells than in control cells. Additionally, PARP1 and Ku70, important factors in DNA repair, were identified as IER5-interacting proteins. PARP1 is activated by DNA strand breaks and polyADP ribosylates various acceptor molecules to facilitate DNA repair: the posttranslational modification (PTM) of proteins through PARylation is one of the immediate events in DNA damage 28, 31. DNA damage-induced PTMs, such as phosphorylation, ubiquitylation, PARylation, SUMOylation, neddylation, methylation and acetylation, play a central role in DNA damage response 32. Interestingly, it has been reported that IER5 can change the PTMs of HSF1 under heat shock condition: specifically, IER5, forms a ternary complex with HSF1 and protein phosphatase 2 (PP2A), and dephosphorylates HSF1 at numbers of serine and threonine residues 11, 13, 14. Our work indicates that IER5 is a possible PARP1 substrate and that the levels of PARP1 decrease in IER5-depleted Hela cells. The interactions between IER5 and Ku70 or PARP1 are valuable for further studies in the NHEJ-mediated DSB repair. Ku70, a DNA binding protein, dimerizes with Ku80, and Ku70/Ku80 complex recognizes DNA DSBs and recruits the DNA-dependent protein kinase catalytic subunit (DNA-PKcs); the Ku70/Ku80/DNA-PKcs complex mediates NHEJ and repairs DSBs 23, 33. In addition, PARP1 also interacts with DSBs repair proteins and participates in the NHEJ repair pathway 34. Since PARP1 inhibitors sensitize tumors to radiation and chemotherapeutic agents that induce DNA DSBs, they have been used cancer treatment 34. Olaparib has undergone the most comprehensive evaluation in this regard: notably, it is the first inhibitor used as single antitumoral agent in the treatment of tumors associated with BRCA1 or BRCA2 mutations 29, 35 and has been approved for the clinical treatment of ovarian and breast cancer in 2014. Some studies have shown improved overall survival associated with the use of Olaparib in ovarian cancer treatment 36. In our study, we found that the inhibition of PARP1 by Olaparib accelerates IER5 degradation in Hela cells. Our findings suggest that the interaction between IER5 and PARP1 might be important for cervical cancer. Though the mechanisms are not fully understood yet, it provides insight for possible novel therapies to treat cervical cancer. Our observations suggest that IER5 is a novel regulator of the NHEJ pathway for DNA DSB repair, possibly through its interaction with PARP1 and Ku70. However, further studies are necessary to fully uncover mechanism of IER5 function.
  35 in total

1.  Microarray analysis of radiation response genes in primary human fibroblasts.

Authors:  Enikö Kis; Tünde Szatmári; Márton Keszei; Róbert Farkas; Olga Esik; Katalin Lumniczky; András Falus; Géza Sáfrány
Journal:  Int J Radiat Oncol Biol Phys       Date:  2006-10-25       Impact factor: 7.038

Review 2.  Cervical cancer: screening, diagnosis and staging.

Authors:  Panagiotis Tsikouras; Stefanos Zervoudis; Bachar Manav; Eirini Tomara; George Iatrakis; Constantinos Romanidis; Anastasia Bothou; George Galazios
Journal:  J BUON       Date:  2016 Mar-Apr       Impact factor: 2.533

3.  Randomized comparison of fluorouracil plus cisplatin versus hydroxyurea as an adjunct to radiation therapy in stage IIB-IVA carcinoma of the cervix with negative para-aortic lymph nodes: a Gynecologic Oncology Group and Southwest Oncology Group study.

Authors:  C W Whitney; W Sause; B N Bundy; J H Malfetano; E V Hannigan; W C Fowler; D L Clarke-Pearson; S Y Liao
Journal:  J Clin Oncol       Date:  1999-05       Impact factor: 44.544

4.  Dose-dependent expression changes of early response genes to ionizing radiation in human lymphoblastoid cells.

Authors:  Xian-Hui Long; Zeng-Qiang Zhao; Xing-Peng He; Hui-Ping Wang; Qin-Zhi Xu; Jing An; Bei Bai; Jian-Li Sui; Ping-Kun Zhou
Journal:  Int J Mol Med       Date:  2007-04       Impact factor: 4.101

5.  gamma-H2AX dephosphorylation by protein phosphatase 2A facilitates DNA double-strand break repair.

Authors:  Dipanjan Chowdhury; Michael-Christopher Keogh; Haruhiko Ishii; Craig L Peterson; Stephen Buratowski; Judy Lieberman
Journal:  Mol Cell       Date:  2005-11-28       Impact factor: 17.970

6.  [Poly(ADP-Ribose) polymerase 1 as a key regulator of DNA repair].

Authors:  S N Khodyreva; O I Lavrik
Journal:  Mol Biol (Mosk)       Date:  2016 Jul-Aug

7.  Cdc14A and Cdc14B Redundantly Regulate DNA Double-Strand Break Repair.

Authors:  Han Lin; Kyungsoo Ha; Guojun Lu; Xiao Fang; Ranran Cheng; Qiuhong Zuo; Pumin Zhang
Journal:  Mol Cell Biol       Date:  2015-08-17       Impact factor: 4.272

8.  Overexpression of hypoxia-inducible factor 1alpha indicates diminished response to radiotherapy and unfavorable prognosis in patients receiving radical radiotherapy for cervical cancer.

Authors:  Barbara Bachtiary; Monika Schindl; Richard Pötter; Bettina Dreier; Thomas Hendrik Knocke; Johannes A Hainfellner; Reinhard Horvat; Peter Birner
Journal:  Clin Cancer Res       Date:  2003-06       Impact factor: 12.531

9.  Radiation dose effect of DNA repair-related gene expression in mouse white blood cells.

Authors:  Ming-juan Li; Wei-wei Wang; Shi-wei Chen; Qian Shen; Rui Min
Journal:  Med Sci Monit       Date:  2011-10

Review 10.  Use of poly ADP-ribose polymerase [PARP] inhibitors in cancer cells bearing DDR defects: the rationale for their inclusion in the clinic.

Authors:  Aniello Cerrato; Francesco Morra; Angela Celetti
Journal:  J Exp Clin Cancer Res       Date:  2016-11-24
View more
  4 in total

1.  Cdc25B is transcriptionally inhibited by IER5 through the NF-YB transcription factor in irradiation-treated HeLa cells.

Authors:  Lixin Ding; Xianzhe Zhao; Qiang Xiong; Xiaoyan Jiang; Xiaodan Liu; Kuke Ding; Pingkun Zhou
Journal:  Toxicol Res (Camb)       Date:  2021-07-29       Impact factor: 2.680

2.  Novel role of PAF1 in attenuating radiosensitivity in cervical cancer by inhibiting IER5 transcription.

Authors:  Jing-Jie Zheng; Yue He; Yang Liu; Feng-Shuang Li; Zhen Cui; Xiao-Meng Du; Chun-Peng Wang; Yu-Mei Wu
Journal:  Radiat Oncol       Date:  2020-05-29       Impact factor: 3.481

3.  High IER5 Gene Expression Is Associated With Poor Prognosis in Glioma Patients.

Authors:  Zijun Wu; Dan Wang; Fanxin Zeng; Yanrong Zhang; Guannan Zhu; Yiqi Ma; Bin Song; Su Lui; Min Wu
Journal:  Front Cell Dev Biol       Date:  2021-06-17

4.  Prediction of IER5 structure and function using a bioinformatics approach.

Authors:  Qiang Xiong; Xiaoyan Jiang; Xiaodan Liu; Pingkun Zhou; Kuke Ding
Journal:  Mol Med Rep       Date:  2019-04-15       Impact factor: 2.952

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.