The effect of dietary asparagine supplementation on energy metabolism in liver of weaning pigs when challenged with lipopolysaccharide.

OBJECTIVE: This experiment was conducted to investigate whether asparagine (Asn) could improve liver energy status in weaning pigs when challenged with lipopolysaccharide.
METHODS: Forty-eight weaned pigs (Duroc×Large White×Landrace, 8.12±0.56 kg) were assigned to four treatments: i) CTRL, piglets received a control diet and injected with sterile 0.9% NaCl solution; ii) lipopolysaccharide challenged control (LPSCC), piglets received the same control diet and injected with Escherichia coli LPS; iii) lipopolysaccharide (LPS)+0.5% Asn, piglets received a 0.5% Asn diet and injected with LPS; and iv) LPS+1.0% Asn, piglets received a 1.0% Asn diet and injected with LPS. All piglets were fed the experimental diets for 19 d. On d 20, the pigs were injected intraperitoneally with Escherichia coli LPS at 100 μg/kg body weights or the same volume of 0.9% NaCl solution based on the assigned treatments. Then the pigs were slaughtered at 4 h and 24 h after LPS or saline injection, and the liver samples were collected.
RESULTS: At 24 h after LPS challenge, dietary supplementation with 0.5% Asn increased ATP concentration (quadratic, p<0.05), and had a tendency to increase adenylate energy charges and reduce AMP/ATP ratio (quadratic, p<0.1) in liver. In addition, Asn increased the liver mRNA expression of pyruvate kinase, pyruvate dehydrogenase, citrate synthase, and isocitrate dehydrogenase β (linear, p<0.05; quadratic, p<0.05), and had a tendency to increase the mRNA expression of hexokinase 2 (linear, p<0.1). Moreover, Asn increased liver phosphorylated AMP-activated protein kinase (pAMPK)/total AMP-activated protein kinase (tAMPK) ratio (linear, p<0.05; quadratic, p<0.05). However, at 4 h after LPS challenge, Asn supplementation had no effect on these parameters.
CONCLUSION: The present study indicated that Asn could improve the energy metabolism in injured liver at the late stage of LPS challenge.

INTRODUCTION

L-asparagine (Asn) is non-essential amino acid. However, previous studies have demonstrated that weaning rats required Asn over a short period [1], and Asn could stimulate growth and protein synthesis of weaning rats. In addition, Asn can stimulate enterocyte proliferation [2,3] and improve jejunal enterocyte ornithine decarboxylase (ODC) activity [3,4]. Asparagine can be synthesized from aspartate and glutamine (or ammonia) by asparagine synthetase in mammals [5,6]. However, in liver, the rate of Asn synthesis is much less because of the lower Asn synthetase activity [7].

Asn has similar structure to aspartate, and it can be deaminated to form aspartate in an ATP-dependent amidation reaction [8]. Liver plays a pivotal role in the metabolism of the whole-body energy [9], such as stimulating fatty acid oxidation and glucose generation. LPS challenge could induce liver injury [10], which could cause insufficient energy supply in the liver [11]. Xu et al [12] reported that energy was necessary for a successful stress response. Our previous study has shown that dietary supplementation of aspartate improved energy status in lipopolysaccharide (LPS)-injured liver of weaning pigs [13]. Accordingly, we hypothesized that Asn could influence the energy metabolism in the liver in LPS-challenge weaning pigs. In this study, we measured the hepatic adenylate purine concentrations and the mRNA expression of key enzymes involved in glycolysis, tricarboxylic acid (TCA) cycle and fatty acid oxidation as well as AMP-activated protein kinase (AMPK) signaling pathway to examine the influence of Asn on energy metabolism in the liver in LPS-challenged weaning pigs.

MATERIALS AND METHODS

Animals

The Animal Care and Use Committee of Wuhan Polytechnic University approved the animal use protocol for this research. This experiment was conducted in the Hubei Key Laboratory of Animal Nutrition and Feed Science (Wuhan Polytechnic University, Wuhan, China). In this study, a total of 48 weaned castrated male pigs (Duroc×Large White×Landrace, 8.12±0.56 kg, weaned at 21±2 d of age ) were purchased from the Hubei Zhengda Swine Co., Ltd (Wuhan, Hubei, China), and individually housed in the stainless steel cages (length 1.08 m, width 0.98 m, height 0.84 m). All pigs were housed in an environmentally controlled room (temperature 28°C and natural light), and allowed ad libitum access to water and feed during a 19-d experimental period.

Experimental design

Based on the BW, forty-eight piglets were randomly assigned to four treatments (two sampling times), i) non-challenged control (CTRL; piglets received a control diet and injected with 0.9% NaCl solution); ii) lipopolysaccharide (LPS)-challenged control (LPSCC; piglets received the same control diet and injected with Escherichia coli LPS ); iii) LPS+0.5% Asn treatment (piglets received a 0.5% Asn diet and injected with LPS); and iv) LPS+1.0% Asn treatment (piglets received a 1.0% Asn diet and injected with LPS). There were six replicates (n = 6) for each treatment in each sampling time, and each replicate had one pig. In this study, the dose of the Asn (L-Asn, purity >99%; Amino Acid Bio-Chemical Co, Wuhan, China) and LPS (Escherichia coli serotype 055: B5, Sigma Chemical Inc., St. Louis, MO, USA) were determined on the basis of our previous studies [14]. The control diet was prepared to meet or exceed NRC [15] nutrient requirements (Table 1), and the diets were isonitrogenous by supplementation of L-alanine (purity >99%; Amino Acid Bio-Chemical Co, China). During the entire 19 d feeding trial (pre-challenge), there were no differences in average daily gain, average daily feed intake and feed:gain ratio among the four treatment groups (data not shown). On d 19, the LPS-challenged pigs were injected intraperitoneally with 500 μg/mL Escherichia coli LPS at 100 μg/kg BW (0.2 mL/kg BW), and the pigs in control group were injected with the same volume of 0.9% NaCl solution. LPS injection caused fever, somnolence, anorexia, vomiting, and shivering within 1 h in all pigs. At 4 h or 24 h (n = 6) after LPS or saline injection, pigs were slaughtered under anesthesia with an intravenous injection of sodium pentobarbital (50 mg/kg BW), and a portion of the liver (approximately 3 g) was removed and frozen in liquid nitrogen immediately. One part of the liver sample (approximately 1 g) was used for measuring ATP, ADP, and AMP concentrations, and another part (approximately 2 g) was then stored at −80ºC for mRNA and protein expression analysis.

Table 1

Ingredients and nutritional composition of diet (as fed basis)

Items	Content
Ingredients (%)
Corn	55.50
Soybean meal (44% crude protein)	22.00
Wheat bran	3.00
Fish meal	5.50
Corn oil or fish oil	5.00
Soy protein concentrate	2.50
Milk-replacer powder	3.00
Limestone	0.70
Dicalcium phosphate	1.00
Salt	0.20
L-Lysine·HCl (78.8% Lysine)	0.27
Acidifier1)	0.20
Butylated hydroquinone	0.05
Preservative2)	0.05
Sweetener3)	0.03
Vitamin and mineral premix4)	1.00
Nutrient composition (g/kg)
Digestible energy5) (MJ/kg)	14.0
Crude protein6)	202
Calcium6)	9.0
Phosphorus6)	7.0
Lysine6)	13.5
Methionine+cysteine6)	7.2
Aspartate+asparagine6)	16.9

A compound acidifier including lactic acid and phosphoric acid, provided by Wuhan Fanhua Biotechnology Company, Wuhan, China.

A compound mould inhibitor including calcium propionate, fumaric acid, fumaric acid monoethyl ester and sodium diacetate, provided by Sichuan Minsheng Pharmaceutical Co., Ltd, Chengdu, China.

A compound sweetener including saccharin sodium and disodium 5′-guanylate, provided by Wuhan Fanhua Biotechnology Company, Wuhan, China.

The premix provided the following amounts per kilogram of complete diet: retinol acetate, 2,700 μg; cholecalciferol, 62.5 μg; dl-α-tocopheryl acetate, 20 mg; menadione, 3 mg; vitamin B12, 18 μg; riboflavin, 4 mg; niacin, 40 mg; pantothenic acid, 15 mg; choline chloride, 400 mg; folic acid, 700 μg; thiamin, 1.5 mg; pyridoxine, 3 mg; biotin, 100 μg; Zn, 80 mg (ZnSO4·7H2O); Mn, 20 mg (MnSO4·5H2O); Fe, 83 mg (FeSO4·H2O); Cu, 25 mg (CuSO4·5H2O); I, 0.48 mg (KI); Se, 0.36 mg (Na2SeO3·5H2O).

Calculated.

Analyzed.

ATP, ADP, and AMP concentrations in the liver

The ATP, ADP, and AMP concentrations in the liver were measured with high performance liquid chromatography (HPLC) according to a published method [16]. Briefly, the supernatant was prepared from the liver. As for the HPLC, the detection wavelength was 260 nm, and the column temperature and the pump flow was 35ºC and 1.0 mL/min, respectively. Total adenine nucleotide (TAN) and adenylate energy charges (AEC) were calculated using the following equations: TAN = ATP+ ADP+AMP; AEC = (ATP+0.5ADP)/(ATP+ADP+AMP) [16].

mRNA abundance analysis by real-time PCR

Total RNA was isolated from pig liver by Trizol (#9108, TaKaRa Biotechnology [Dalian] Co., Ltd., Dalian, China). cDNA was synthesized with Prime Script RT reagent kit with gDNA eraser according to the producer instructions (#RR047A, TaKaRa Biotechnology [Dalian] Co., Ltd., China). The expression of the target genes were analyzed by the real-time polymerase chain reaction (PCR) with an Applied Biosystems 7500 Real-Time PCR System (Applied Biosystems, Life Technologies, Foster City, CA, USA) using a SYBR Premix Ex TaqTM (Tli RNaseH Plus) qPCR kit (#RR420A, TaKaRa Biotechnology [Dalian] Co., Ltd., China). The PCR program was as follows: 95°C for 30 s, followed by 40 cycles of 95°C for 5 s and 60°C for 34 s. The target genes were amplified by using the forward and reverse primers, which were designed with Primer Premier 6.0 and synthesized by TaKaRa Biotechnology (China, Table 2), and their mRNA expression relative to housekeeping gene (glyceraldehyde-3-phosphate dehydrogenase) were calculated according to the 2−ΔΔCT method [17].

Table 2

Specific primer sequences for pigs used for real-time polymerase chain reaction

Gene	Forward (5′-3′)	Reverse (5′-3′)	Gene Bank No.	Sequences bp
Hexok 2	CTCATCACAACCGTTACCA	TGTCATTAGTGTCCTCATCC	NM_001122987.1	119
L-PFK	CTGCACCGCATCATGGA	CCCCATCACCTCCAGAACA	XM_003358990.1	84
PK	TCACTCCACAGACCTCAT	TACCTAGCCACCTGATGT	XM_003356683.1	123
PDH	GCAGACTTACCGTTACCAT	GATAGCCGAGTTCTTCCAA	XM_003360244.2	248
ACO	CTCGCAGACCCAGATGAAAT	TCCAAGCCTCGAAGATGAGT	AF185048	218
L-CPT-1	GGACCGCCACCTGTTCTGCCTCTA	GCCCCCTCCGCTCGACACATAC	AF288789	175
CS	TCTCAGCTCAGTGCAGCCATTACA	CTGCAACACAAGGTAGCTTTGCGA	NM_214276	145
ICDH β	TGTGGTTCCTGGTGAGAG	CGAGATTGAGATGCCGTAG	XM_003361597.1	149
ICDH γ	GGTGGAGAGCCTCAAGAT	TGGTGGTGTTGTCTACGA	XM_003360495.1	218
AMPKα1	AAATCGGCCACTACATCCTG	GGATGCCTGAAAAGCTTGAG	NM_001167633.1	187
AMPKα2	AACATGGACGGGTTGAAGAG	CGCAGAAACTCACCATCTGA	NM_214266.1	193
Sirt1	CTGGAACAGGTTGCAGGAAT	CCTAGGACATCGAGGAACCA	EU030283	144
PGC1α	GATGTGTCGCCTTCTTGTTC	CATCCTTTGGGGTCTTTGAG	NM_213963	93
GAPDH	CGTCCCTGAGACACGATGGT	GCCTTGACTGTGCCGTGGAAT	AF017079	194

Hexok 2, hexokinase 2; L-PFK, 6-phosphofructokinase (liver type-like); PK, pyruvate kinase; PDH, pyruvate dehydrogenase; ACO, acyl-coenzyme A oxidase; L-CPT-1, liver carnitine palmitoyltransferase I; CS, Citrate synthase; ICDH β, isocitrate dehydrogenase β; ICDH γ, isocitrate dehydrogenase γ; AMPK, AMP-activated protein kinase; Sirt1, silent information regulator 1; PGC1α, peroxisome proliferator activated receptor gamma coactivator-1α; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Protein abundance analysis by Western blot

The method for quantification of liver protein expression was carried out with Western blot as previously described [13]. Briefly, equal amounts of proteins in liver supernatant fluids were separated on 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and then transferred to blotting membrane for immunoblotting. The specific primary antibodies included rabbit phosphorylated AMPKα (pAMPKα; Thr172; 1:1,000, #2532) and rabbit anti-total AMPKα (tAMPKα; 1:1,000, #2535) (Cell Signaling Technology Inc., Danvers, MA, USA).

Statistical analysis

The experimental data were analyzed using SPSS 17.0 software (SPSS Inc., Chicago, IL, USA). T test was used to determine whether there was a significant difference between the data obtained in the LPS group (LPSCC, 0% Asn) and the data obtained in the control group, in order to determine the effect of LPS challenge on the weaned piglets. Linear and quadratic polynomial contrasts were used to determine the response to Asn supplementation among LPS-challenged pigs. All data were expressed as means±SE. The statistical significance level for all analyses was set at p≤0.05 and 0.05

RESULTS

Concentrations of ATP, ADP, and AMP in the liver

As shown in Table 3, LPS challenge had no effect on the ATP, ADP, and AMP concentrations (p>0.1) at 4 or 24 h post-injection. Dietary supplementation with Asn had no effect on the concentrations of ATP, ADP, and AMP at 4 h after LPS challenge (p>0.1), however, dietary Asn supplementation increased ATP and ADP concentrations (quadratic, p<0.05), and had a tendency to increase AEC (quadratic, p<0.1) and reduce AMP/ATP ratio (quadratic, p<0.1) at 24 h after LPS challenge.

Table 3

The effect of Asn supplementation on the ATP production in liver at 24 h after Escherichia coli lipopolysaccharide challenge in weaned pigs1)

Item	CTRL2)	LPSCC2)	LPS+0.5% Asn2)	LPS+1.0% Asn2)	SEM	p value
						Control vs LPSCC	Linear	Quadratic
4 h post-challenge
ATP (μg/g wet wt)	280	143	206	172	67	0.129	0.558	0.340
ADP (μg/g wet wt)	143	122	142	133	32	0.308	0.789	0.865
AMP (μg/g wet wt)	443	419	291	391	51	0.611	0.759	0.101
TAN3) (μg/g wet wt)	866	684	639	695	85	0.086	0.836	0.684
AEC4)	0.38	0.31	0.42	0.35	0.06	0.220	0.629	0.182
AMP/ATP	2.18	3.17	1.54	3.17	0.91	0.230	0.918	0.171
24 h post-challenge
ATP (μg/g wet wt)	256	218	375	223	54	0.514	0.399	0.008
ADP (μg/g wet wt)	176	138	211	86	41	0.426	0.725	0.025
AMP (μg/g wet wt)	365	447	431	392	60	0.147	0.467	0.713
TAN3) (μg/g wet wt)	796	802	1017	701	114	0.962	0.93	0.038
AEC4)	0.42	0.36	0.47	0.39	0.05	0.235	0.254	0.063
AMP/ATP	1.67	2.25	1.28	1.77	0.41	0.271	0.133	0.098

Asn, asparagine; LPSCC, lipopolysaccharide challenged control; LPS, lipopolysaccharide; SEM, standard error of the mean; TAN, total adenine nucleotide; AEC, adenylate energy charges.

Values are means±SE, n = 6 (1 pig/pen).

CTRL (non-challenged control), piglets receiving a control diet and injected with 0.9% NaCl solution; LPSCC (LPS challenged control), piglets receiving the same control diet and injected with Escherichia coli LPS; LPS+0.5% Asn, piglets receiving a 0.5% Asn diet and injected with LPS; LPS+1.0% Asn, piglets receiving a 1.0% Asn diet and injected with LPS.

TAN = ATP+ADP+AMP.

AEC = (ATP+0.5ADP)/(ATP+ADP+AMP).

mRNA expression of genes related to the energy metabolism

As shown in Table 4, at 4 h post-injection, LPS challenge up-regulated the mRNA expression of liver hexokinase (Hexok) 2, and down-regulated the mRNA expression of 6-phosphofructokinase (liver type-like) (L-PFK), pyruvate dehydrogenase (PDH), acyl-coenzyme A oxidase, and liver carnitine palmitoyltransferase (L-CPT)-1 (p<0.05). Asn supplementation had no effect on mRNA expression of the key enzymes involved in glycolysis, TCA cycle and fatty acid oxidation after 4 h LPS challenge (p>0.1). However, at 24 h post-challenge, LPS challenge decreased mRNA expressions of PDH and citrate synthase (CS) (p<0.05). Asn supplementation increased pyruvate kinase (PK), PDH, CS, and isocitrate dehydrogenase (ICDH) β mRNA expression (linear, p<0.05; quadratic, p<0.05), and had a tendency to increase Hexok 2 mRNA expression (linear, 0.05